Penicillin acylases are a group of hydrolases originating from microorganisms, for example bacteria, that are capable of reversibly hydrolysing the 6- acyl group of penicillins or the 7-acyl group of cephalosporins to form the corresponding free amines without the ring structure of the penicillins or cephalosporins being destroyed. Reaction diagram I illustrates a hydrolysis reaction. A few examples of side chains R in the penicillin compound are phenylacetyl and phenoxyacetyl.

Penicillin G acylase (PenG acylase) is variously known as for example Penicillin G (PenG) amidase or Benzylpenicillin amidohydrolase (enzyme classification E. C. 3.5. 1. 11).

The production of semisynthetic lactam products requires the deacylation of the penicillins and cephalosporins produced from fermentation. Although rather efficient chemical routes are available for the deacylation, nowadays the enzymatic route is preferred in view of the high energy and solvents cost together with

some environmental problems associated with the chemical route. The enzymes, which may accomplish the deacylation of S-lactam compounds, are classified as hydrolases based on the chemical reaction they catalyse. However, those hydrolases, which are particularly useful in the deacylation of 9-lactam compounds, are usually referred to in the art as"acylases"or"amidases". These denominations as used in this specification have the same meaning. In connection with 9-lactam antibiotics these acylases usually are further specified as'; ß-lactam acylases"as not all amidases accept a 11-lactam nucleus as an acceptor/donor moiety for the acyl group.

Furthermore, several types of ß-lactam acylases may be envisaged, based on their substrate specificity and molecular structure.

The substrate specificity of the acylase is determined by a side chain binding pocket at the enzyme which recognizes the side chain moiety of 13-lactam molecules (R in Reaction diagram 1). In general, the acylases are not very specific for the moiety adjacent to the nitrogen atom of the amide group (this may be a ceph-3-em group, a penam group, an amino acid, a sugar, etc.

In the case of PenG acylases the preferred side chain moiety must be hydrophobic and is preferably phenylacetyl or (short) alkyl. PenG acylase is used commercially to hydrolyse PenG or Cephalosporin G (CefG) to phenylacetic acid on the one hand and 6-APA or 7-ADCA, respectively, on the other hand. These latter compounds are the most important intermediates for the industrial production of semi- synthetic penicillins and cephalosporins. Beside these major applications other have been reported for these enzymes such as blocking/deblocking of sensitive groups in organic synthesis and peptide chemistry, stereospecific conversions, optical resolution of phenylglycine, deesterification of carbinols, acylation of mono-bactams etc. In the various applications the enzyme may be used either in its native state or as immobilised preparation. Microbial whole cells containing the enzyme activity have also been used either as cell suspension or as immobilised cell preparation.

Examples of substrates which are not hydrolyzed by PenG acylases are those with charged acyl moieties such as dicarboxylic acids: succinyl, glutaryl, adipyl and also amino-adipyl, the side-chain of Cephalosporin C (CefC).

Penicillin V acylases are highly specific for phenoxyacetyl, while ampicillin acylase prefers D-phenylglycine as a side chain. Glutaryl-acylases deacylate glutaryl-7-ACA, which is prepared from CefC after enzymatic deamidation of the side chain with D-amino acid oxidase followed by chemical decarboxylation of the formed ketoadipyl derivative with peroxide, which is produced in the first step. Moreover some

of these acylases have been reported to be capable of hydrolyzing cephalosporins (including the desacetoxy-derivative) with succinyl, glutaryl and adipyl as an acyl moiety and even in one case CefC to a very limited degree (for a review see EP-A- 322032, Merck).

Apart from their specificities, acylases may also be classified based on molecular aspects: Type-I acylases, which are specific for Penicillin V, are composed of four identical subunits, each having a molecular weight of about 35 kDa.

Type-ll acylases all share a common molecular structure: these enzymes are heterodimers composed of a small subunit (a; 16-26 kDa) and a large subunit (R ; 54-66 kDa). With respect to the substrate specificity, Type-)) acylases may be further subdivided into two groups: o Type-IIA acylases comprising the PenG acylases ; o Type-IIB acylases comprising the Glutaryl acylases.

Type III acylases are the Ampicillin acylases which have been reported to be dimers consisting of two identical subunits with a molecular weight of about 72 kDa.

In the framework of this application PenG acylase is understood to be a Type Il-A acylase. Type II acylases all share a common molecular structure. As used herein, the term"PenG acylase"is intended to mean prokaryotic Type Il-A acylase as well as its precursor (such as preenzyme and preproenzyme forms).

For an economically attractive process for enzymatic preparation of lactam antibiotics using using PenG acylase it is desirable that the Synthesis/Hydrolysis ratio (S/H ratio) is high. Preferably the S/H ratio is high and at the same time the enzymatic activity is also sufficiently high.

The S/H ratio is understood to be the molar ratio of synthesis product to hydrolysis product at a particular moment during the enzymatic reaction. Synthesis product is understood to be the (3-lactam antibiotic formed from the activated side chain and p-iactam nucleus. Hydrolysis product is understood to be the corresponding acid of the activated side chain.

The S/H ratio is a function of, amongst other things, the concentration of the reactants, the molar ratio of activated side chain to ß-lactam nucleus, the temperature, the pH and the enzyme. It is therefore important to indicate in what conditions an S/H ratio is determined. In the ideal situation a comparative experiment

is carried out where the particular candidate is tested against a reference enzyme, preferably Ecoli PenG acylase During an enzymatic acylation reaction the S/H ratio generally decreases. The S/H ratio is a function of the conversion, amongst other things. The S/H ratios of different penicillin acylases are preferably compared at equal conversion.

