METHODS FOR CULTURING NR4A-DEFICIENT CELLS CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This PCT application claims the priority benefit of U.S. Provisional Application Nos.63/378,503, filed October 5, 2022; 63/382,687, filed November 7, 2022; 63/482,962, filed February 2, 2023; and 63/498,445, filed April 26, 2023, each of which is herein incorporated by reference in its entirety. REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY [0002] The content of the sequence listing is submitted electronically (Name: 4385_115PC04_Seqlisting_ST26.XML; Size: 253,487 bytes; and Date of Creation: October 3, 2023) with the application and herein incorporated by reference in its entirety. FIELD OF THE DISCLOSURE [0003] The present disclosure relates to methods of culturing and modifying cells, e.g., pluripotent, multipotent, and/or immune cells (e.g., T cells and/or NK cells). In some aspects, the cells are modified (i.e., edited) to exhibit reduced NR4A expression (e.g., NR4A1, NR4A2, and/or NR4A3), e.g., as compared to corresponding cells that have not been modified. In some aspects, the cells are further modified (i.e., transduced) to exhibit increased c-Jun expression, e.g., as compared to corresponding cells that have not been further modified. Cells cultured and modified using the methods disclosed herein can be used for various cell therapies, including but not limited to chimeric antigen receptor (CAR) T cell therapy, TCR T cell therapy including neoantigen directed-T cell therapies, and TIL therapy. BACKGROUND OF THE DISCLOSURE [0004] Cancer immunotherapy relies on harnessing T cells—the immune system’s primary killers of infected and diseased cells—to attack and kill tumor cells. However, the ability of immune cells to target and kill tumor cells is dampened by the presence of various inhibitors of the immune response that are present within the tumor microenvironment. Therefore, while CAR T cells have had various successes in treating certain cancers (e.g., KYMRIAH™ (tisagenlecleucel, Novartis) and YESCARTA™ (axicabtagene ciloleucel, Kite/Gilead) has been approved by the FDA), challenges remain. For instance, the success of CAR T cell immunotherapy is often limited by the extent of CAR T expansion in a recipient’s body, which typically requires a large infusion of cells. Additionally, exhaustion and loss of persistence of the transferred CAR T cells have been observed, leading to loss of clinical efficacy and potential relapse. [0005] One means of overcoming T cell exhaustion is to selectively administer T cells having a less-differentiated state. For example, T memory stem cells (TSCM) persist for a greater period in patients following administration than do more differentiated T central memory (T _CM ) or T effector memory (T _EM ) cells, and T _SCM elicit a more pronounced and prolonged effect on tumor size than more differentiated cells. However, many adoptive cell therapy (ACT) cell preparations comprise an ill-defined mix of immune cells at various states of differentiation, which are ineffective at eradicating solid tumors. To be curative, T cells products with enhanced self-renewing stem/effector properties are needed. As such, there remains a need in the art for methods of efficiently enriching for less differentiated and/or naïve T cells from a mixed population of isolated T cells. BRIEF SUMMARY OF THE DISCLOSURE [0006] Provided herein is a method of preparing immune cells for immunotherapy comprising: (a) contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. [0007] Also provided herein is a method of increasing the stemness of immune cells during ex vivo or in vitro culture comprising: (a) contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. In some aspects, increasing the stemness of immune cells comprises increasing the percentage of the immune cells that exhibit the following phenotypic expression: CD45RO- CCR7 ⁺ CD45RA ⁺ CD62L ⁺ CD27 ⁺ CD28 ⁺ TCF7 ⁺ . [0008] Provided herein is a method of increasing the yield of immune cells during ex vivo or in vitro culture comprising: (a) contacting immune cells with a programmable cell- signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. [0009] Provided herein is a method of increasing both stemness and yield of immune cells