They are most usually compared at 0% conversion (hence, at time t=0), the so-called initial S/H ratio (S/Hìnj), which thus is a measure of the S/H ratio. S/H, ni can be determined with sufficient accuracy by carrying out the acylation reaction until a sufficiently high conversion is reached so that the products, in particular the hydrolysis product, can be measered accurately and then constructing a graph of S/H, ni versus conversion and extrapolating it to 0 % conversion. It might be necessary to determine the initial S/H ratio through extrapolation, since too little hydrolysis product is formed at low conversion for accurate determination of S/Hin.. Curve fitting algorithms which are known in the art may be applied to get a more reliable extrapolation. For accurate determination it is necessary to have sufficient data points. Sufficient data points means at least three data points, which should represent a difference in conversion of at least 0.5%.

Enzymatic activity can generally be defined as the molar quantity of reactant or product that is converted or synthesized per unit time and per quantity of dissolved or immobilised enzyme at a particular moment during the enzymatic acylation reaction. Preferably enzymes are applied in immobilised form and the enzymatic activity is defined per quantity of immobilised enzyme. The enzymatic activity per quantity of enzyme often is also indicated as specific activity of the particular enzyme.

More specifically, in the context of the invention enzymatic activity is defined as the quantity of side chain donor (or activated side chain) that is converted in the acylation reaction per unit time and per quantity of dissolved or immobilised enzyme.

During an enzymatic acylation reaction the enzymatic activity generally decrease over time. The enzymatic activity is a function of the conversion.

The enzymatic activities of different penicillin acylases are preferably compared at equal conversion. They are most usually compared at 0% conversion, the so-called initial enzymatic activity, which thus is a measure of enzymatic activity. The initial enzymatic activity is understood to be the enzymatic activity at 0% conversion, thus at time t = 0. The initial enzymatic activity can be determined with sufficient accuracy by carrying out the acylation reaction until a certain conversion is reached and then constructing a graph of the enzymatic activity versus the conversion and extrapolating

it to 0% conversion. It is desirable to determine the initial enzymatic activity through extrapolation, since too little ß-lactam antibiotic is formed at low conversion for accurate determination of the initial enzymatic activity. For accurate determination it is also desirable to have sufficient data points. Sufficient data points means at least three data points.

The conversion to be achieved in an acylation reaction can be expressed as the molar quantity of (3-lactam antibiotic formed in the acylation reaction at a particular moment during the reaction per molar quantity of reactant used, where the reactant may be either the (lactam nucleus or the (activated) side chain.

Suitable reaction conditions for the performance of an enzymatic acylation reaction in which a mutated or unmutated penicillin acylase is used are known to one skilled in the art.

The term lactam antibiotic comprises all antibiotics that contain a penam or ceph-3-em ring system. The best-known ß-lactam antibiotics are the penicillins and cephalosporins.

In the context of the present application penicillins are defined as compounds according to formula (II) and cephalosporins as compounds according to formula (ici), (III) where X represents S, O, C, S (O), or SO2, Ri represents a side chain, such as for example phenylacetyl, phenoxyacetyl, hydroxyphenylglycyl, phenylglycyl, dihydrophenylglycyl and derivatives thereof and acetyl, adipyl, glutaryl and derivatives thereof, R2 and R3 each independently may represent Ci, aliphatic or aromatic groups, optionally with one or more O, S or N atoms,

R4 represents OH, aliphatic or aromatic alcohols and derivatives thereof, optionally with one or more O, S or N atoms.

Side chains in the context of the present invention may include any suitable compounds that can be attached to the 6-penam or 7-cephem position of a ß- lactam nucleus, resulting in an antibiotically active compound.

The aliphatic group in R2 and/or R3 preferably contains 1-4 C atoms, and is preferably a methyl group.

Semisynthetic penicillins or cephalosporins are prepared for example by acylating the 6-amino-group of 6-aminopenicillanic acid (6-APA) or a derivative thereof as shown in formula (IV), or the 7-amino group of 7- aminodesacetoxycephalosporanic acid (7-ADCA) or a derivative thereof as shown in formula (V), with the aid of an activated side chain and a penicillin acylase enzyme.

Also 7-aminocephalosporanic acid (7-ACA)-nuclei can be acylated with the aid of penicillin acylases. Derivatives of the compounds according to formula (IV) or (V) are understood to be compounds according to formula (IV) or (V), respectively, wherein X = S; R2= CH3 ; R3 = CH3 and R4 = OH.

(IV) (V) The present invention discloses a new PenG acylase (which is further indicated herein as S2) with enzymatic activities different from that of the wild type Pencillin G acylase of Escherichia coli (E. coli).

One way to alter the enzymatic activity of PenG acylases comprises mutation of the enzyme, thereby replacing amino acids involved in the biocatalytic process. W096/05318 and W098/20120 disclose several alternatives to alter Penicillin acylase of E. coli by mutating the nucleotide sequence, which encodes the wild type enzyme.