during ex vivo or in vitro culture comprising: (a) contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. In some aspects, increasing the stemness of immune cells comprises increasing the percentage of the immune cells that exhibit the following phenotypic expression: CD45RO- CCR7 ⁺ CD45RA ⁺ CD62L ⁺ CD27 ⁺ CD28 ⁺ TCF7 ⁺ . [0010] Provided herein is a method of expanding a population of stem-like immune cells ex vivo or in vitro comprising: (a) contacting immune cells with a programmable cell- signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. Provided herein is a method of improving one or more properties of a population of immune cells in response to persistent antigen stimulation comprising: (a) contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited, wherein after the contacting and the editing, the one or more properties of the population of immune cells is improved as compared to a reference population of immune cells. [0011] In any of the above methods, in some aspects, the editing occurs after the contacting. In some aspects, the editing occurs at least about one day, at least about two days, at least about three days, at least about four days, or at least about five days after the contacting. In some aspects, the editing occurs about two days after the contacting. In some aspects, the contacting occurs after the editing. In some aspects, the contacting occurs at least about one day, at least about two days, at least about three days, at least about four days, or at least about five days after the editing. In some aspects, the contacting occurs about one day after the editing. In some aspects, the editing and the contacting occur concurrently. [0012] In any of the above methods, in some aspects, the method further comprises transducing the immune cells: (a) to express a ligand-binding protein, (b) to exhibit an increased expression of a c-Jun polypeptide, or (c) both (a) and (b). In some aspects, the contacting, editing, and transducing occur concurrently. In some aspects, the transducing occurs before the contacting, editing, or both. In some aspects, the transducing occurs before the editing. In some aspects, the transducing occurs before the editing and concurrently with the contacting. In some aspects, the transducing occurs at least about one day, at least about two days, at least about three days, at least about four days, or at least about five days before the editing. In some aspects, the transducing occurs about two days before the editing. In some aspects, the transducing occurs after the contacting, editing, or both. In some aspects, the transducing occurs after the editing. In some aspects, the transducing occurs after the editing and concurrently with the contacting. In some aspects, the transducing occurs at least about one day, at least about two days, at least about three days, at least about four days, or at least about five days after the editing. In some aspects, the transducing occurs about one day after the editing. [0013] Provided herein is a method of preparing immune cells for immunotherapy comprising concurrently contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. [0014] Provided herein is a method of increasing the stemness of immune cells during ex vivo or in vitro culture comprising concurrently contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. In some aspects, increasing the stemness of immune cells comprises increasing the percentage of the immune cells that exhibit the following phenotypic expression: CD45RO- CCR7 ⁺ CD45RA ⁺ CD62L ⁺ CD27 ⁺ CD28 ⁺ TCF7 ⁺ . [0015] Provided herein is a method of increasing the yield of immune cells during ex vivo or in vitro culture comprising concurrently contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. [0016] Provided herein is a method of increasing both stemness and yield of immune cells during ex vivo or in vitro culture comprising concurrently contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. In some aspects, increasing the stemness of immune cells comprises increasing the percentage of the immune cells that exhibit the following phenotypic expression: CD45RO- CCR7 ⁺ CD45RA ⁺ CD62L ⁺ CD27 ⁺ CD28 ⁺ TCF7 ⁺ . [0017] Provided herein is a method of expanding a population of stem-like immune cells ex vivo or in vitro comprising concurrently contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. [0018] Provided herein is a method of improving one or more properties of a population of immune cells comprising concurrently contacting immune cells with a programmable cell- signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited, wherein after the contacting and the editing, the one or more properties of the population of immune cells is improved as compared to a reference population of immune cells. [0019] For any of the methods provided herein (e.g., described above), in some aspects, the method further comprises transducing the immune cells: (a) to express a ligand-binding protein, (b) to exhibit an increased expression of a c-Jun polypeptide, or (c) both (a) and (b). In some aspects, the transducing occurs concurrently with the contacting and the editing. In some aspects, the transducing occurs before or after the contacting and the editing. [0020] For any of the methods provided herein (e.g., described above), in some aspects, the editing comprises introducing a gene editing tool into the immune cells, and wherein the gene editing tool is capable of reducing the expression level of the NR4A family member in the immune cells. In some aspects, the transducing comprises introducing into the immune cells a nucleotide sequence encoding the c-Jun polypeptide, such that the expression of the c-Jun polypeptide is increased after the introducing. In some aspects, the transducing comprises introducing into the immune cells a nucleotide sequence encoding the ligand-binding protein, such that after the introducing, the immune cells express the ligand-binding protein. In some aspects, the transducing comprises introducing into the immune cells a first nucleotide sequence encoding the c-Jun polypeptide and a second nucleotide sequence encoding the ligand-binding protein, such that after the introducing, the expression of the c-Jun polypeptide is increased and the immune cells express the ligand-binding protein. In some aspects, the first nucleotide sequence and the second nucleotide sequence are within a single vector. In some aspects, the transducing comprises introducing into the immune cells a transcriptional activator that is capable of increasing the expression level of an endogenous c-Jun protein in the immune cells, such that after the introducing, the expression of the endogenous c-Jun protein is increased. In some aspects, the transcriptional activator is attached to a Cas protein, which has been modified to lack endonuclease activity. [0021] For any of the methods provided herein (e.g., described above), in some aspects, after the contacting, the editing, the modifying, and/or the transducing, the immune cells are further cultured in an additional medium comprising potassium ion at a concentration higher than 5 mM. [0022] Provided herein is a method of preparing immune cells for immunotherapy comprising editing immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited, wherein the immune cells have been contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM. [0023] Provided herein is a method of increasing the stemness of immune cells during ex vivo or in vitro culture comprising editing immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited, wherein the immune cells have been contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, increasing the stemness of immune cells comprises increasing the percentage of the immune cells that exhibit the following phenotypic expression: CD45RO- CCR7 ⁺ CD45RA ⁺ CD62L ⁺ CD27 ⁺ CD28 ⁺ TCF7 ⁺ . [0024] Provided herein is a method of increasing the yield of immune cells during ex vivo or in vitro culture comprising editing immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited, wherein the immune cells have been contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM. [0025] Provided herein is a method of increasing both stemness and yield of immune cells during ex vivo or in vitro culture comprising editing immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited, wherein the immune cells have been contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, increasing the stemness of immune cells comprises increasing the percentage