Numerous publications are known in which reference is made to

mutated penicillin acylases. In W098/20120 reference is made for example to the following publications: Prieto et al, Appl. Microbiol. Biotechnol. 33 (1990) 553-559, in which it is described that replacement of L-methionine in position 168 in penicillin acylase of K. citrophila by L-alanine (M168A), L-valine (M168V), L-asparagine (M168N) or L-tyrosine (M168Y) had an influence on the kinetic parameters for deacylation of penicillin G and penicillin V, while the substitution of Asn375 or Tyr481 by lysine (N375K) and histidine (Y481H), respectively, had no effect. In J. Martin and 1. Prieto, Biochimica et Biophysica Acta 1037 (1990) 133-139, a mutant is described in which Met168 is replaced by alanine (M168A). This resulted in improved thermal stability.

Replacement of Ser177 in E. coli penicillin acylase by glycine (S177G), threonine (S177T), leucine (S177L), or arginine (S177R) produced inactive enzymes (Wang Min et al., Shiyan Shengwu Xuebao 24 (1991) 1,51, while from Kyeong Sook et a/., Journal of Bacteriology 174 (1992) 6270 and Slade et a/., Eur. J. Biochem. 197, (1991) 75 it is known that Ser290 is an essential amino acid in penicillin acylase of E. coli.

Replacement of Gly359 by L-aspartic acid (G359D) resulted in a mutated enzyme which was not able to hydrolyze penicillin G but which was able to hydrolyze phthalyl- leucine and phthalyl-glycyl-L-proline. Replacement of Trp431 in Arg (W431R ; Gabriel Del Rio et a/., Biotechnology and Bioengineering 48 (1995) 141-148) resulted in a mutated PenG acylase of Ecoli with increased stability in a basic environment.

In a recent publication W. B. L. Alkema et a/., Protein Engineering, 13, (2000) 857-863, characterised the binding site of E. coli penicillin acylase is, and further described that a mutant with L-tyrosine on a146 (F146Y) was not active for the synthesis of penicillin G from phenylacetamide and 6-aminopenicillanic acid, while mutants with leucine (F146L) or alanine (F146A) at that position were more effective for the synthesis of penicillin G than the wild type but were seriously hampered in enzymatic activity.

Further, Alkema, Dijkhuis, de Vries and Janssen, 2002 (Eur. J. Biochem. , 269,2093-2100) discuss the role of hydrofobic active site residues in specificity and acyl transfer. All mutants with a better S/H ratio, which are shown by Alkema et al., exhibit significantly lower enzymatic activity on amide substrates (tables 1,2, 3 Alkema et al.). Usually enzymatic activity is reduced by a factor two or more.

The best mutant that is shown is ßFE7L which shows an improvement of S/H ratio of 14% at an enzymatic activity which is 71 % of the wild type E. coli enzymatic activity (table 3, Alkema et al.) A general conclusion from the known attempts to improve the enzymatic characteristics of PenG acylase for use in the synthesis of synthetic antibiotics is that a higher S/H ratio seriously corrupts enzymatic activity which is reflected in lower synthesis rate per mg of acylase protein.

The present invention provides for a newly isolated PenG acylase (PAS2) of an unknown source, which surprisingly exhibits an improved S/H, ni as well as an essentially unaltered enzymatic activity with respect to the acyl donors, in particular amide acyl donors as compared to PenG acylase of E coli.

Description of the Figures Fig. 1) Composition of PAS2. The positions of the signal peptide (pos. 1-24), the a- subunit (pos. 25-253,25. 5 kD), the spacer peptide (pos. 254-308) and the subunit (pos. 309-863,62 kD) in the prepropolypeptide are indicated.

Fig. 2) Ampicillin synthesis by E. coli penicillin acylase. Formation of ampicillin (black squares) and D-phenylglycine (black circles) refers to the left y-axis, D- phenylglycine amide (white circles) and 6-APA (white squares) refer to the right y-axis.

Fig. 33 Ampicillin synthesis by PAS2. Formation of ampicillin (black squares) and D- phenylglycine (black circles) refers to the left y-axis, D-phenylglycine amide (white circles) and 6-APA (white squares) refer to the right y-axis.

Fig. 4) Amoxicillin synthesis by E. coli penicillin acylase. Formation of amoxicillin (black squares) and D-p-hydroxyphenylglycine (black circles) refers to the left y-axis, D- p-hydroxyphenylglycine amide (white circles) and 6-APA (white squares) refer to the right y-axis.

Fig. 5) Amoxicillin synthesis by PAS2. Formation of amoxicillin (black squares) and D-p- hydroxyphenylglycine (black circles) refers to the left y-axis, D-p- hydroxyphenylglycine amide (white circles) and 6-APA (white squares) refer to the right y-axis.

Fig. 6) Initial synthesis/hydrolysis (S/H) ratios obtained in amoxicillin synthesis (white symbols) and ampicillin synthesis (black symbols) by E. coli penicillin acylase (squares) and PAS2 (circles).

Fig. 7) Product formation in the course of ampicillin (top) and amoxicillin synthesis (bottom). Data obtained with PAS2 are represented by open circles, data for E. coli PenG acylase are indicated by filled boxes. All reactions were carried

out with 15 mM acyl donor and 25 mM nucleophile. Solid lines were calculated according to a kinetic model that applies for penicillin acylases.

In one embodiment the present invention is concerned with an enzyme having PenG acylase activity and which is characterised by a) an initial Synthesis/Hydrolysis ratio (S/Hjnj) of at least 50% above the S/Hjnj of PenG acylase of E. coli and b) an initial rate of activated side chain conversion less that 20% below the level of PenG acylase of E. coli wherein as an activated side chain precursor is used D-p-hydroxyphenylglycine amide (DHPGA) and wherein as a penam nucleophile is used 6-amino penicillanic acid.