of the immune cells that exhibit the following phenotypic expression: CD45RO- CCR7 ⁺ CD45RA ⁺ CD62L ⁺ CD27 ⁺ CD28 ⁺ TCF7 ⁺ . [0026] Provided herein is a method of expanding a population of stem-like immune cells ex vivo or in vitro comprising editing immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited, wherein the immune cells have been contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM. [0027] Provided herein is a method of enhancing one or more properties of a population of immune cells in response to persistent antigen stimulation comprising editing immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited, wherein the immune cells have been contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM. [0028] In some aspects, the one or more properties are selected from: (a) an ability to produce a cytokine, (b) an ability to down-regulate an exhaustion marker, (c) an ability to proliferate, (d) an ability to kill tumor cells, and (e) any combination thereof. In some aspects, the cytokine comprises an IFN-γ, TNF-α, IL-2, or combinations thereof. [0029] In any of the methods provided herein (e.g., described above), in some aspects, after the editing, the immune cells are further cultured in an additional medium comprising potassium ion at a concentration higher than 5 mM. In any of the methods provided herein (e.g., described above), in some aspects, the editing comprises introducing a gene editing tool into the immune cells, and wherein the gene editing tool is capable of reducing the expression level of the NR4A family member in the immune cells. [0030] In any of the methods provided herein (e.g., described above), in some aspects, the immune cells have been transduced: (a) to express a ligand-binding protein, (b) to exhibit an increased expression of a c-Jun polypeptide, or (c) both (a) and (b). In some aspects, the immune cells have been transduced to comprise a nucleotide sequence encoding the ligand binding protein, such that the immune cells express the ligand-binding protein. In some aspects, the immune cells have been transduced to comprise a nucleotide sequence encoding the c-Jun polypeptide, such that the expression of the c-Jun polypeptide increased in the immune cells. In some aspects, the immune cells have been transduced to comprise a first nucleotide sequence encoding the ligand-binding protein and a second nucleotide sequence encoding the c-Jun polypeptide, such that the immune cells express the ligand- binding protein and the expression of the c-Jun polypeptide is increased in the immune cells. In some aspects, the first nucleotide sequence and the second nucleotide sequence are within a single vector. In some aspects, the immune cells have been transduced to comprise a transcriptional activator that is capable of increasing the expression level of an endogenous c-Jun protein in the immune cells, such that the expression of the endogenous c-Jun protein is increased. In some aspects, the transcriptional activator is attached to a Cas protein, which has been modified to lack endonuclease activity. [0031] In any of the methods provided herein (e.g., described above), in some aspects, the ligand binding protein is selected from a chimeric antigen receptor (CAR), a T cell receptor (TCR), a chimeric antibody-T cell receptor (caTCR), a chimeric signaling receptor (CSR), T cell receptor mimic (TCR mimic), or combinations thereof. In some aspects, the CAR is designed as a standard CAR, a split CAR, an off-switch CAR, an on-switch CAR, a first- generation CAR, a second-generation CAR, a third-generation CAR, or a fourth-generation CAR. In some aspects, the ligand binding protein comprises an antigen-binding domain, a transmembrane domain, a costimulatory domain, an intracellular signaling domain, or combinations thereof. [0032] In some aspects, the antigen-binding domain specifically binds to an antigen selected from the group consisting of AFP (alpha-fetoprotein), αvβ6 or another integrin, BCMA, Braf, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7/8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin 18.2, Claudin 6, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase/phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-α (fibroblast activation protein α), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-α (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gp100 (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight- melanoma-associated antigen), IGF1R (insulin-like growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL-13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma-associated antigen (MAGE)-A1, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC/peptide complexes (e.g., HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1), NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY- ESO, oncofetal antigen, PD-1, PD-L1, PRAME (preferentially expressed antigen of melanoma), progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen ), PSMA (prostate specific membrane antigen), ROR1, ROR2, SIRPα (signal- regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, HPV, and other pathogens, and any combination thereof. In some aspects, the antigen-binding domain specifically binds to ROR1. [0033] In some aspects, the costimulatory domain comprises a costimulatory domain of an interleukin-2 receptor (IL-2R), interleukin-12 receptor (IL-12R), IL-7, IL-21, IL-23, IL-15, CD2, CD3, CD4, CD7, CD8, CD27, CD28, CD30, CD40, 4-1BB/CD137, ICOS, lymphocyte function-associated antigen-1 (LFA-1), LIGHT, NKG2C, OX40, DAP10, or any combination thereof. In some aspects, the costimulatory domain comprises a 4- 1BB/CD137 costimulatory domain. [0034] In some aspects, the transmembrane domain comprises a transmembrane domain of KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, IL2R beta, IL2R gamma, IL7R α, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG/Cbp, NKG2D, NKG2C, CD19, CD8, or any combination thereof. In some aspects, the transmembrane domain comprises a CD28 transmembrane domain. [0035] In some aspects, the intracellular signaling domain comprises an intracellular signaling domain derived from CD3 zeta, FcR gamma, common FcR gamma (FCER1G), Fc gamma RIIa, FcR beta (Fc Epsilon Rib), CD3 gamma, CD3 delta, CD3 epsilon, CD22, CD79a, CD79b, CD278 (ICOS), FcεRI, CD66d, CD32, DAP10, DAP12, or any combination thereof. In some aspects, the intracellular signaling domain comprises a CD3 zeta intracellular signaling domain. [0036] In some aspects, the ligand-binding protein is a TCR, wherein the TCR specifically binds to a tumor antigen/MHC complex. In some aspects, the tumor antigen is derived from AFP, CD19, BCMA, CLL-1, CS1, CD38, CD19, TSHR, CD123, CD22, CD30, CD171, CD33, EGFRvIII, GD2, GD3, Tn Ag, PSMA, ROR1, ROR2, GPC1, GPC2, FLT3, FAP, TAG72, CD44v6, CEA, EPCAM, B7H3, KIT, IL- 13Ra2, mesothelin, IL-l lRa, PSCA, PRSS21, VEGFR2, LewisY, CD24, PDGFR-beta, SSEA-4, CD20, folate receptor alpha, ERBB2 (Her2/neu), Kras, Braf, MUC1, MUC16, EGFR, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gp100, bcr-abl, tyrosinase, EphA2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1/CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WTl, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV, HPV E6,E7, MAGE Al, ETV6- AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT- 2, Fos-related antigen 1, p53, p53 mutant, prostein, surviving, telomerase, PCTA- 1/Galectin 8, MelanA/MARTl, Ras mutant (e.g., HRAS, KRAS, NRAS), hTERT, sarcoma translocation breakpoints, ML- IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5, IGLL1, CD2, CD3ε, CD4, CD5, CD7, the extracellular portion of the APRIL protein, neoantigen, or any combinations thereof. [0037] In any of the methods provided herein (e.g., described above), in some aspects, the c-Jun polypeptide is linked to the ligand binding protein by a linker. [0038] In any of the methods provided herein (e.g., described above), in some aspects, the immune cells further express a truncated (EGFRt). In some aspects, the immune cells have been modified to comprise a nucleotide sequence encoding the EGFRt. In some aspects, the EGFRt comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence as set forth in SEQ ID NO: 24. In some aspects, the EGFRt comprises the amino acid sequence as set forth in SEQ ID NO: 24. In some aspects, the EGFRt is linked to the c-Jun polypeptide and/or the ligand binding protein by a linker. [0039] Where a linker is involved, in some aspects, the linker comprises a cleavable linker. In