As used herein, the expressions"initial rate of activated side chain conversion less that 20% below the level of PenG acylase of E. coli"and'initial rate of activated side chain conversion of more than 80% of the initial rate of activated side chain conversion by Penicillin G acylase of E coli"are intended to have the same meaning, and will be used interchangeably.

More in particular, according to the present invention a naturally occurring PenG acylase was found, which conforms the above characteristics and which is characterised in that it comprises two peptides with amino acid sequences corresponding to positions 25 or 26 to 253 and positions 309 to 863 of SEQ ID NO: 2, respectively.

Peptide 25 or 26 to 253 shows similarity to the so-called a subunits and the peptide 309 to 863 shows similarity to the so-called (3 subunits of Type-llA acylases. Hence, the S2 enzyme was tentatively classified as a Type-IIA acylase.

The sequence of S2 suggests that the enzyme is initially expressed as a preproprotein consisting of a signal sequence and the two subunits (a and ß) that are separated by a spacer peptide. In the known Type-IIA acylases the signal sequence directs the protein to the periplasm and is subsequently cleaved off. In this compartment, the spacer peptide is removed, probably by an autocatalytic process. To determine the exact cleavage points and masses of the subunits of the protein, a mass spectrum was recorded.

The results clearly revealed a molecular weight of 25,519 Da and 61,893 Da for the a-subunit and the 6-subunit, respectively, corresponding to cleavage points after positions 24,253, and 308 of the preproprotein (figure 1). Cleavage by the signal peptidase, however, seems to be not very precise, as cleavage was also found to occur after position 25 in about 30 % of the cases.

It was further found that, in particular, the a subunits could vary significantly in length. More in particular, the amino-terminal amino acid could vary from position about 23 to about 27 of the sequence as represented in of SEQ ID NO : 2 and from position about 244 to 308 of the sequence represented in SEQ ID NO : 2.

Hence the preproprotein comprises a signal peptide, an a-subunit, a spacer peptide and a 13-subunit, and may be characterised by SEQ ID NO : 2.

Minor variations (including spontaneous and induced mutations) in the amino acid sequence of the protein still may result in a protein with the same favourable set of properties characteristic of S2 or even may result in further improvement of the enzymatic characteristics. More in particular polypeptides, which show at least 85 %, preferably 90%, more preferably 95%, most preferably 99% homology with SEQ ID NO : 2 may still possess the same enzymatic characteristics typical of S2.

Accordingly the present invention also relates to a polypeptide having PenG acylase activity and which shows at least 85 %, preferably 90%, more preferably 95%, most preferably 99% homology with SEQ ID NO 2.

In a further embodiment the invention relates to a polynucleotide encoding an enzyme having Penicillin acylase activity and which is characterised by a. an initial Synthesis/Hydrolysis ratio (S/H, n.) of at least 50% above the S/Hjni of PenG acylase of E coli and b. an initial rate of activated side chain conversion less that 20% below the level of PenG acylase of E. coli wherein as an activated side chain precursor is used D-p-hydroxyphenylglycine amide (DHPGA) and wherein as a penam nucleophile is used 6-amino penicillanic acid.

More in particular the invention relates to a polynucleotide encoding a polypeptide comprising peptides having the amino acid sequences corresponding to positions about 23-27 to about 244-308 of SEQ ID NO: 2 and positions 309 to 863 of SEQ ID NO: 2 or amino acid sequences having at least 85 %, preferably 90%, more preferably 95%, most preferably 99% homology to said sequences.

In a further embodiment the invention relates to a polynucleotide encoding a polypeptide comprising peptides having amino acid sequences corresponding to positions 25 to 253 and positions 309 to 863 of SEQ ID NO: 2 or corresponding to positions 26 to 253 and 309 to 863 of SEQ ID NO: 2.

Optionally these polynucleotides may further comprise polynucleotides encoding a signal peptide and a spacer peptide.

In a further embodiment the present invention relates to a vector suitable for transforming an appropriate host cell comprising any of the polynucleotides described above. Preferably this polynucleotide is operatively linked with regulator sequences suitable for expression of said polynucleotide in an appropriate host cell.

The invention further comprises a recombinant host cell comprising a polynucleotide or a vector described above.

Suitable hosts are prokaryotic and eukaryotic organisms, preferably prokaryotic organisms, more preferably E. coli. Vectors according to the present invention are vectors which are suitable for stabile transformation of the desired host, and which are capable of promoting synthesis of the desired protein in said host.

According to a more preferred embodiment of the present invention such recombinant host cell is capable of expressing and preferable also excreting an enzyme having PenG acylase activity and which is characterised by a. an initial Synthesis/Hydrolysis ratio (S/Hin !) of at least 50% above the S/Hjnj of PenG acylase of E coli and b. an initial rate of activated side chain conversion less that 20% below the level of PenG acylase of E. coli wherein as an activated side chain precursor is used D-p-hydroxyphenylglycine amide (DHPGA) and wherein as a penam nucleophile is used 6-amino penicillanic acid.

Henceforth the invention also relates to a method for the preparation of a polypeptide comprising the steps of; - transforming a host cell with a polynucleotide described above; - culturing said host cell under conditions allowing expression and preferably also secretion of said polynucleotide ; and - optionally purifying the encoded polypeptide from said cell or culture medium - optionally formulating said purified polypeptide.

Transformation of the host with the desired polynucleotide or vector, culturing of the transformed host cell purification of the polypeptide and formulation of the polypeptide may be carried out by methods known in the art.

Suitably the enzymatic polypeptide is immobilised in order to be able to use the enzyme repeatedly in subsequent reaction cycles.

In view of the useful characteristics of the polypeptide so produced the present invention also relates to a method for the preparation of a R-lactam antibiotic, for example starting from 6-amino penicillanic acid wherein the above novel Penicillin acylase is used as a biocatalyst.

One skilled in the art knows suitable reaction conditions for the performance of an enzymatic acylation reaction in which a mutated or unmutated PenG acylase is used.

The molar ratio of activated side chain to 13-lactam nucleus, i. e. the total quantity of activated side chain added divided by the total quantity of lactam nucleus added, both expressed in moles, may vary between wide limits. Preferably the molar ratio is between 0.5 and 2.0, in particular between 0.7 and 1. 8.

The temperature at which the enzymatic acylation reaction is carried out is generally lower than 40 °C, preferably between-5 and 35 °C. The pH at which the enzymatic acylation reaction is carried out generally lies between 5.5 and 9.5, preferably between 6.0 and 9.0.

Preferably the reaction is almost completely terminated when the maximum conversion is all but reached. A suitable embodiment to terminate the reaction is lowering the pH, preferably to a value between 4.0 and 6.3, in particular between 4.5 and 5.7. Another suitable embodiment is lowering the temperature of the reaction mixture as soon as maximum conversion is achieved. A combination of both embodiments is also possible.

In the context of the invention, a decrease in pH can be accomplished for example by the addition of an acid. Suitable acids are for example mineral acids, in particular sulphuric acid, hydrochloric acid solution or nitric acid and carboxylic acids, for example acetic acid, oxalic acid and citric acid. An increase in pH can be accomplished for example by the addition of a base. Suitable bases are for example inorganic bases, in particular ammonia, potassium hydroxide or sodium hydroxide solution and organic bases, for example triethylamine and D-phenylglycine amide.

Preferably ammonia is applied.

The enzymatic acylation reaction can be carried out in water. If desired, the reaction mixture may also contain an organic solvent or a mixture of organic solvents, preferably less than 30 vol. %. Examples of organic solvents that may be applied are alcohols with 1-7 C-atoms, for example a monoalcohol, in particular methanol or ethanol ; a diol, in particular ethylene glycol or a triol, in particular glycerol.

The enzymatic acylation reaction is preferably carried out as a batch process. If desired, it is also possible to carry out the reaction continuously. Suitable examples of ß-lactam nuclei that can be used in the process according to the invention are penicillin derivatives, for example 6-APA, and cephalosporin derivatives, for example a 7-aminocephalosporanic acid with or without a substituent on the 3-site, for

example 7-ACA, 7-ADCA and 7-amino-3-chloro-ceph-3-em-4-carboxylic acid (7-ACCA) and 7-amino-3-chloro-8-oxo-1-azabicyclo [4.2. 0] oct-2-ene-2-carboxylic acid.

As an activated side chain in the (enzymatic) acylation reaction use may be made of for example phenylglycine in activated form, preferably a (primary, secondary or tertiary) amide or salt thereof or a lower alkyl (1-4C) ester, for example a methyl ester; as phenylglycines use may be made of for example substituted or unsubstituted phenylglycines, in particular phenylglycine, p-hydroxyphenylglycine, dihydrophenylglycine. Preferably phenylglycine amide is used as activated side chain.

ß-lactam antibiotics that are preferably prepared by the process according to the invention are amoxicillin, ampicillin, cephalexin, cefadroxil, cephradine and cefaclor.

MATERIALS AND METHODS Construction of S2 producing strains To achieve high-level expression of S2, a DNA fragment having a polynucleotide sequence according to SEQ ID NO 1 (S2 gene) was cloned behind the tightly regulatable PBAD promoter located on pBAD/Myc-HisA_Ndel.. To construct this plasmid vector, two Ndel sites located on the commercially available vector pBAD/Myc- HisA (Invitrogen) were removed and the Ncol site present in the multiple cloing site of the vector was changed to an Ndel recognition sequence. All changes were carried out with the QuickChange Site-Directed Mutagenesis Kit (Stratagene) according to the manual. The S2 gene was cloned including its own signal sequence, using a forward PCR primer based on the 5'-end of the gene with an introduced Ndel restriction site (restriction site underlined, start codon bold), 5'ttggagacagagcatatgaagcagcatttgttg 3', and a reverse primer based on the 3'-end of the gene with a Sall site (underlined) incorporated (5' ccagggcgtcqacacggtcagtagcg 3'). PCR amplifications were carried out with pWO polymerase (Roche) under standard conditions as recommended by the supplier. PCR product and vector were digested with Ndel/Sall and Ndel/Xhol, respectively, and ligated with T4 ligase according to the instructions of the manufacturer (Roche). The ligation mixture was transformed to electrocompetent E coli TOP10 cells (Invitrogen), and the construct (pBADS2) was confirmed by sequencing.

A disadvantage of the pBAD system is its selection marker (AmpR), a

P-lactamase, which interferes with synthesis/hydrolysis experiments of some p-iactam antibiotics, when periplasmatic extracts are used. Therefore, all further experiments were carried out with purified protein. In particular for performing experiments with ß- lactam antibiotics the AmpR selection marker has been replaced by a chloramphenicol marker which allows also for the use of unpurified pS2 Protein purification E. coli penicillin acylase (ECPA) was produced and purified as described before [Alkema, 2000, Protein Engineering 13: 857-863]. The obtained enzyme solution was concentrated by ultrafiltration (Amicon bioseparations, YM 30 filter) before the enzyme was rebuffered in 50 mM potassium phosphate buffer (pH 7.0) with 5 % glycerol, using an Econo-pac 10DG column (BioRad).