some aspects, the linker comprises a P2A linker, a T2A linker, an F2A linker, an E2A linker, a furin cleavage site, or any combination thereof. In some aspects, the linker comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 14. In some aspects, the linker comprises the amino acid sequence set forth in SEQ ID NO: 14. [0040] In any of the methods provided herein (e.g., described above), in some aspects, the PCS comprises (i) a base layer comprising high surface area mesoporous silica micro-rods (MSR); (ii) a continuous, fluid-supported lipid bilayer (SLB) layered on the MSR base layer; (iii) a plurality of surface cues loaded onto the PCS; and (iv) a plurality of soluble cues loaded onto the PCS. In some aspects, the PCS comprises (i) a base layer comprising high surface area mesoporous silica micro-rods (MSR); (ii) a continuous, fluid-supported lipid bilayer (SLB) layered on the MSR base layer; and (iii) a plurality of surface cues. For such aspects, the PCS can further comprise a plurality of soluble cues. In some aspects, one or more of the plurality of surface cues are loaded onto the SLB layer. In some aspects, one or more of the plurality of soluble cues are loaded onto the MSR base layer. In some aspects, one or more of the plurality of soluble cues are released from the PCS in a controlled-release manner. In some aspects, one or more of the plurality of soluble cues are released from the PCS in a sustained manner for at least about 30 days. In some aspects, the plurality of soluble cues comprises IL-1, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12, IL-15, IL-17, IL-21, transforming growth factor beta (TGF-β), or an agonist thereof, a mimetic thereof, a variant thereof, a functional fragment thereof, or a combination thereof. In some aspects, the plurality of soluble cues comprises (i) IL-2, an agonist thereof, a mimetic thereof, a variant thereof, a functional fragment thereof, or a combination thereof and (ii) a second soluble cue comprising IL-7, IL-21, IL-15, IL-15 superagonist, or any combination thereof. In some aspects, the plurality of soluble cues comprises (i) IL-2, an agonist thereof, a mimetic thereof, a variant thereof, a functional fragment thereof, or a combination thereof, (ii) a second soluble cue comprising IL-7, IL-21, IL-15, IL-15 superagonist, or any combination thereof, and (iii) a third soluble cue comprising IL-7, IL-21, IL-15, IL-15 superagonist, or any combination thereof. In some aspects, the plurality of soluble cues comprises an N-terminal IL-2 fragment comprising the first 30 amino acids of IL-2 (pl-30), an IL-2 superkine peptide, an IL-2 partial agonist peptide, or a combination thereof. In some aspects, the plurality of surface cues comprises a T-cell stimulatory molecule, a T- cell co-stimulatory molecule, or both a T-cell stimulatory molecule and a T cell co- stimulatory molecule. [0041] In some aspects, the T-cell stimulatory molecule and/or the T-cell co-stimulatory molecule is loaded onto the SLB. In some aspects, the T-cell stimulatory molecule and/or the T-cell co-stimulatory molecule is loaded via affinity pairing or chemical coupling. In some aspects, the affinity coupling comprises a biotin-streptavidin pair, an antibody- antigen pair, an antibody-hapten pair, an affinity pair, a capture protein pair, an Fc receptor- IgG pair, a metal-chelating lipid pair, or a combination thereof. In some aspects, the chemical coupling comprises azide-alkyne chemical (AAC) reaction, dibenzo-cyclooctyne ligation (DCL), tetrazine-alkene ligation (TAL), or any combination thereof. [0042] In some aspects, the T-cell stimulatory molecule and/or the T-cell co-stimulatory molecule is coated onto the SLB. In some aspects, the T-cell stimulatory molecule and/or the T-cell co-stimulatory molecule is partly embedded onto the SLB. In some aspects, the T-cell stimulatory molecule and/or T-cell co-stimulatory molecule is loaded onto the MSR. [0043] In some aspects, the T-cell stimulatory molecule and/or the T-cell co-stimulatory molecule comprises antibody molecules or antigen-binding fragments thereof. In some aspects, the T-cell stimulatory molecule comprises an anti-CD3 antibody or an antigen- binding portion thereof, an anti-macrophage scavenger receptor (MSR1) antibody or