For S2, a similar purification scheme was used. E. coli TOP10 (pBADS2) cells were grown in LB [Sambrook, 1989] at 17°C with rotary shaking at 200 rpm. In order to induce protein expression from PBAD, the medium was supplied with 0.8 % arabinose after 2 d of growth. When the late exponential phase was reached, cells were harvested by centrifugation at 5, 000xg for 10 min (4°C). To prepare a periplasmatic extract, cells were resuspended in 1/10 of the original culture volume of ice-cold osmotic shock buffer (20 % sucrose, 100 mM Tris. HCI, 10 mM EDTA; pH 8.0) and centrifuged as described above. Cell walls were disrupted by resuspending the cell pellet in 1/10 of the original culture volume of ice-cold 1 mM EDTA. After centrifugation (6, 000xg, 15 min, 4°C), 1 M potassium phosphate buffer (pH 7.0) was added to the supernatant (periplasmatic extract) to a final concentration of 50 mM. Subsequently, solid (NH4) 2SO4 was added to a final concentration of 1.5 M, while stirring at 4°C. The solution was subjected to hydrophobic interaction chromatography, using a Resource Phe (Amersham Pharmacia Biotech) column, and eluted with a linear gradient of 1.5 M to 0 M (NH4) 2SO4 in 20 mM potassium phosphate buffer (pH 7.0). S2 eluted at a concentration of 300 mM (NH4) 2SO4. Enzyme containing fractions were pooled, concentrated and rebuffered as described for ECPA. Both enzymes were stored at- 20°C and could be defrosted several times without detectable loss of activity.

The amount of active enzyme was determined by titration with the irreversible inhibitor phenylmethyisulfonyl fluoride (Boehringer Mannheim) as described by Alkema et aL [Alkema, 1999, Analytical Biochemistry, 275: 47-53].

Chemicals Ampicillin, cefadroxil, and cephalexin were purchased from Sigma, HPAAm was from Acros Organics. Penicillin G, amoxillin, 7-ADCA, 6-APA, PGA, and HPGA were provided by DSM Life Sciences (Delft, The Netherlands). NIPAB and NIPGB were synthesized by reacting phenylacetic acid chloride and D-phenylglycine chloride, respectively, with 5-amino-2-nitro-benzoic acid in a water/acteone mixture.

PAAm was prepared by adding phenylacetylchloride dropwise to a concentrated ammonia solution, resulting in the formation of a white precipitate, which was filtered off and dried to constant weight. [Alkema, PhD thesis, 2002, Groningen State University)].

Abbreviations NIPAB, 2-nitro-5-[(phenylacetyl) amino]-benzoic acid; NIPGB, D-2- nitro-5- [ (phenylglycyl) amino] -benzoic acid; PAA, phenylacetic acid; D-PGA, D- phenylglycine amide; D-PG, D-phenylglycine ; D-HPGA, D-p-hydroxyphenylglycine amide; D-HPG, D-p-hydroxyphenylglycine ; D-PGM, D-phenylglycine methylester ; D-HPGM, D-p-hydroxyphenylglycine methylester ; PAAm, phenylacetamide ; HPAAm, p-hydroxyphenylacetamide ; 6-APA, 6- aminopenicillanic acid; 7-ADCA, 7-aminodesacetoxycephalosporanic acid; PenG, penicillin G Kinetic measurements All enzymatic conversions were carried out in 50 mM potassium phosphate buffer (pH 7.0) at 30°C. Steady-state kinetic parameters for the hydrolysis of the colorimetric substrates 2-nitro-5- [ (phenylacetyl) amino] -benzoic acid (NIPAB) and D- 2-nitro-5-[(phenylglycyl) amino] -benzoic acid (NIPGB) were determined by measuring initial velocities of 5-amino-2-nitro-benzoic acid release (AsXosnm = 9-09 MM-'CM-') at 405 nm in a Perkin Elmer Bio40 UV/VIS spectrometer, using different substrate concentrations (Alkema et al. 1999, Anal. Biochem 275,47-53). Data were fitted with the program Origin 6.0 (Microcal Software, Inc.). Kj values for phenylacetic acid (PAA) and Km values for non-colorimetric substrates were determined by measuring the

inhibition on the hydrolysis of NIPGB as described by Alkema et al. [Alkema et a/., 1999, Analytical Biochemistry, 275: 47-53].. The kCat values were determined separately by monitoring the initial velocities of substrate conversion at substrate concentrations of at least 10 x Km by high-performance liquid chromatography (HPLC) (Alkema et al., 2000, Protein Eng. 13,857-863). All HPLC analyses were carried out using a 10 cm long Chrompack C18 column (5 mm diameter) in connection with Jasco PU-980 pumps and a Jasco MD-910 detector set at 214 nm. Compounds were isocratically eluted at a flow rate of 1 ml min~1 with a solution of 340 mg sodium dodecyisutfate and 680 mg 1- 1 KH2PO4. 3 H2O in a 30: 70 (v/v) acetonitrile/water mixture of pH 3.0 (adjusted with diluted phosphoric acid).

Enzymatic synthesis of (3-lactam antibiotics was carried out by mixing enzyme with solutions of acyl donor [either phenylacetamide (PAAm), D-phenylglycine amide (PGA), p-hydroxyphenylacetamide (HPAAm), or D-p-hydroxyphenylglycine amide (HPGA) or the corresponding esters] and nucleophile (6-APA or 7-ADCA). The initial concentration of acyl donor was 15 mM in all experiments, whereas the concentration of nucleophile varied between 1 and 190 mM. All reactants were monitored in time by HPLC analysis and initial velocities of synthesis and hydrolysis product formation were used to calculate (S/H) ini ratios. Peak areas were related to the concentration of the respective compounds by calibration curves that were established with solutions of the pure compounds....

Mass spectrometry The molecular masses of the two subunits of S2 were determined at the Mass Spectrometry Core Facility, University of Groningen (The Netherlands), using an electrospray triple quadruple mass spectrometer (API 3000, PE-Sciex). Full-scan spectra were recorded with a step size of 0.1 amu and analyzed with Biomultiview software (version 1.5, PE-Sciex). For this experiment, the buffer system of the original enzyme solution was replaced by a 10 mM ammonium acetate buffer (pH 6.8) with an Econo-pac 10DG column (BioRad) and 0.1 % formic acid was added before analysis.

EXAMPLE 1 Kinetic properties of S2.

The steady state kinetic parameters for two substrates, which are commonly used for the kinetic characterisation of PenG acylases are shown in table 1.

Based on the kinetic parameters shown in table 1 it can be concluded that the steady state parameters of S2 for the given substrates clearly differ from the other PenG acylases.

As in the field of ß-lactam bioconversions E. coli PenG acylase is broadly applied and considered particularly useful in the synthesis of semi-synthetic lactam antibiotics, for the further characterisation of S2 only E. coli PenG acylase was taken as a reference. The results of a further kinetic analysis of S2 are shown in table 2.

Table 1: Comparison of kinetic constants of S2 with other PenG acylases using NIPAB and PenG as substrates.

NIPAB Penicillin G PenG acylase kcat [s-1] Km [µM] kcat [s-1] Km [1, M] S2 24 4 25 12 E. coli 18 16 36 9 A. faecalis 48 4 42 2 K. cryocrescens 11 12 35 9 Data for E coli, A. faecalis and K. cryocrescens were taken from Alkema et al. Anal Biochem, 1999,275, 47-53.

Table 2. Steady-state kinetic parameters of S2 and E.coli PenG acylase (E. coli PA) S2 E. coli PA Compound kcat [s-1] kcat/Kmkcat [s''] Km [mM] kcat/Km [mM~ s-] [mM-s~1] NIPGB 12 0. 646 18. 6 14 1. 3 10. 8 PAAm 23 0.030 767 46 0.156 295 HPAAm 29 0.027 1074 47 0.114 412 D-PGA 25 12.0 2.1 57 30 1.9 D-HPGA 16 9.1 1.8 28 12.2 2.3 Ampicillin 16 0.575 27.8 25 2.5 10.0 Amoxillin 15 0.399 37.6 17 1.07 15.9 Cephalexin 20 1.3 15.4 29 1.5 19.3 Cefadroxil 13 0.284 45. 8 32 0.642 49.8 Based on the values of Km shown in table 2 it can be concluded that S2 shows higher affinity for all of the substrates tested. For most substrates the high affinity leads to a higher specificity for the given substrate as is indicated by the value of the so-called specificity constant keat/Km. ! n general the catalytic parameters for S2 suggest that in particular at low substrate concentration, e. g. at the end of bioconversions where the substrates get exhausted, S2 might show better performance compared to E. coli PenG acylase.

EXAMPLE 2 Synthesis of penicillin and cephalosporin derivatives with S2 The purified S2 enzyme preparation was used to study its behavior in the synthesis of different ß-lactam antibiotics. In the synthesis experiments, amide derivatives of the respective sidechains were used as acyidonors and 6-APA or 7- ADCA as nucleophiles. Besides the coupling of the acyl donor to the nucleophile, two side reactions can occur: (1) hydrolysis of the activated side chain, (2) hydrolysis of the initially formed antibiotic. These effects lead to a maximum in product (antibiotic) accumulation in the course of the reaction (Qmax), which is determined by the enzyme properties. Another enzyme characteristic is the initial ratio between product formation

(synthesis) and side reaction 1 (hydrolysis of the activated side-chain), the S/Hjnj ratio.

These parameters reflect the efficiency of the enzyme in a particular synthesis reaction and can be obtained by addition of a fixed amount of PenG acylase to a mixture containing the-lactam nucleus and an acyl donor. The progress of the reaction is monitored in time by taking samples at different time points, which are analysed by HPLC (Alkema et al. Protein Engineering, 13,857-863).

Figures 2 and 3 show the progress curves for the formation of ampicillin starting from D-phenylglycinamide (D-PGA) and 6-APA by E. coli and S2 acylase, respectively.

Figures 4 and 5 show the progress curves for the formation of amoxicillin starting from D-hydroxyphenylglycine amide (D-HPGA) and 6-APA by E. coli and S2 acylase, respectively.

In both comparative experiments the PenG acylase concentration was the same (200nM) for both S2 and E. coli PenG acylases. All reactions were carried out with 15mM acyl donor and 25mM nucleophile. For the synthesis of ampicillin as well as amoxicillin the (S/H) jnj ratio for S2 is substantially improved compared to E. coli acylase. In addition, a higher accumulation for ampicillin as well as for amoxicillin is observed (higher Qmax). Very surprisingly the S2 acylase shows in addition to an improved initial S/H ratio and a higher ampicillin and amoxicillin accumulation also an increased synthesis rate for both products. For ampicillin the initial rate of S2 antibiotic formation is 151% compared to E. coli PenG acylase, while for amoxicillin the initial rate of S2 antibiotic formation is even 206% compared to E. coli PenG acylase. These results reflect the high potential of the S2 PenG acylase for the use in the preparation of semi-synthetic (3-lactam antibiotics. Similar experiments were carried out using 7-ADCA as a nucleophile, resulting in the synthesis of cephalexin and cefadroxyl. A summary of the synthesis experiments with S2 and E. coli PenG acylase using amides as acyl donors is given in table 3.

To compare the overall activity of the two enzymes, the initial rates of the conversion of the acyl donors in the synthesis of given antibiotics were also determined. In all cases S2 is the fastest enzyme when considering the conversion rate of the acyl donor. In addition, when using 6APA as a nucleophile also the initial S/H ration is substantially improved compared to E. coli PenG acylase. The synthesis of amoxycillin from D-p-hydroxyphenylglycine amide and 6APA was most improved with respect to E. coli PenG acylase showing a 3-fold higher (S/H) jnj, a 50% increase in

Qmax and a 60% higher reaction velocity.

Table 3. Synthesis of antibiotics by E. coli PenG acylase and S2 using amides as acyl donors.

S2 E. coli PAC S/Hini [Q]max ViniD-(H)-PGA S/Hini [Q]max Antibiotic (mM) (% E. coli) (mM) Ampicillin 4. 3 2. 4 113 1. 2 2. 0 Amoxicillin 7.8 2.7 160 1.2 1.7 Cephalexin 9.3 4.1 105 9.6 3.7 Cefadroxyl 8.2 2.4 115 9. 6 2.2 1. c0 (acyl donor) = 15 mM, cO (nucleophile) = 25 mM, c (acylase) = 200 nM.

2. Acyl Donors: D-PGA (D-phenylglycine amide), D-HPGA (D-p- hydroxyphenylglycine amide) 3. Nucleophiles : 6-APA (6-aminopenicillanic acid), 7-ADCA (7- aminodesacetoxycephalosporanic acid).

4. ViniD-(H)-PGA:initial enzymatic activities at which D-PGA and D-HPGA are converted, respectively These results are very surprising as until now all attempts to improve the S/H ratio of E. coli PenG acylase by mutagenesis methods showed that an improvement of the S/H ratio was always accompanied by a serious decrease of the catalytic rate.

As it is desired for the enzymatic synthesis of semi-synthetic lactam antibiotics to work at high concentrations of nucleophile it is important to know the relationship between (S/H)ini ration and the nucleophile concentration. Therefore, in order to study the potential benefits of S2 for the preparation of semi-synthetic p-iactam antibiotics further, the (S/H) ini ratio was determined as a function of the nucleophile concentration. Results are shown in figure 6. The S/Hini ratio steadily increases upon going to higher 6APA concentrations. At high 6APA concentration the (S/H) ini ratio approaches a certain plateau. Compared to E. coli PenG acylase, for ampicillin as well as amoxycillin a significant higher value of the (S/H) jn ratio can be obtained by using S2.

In order to emphasize the benefits of S2 in the synthesis of semi- synthetic 3-) lactam antibiotics, the amount of acyl donor that was coupled with the ß- lactam nucleophile was plotted against the amount of acyl donor that was lost by hydrolysis. Figure 7 shows that when using S2 instead of E. coli PenG acylase under comparative conditions in the synthesis of semi-synthetic p-tactam antibiotics, a significantly higher yield of semi-synthetic (3-lactam antibiotic on acyl donor can be obtained.

Apart from the use of amides as side chain precursors in the enzymatic preparation of semi-synthetic (3-lactam antibiotics also the use of esters as side chain precursors has been explored extensively. Therefore we tested S2 also with esters as acyl side chain donor. The results are shown in table 4. As observed when using amides as acyl side chain donor, also with esters as precursor S2 shows improved performance in synthesis of antibiotics. S2 shows improved (S/H) ; n, ratio's combined with retained or in case of semi-synthetic penicillins significantly improved catalytic rates.

Table 4. Synthesis of antibiotics by E. coli PenG acylase and S2 using esters as acyl donors.

S2 E. coli PAC S/Hini [Q] max V ; n)-PGM S/Hini [Q] max Antibiotic (mM) (% E. coli) (mM) Ampicillin 4. 9 3. 2 130 1. 6 2. 7 Amoxicillin 6.2 3.3 190 1.1 1.7 Cephalexin 7.7 4.6 95 7.0 4.5 Cefadroxyl 8.0 4.7 100 7.0 3.5 1. co (acyl donor) = 15 mM, co (nucleophile) = 25 mM, c (acylase) = 200 nM.

2. Acyl Donors: D-PGM (D-phenylglycine methyl ester), D-HPGM (D-p- hydroxyphenylglycine methylester) 3. Nucleophiles : 6-APA (6-aminopenicillanic acid), 7-ADCA (7- aminodesacetoxycephalosporanic acid).

4. Vinip-H)-PGM : initial enzymatic activities at which D-PGM and D-HPGM are converted, respectively