an antigen-binding portion thereof, an anti-T-cell receptor (TCR) antibody or an antigen- binding portion thereof, an anti-CD2 antibody or an antigen-binding portion thereof, an anti-CD47 antibody or an antigen-binding portion thereof, a major histocompatibility complex (MHC) molecule loaded with an MHC peptide or a multimer thereof, an MHC- immunoglobulin (Ig) conjugate or a multimer thereof, or a combination thereof. In some aspects, the T-cell co-stimulatory molecule comprises an antibody, or an antigen-binding portion thereof, which specifically binds to a co-stimulatory antigen comprising CD28, 4.1BB (CD137), OX40 (CD134), CD27 (TNFRSF7), GITR (CD357), CD30 (TNFRSF8), HVEM (CD270), LTfiR (TNFRSF3), DR3 (TNFRSF25), ICOS (CD278), CD226 (DNAM1), CRTAM (CD355),TIM1 (HAVCR1, KIM1), CD2 (LFA2, OX34), SLAM (CD150, SLAMF1), 2B4 (CD244, SLAMF4), Lyl08 (NTBA, CD352, SLAMF6), CD84 (SLAMF5), Ly9 (CD229, SLAMF3), CRACC (CD319, BLAME), or any combination thereof. In some aspects, the T-cell stimulatory molecule and/or the T-cell co-stimulatory molecule comprises bispecific antibodies or antigen binding portions thereof. In some aspects, the T-cell stimulatory molecule and/or the T-cell co-stimulatory molecule comprises a pair comprising CD3/CD28, CD3/ICOS, CD3/CD27, CD3/CD137, or a combination thereof. [0044] For any of the methods provided herein (e.g., described above), in some aspects, the PCS further comprises an immunoglobulin molecule that binds specifically to an Fc- fusion protein. In some aspects, the PCS further comprises a recruitment compound comprising granulocyte macrophage-colony stimulating factor (GM-CSF), chemokine (C- C motif) ligand 21 (CCL-21), chemokine (C-C motif) ligand 19 (CCL-19), Chemokine (C- X-C Motif) ligand 12 (CXCL12), interferon gamma (IFNy), a FMS-like tyrosine kinase 3 (Flt-3) ligand, or any combination thereof. In some aspects, the recruitment compound comprises granulocyte macrophage colony stimulating factor (GM-CSF). [0045] For any of the methods provided herein (e.g., described above), in some aspects, the PCS further comprises an antigen. In some aspects, the antigen comprises a tumor antigen. In some aspects, the tumor antigen is adenomatous polyposis coli protein (APC), adenosine deaminase-binding protein (AD Abp), a-fetoprotein, AFP (alpha-fetoprotein), AIM-2, AIM-3, and WT1), ART1, ART4, B7-H3, B7-H6, BAGE, BCMA, B-cyclin, BMI1, Braf, brain glycogen phosphorylase, BRAP, C13orf24, C6orfl53, C9orf 112, CA- 125, CA9 (carbonic anhydrase 9), CASP-8, cathepsin B, Cav-1, CCL-1 (C-C motif chemokine ligand 1), CD123, CD138, CD171, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD352, CD38, CD40, CD44, CD44v6, CD44v7/8, CD45, CD47, CD5, CD56, CD66e, CD70, CD74, CD74, CD79a, CD79b, CD98, cdc27, CDK-1, CDK4, CEA, CEA (carcinoembryonic antigen), c-erbB-2, Claudin 18.2, Claudin 6, c-MET, Colorectal associated antigen (CRC)- C017-1A/GA733, Connexin 37, COX-2, CT-7, cyclophilin b, CYNL2, Dipeptidyl peptidase IV (DPPIV), DLL3 (delta-like protein 3), DLL4, EBV- encoded nuclear antigen (EBNA)-I, E-cadherin, EGFRvIII, ENPP3 (ectonucleotide pyrophosphatase/phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, EPHa2 (ephrine receptor A2), EphA2/Eck, ephrinB2, ERBB dimers, ESO-1, estrogen receptor, ETBR (endothelin B receptor), EZH2, FAP-α (fibroblast activation protein α), FBP (a folate binding protein), FCRL5, fetal AchR (fetal acetylcholine receptor), fodrin, Fra-l/Fosl 1, FR-α (folate receptor alpha), GAGE-1, GAGE-family of tumor antigens, Ganglioside/GD2, GCC (guanyl cyclase C), GD2, GD2 gangliosides, GD3, GLEA2, GM2, GnT-V, GnT-V,, GOLGA, gp100 (glycoprotein 100), gp75, GPC2 (glypican-2), GPC3, gplOO, GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), GUI, H60, hepatitis B surface antigen, HER2, HER3, HER4, HLA-A complexed with peptides derived from AFP, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma-associated antigen), HSPH1, Ig kappa, Ig lambda, IGF1R (insulin-like growth factor 1 receptor), Ig-idiotype, IL-13Ra2 (IL-13 receptor alpha 2), IL13Ralpha, IL- 22Ra (IL-22 receptor alpha), ING4, KDR (kinase insert domain receptor), Ki67, KIAA0376, KRAS, Ku70/80, LAGE-I, Lewis Y, LI cell adhesion molecule (LI -CAM), Liv-1, Livin, lmp-1, LRRC8A (leucine rich repeat containing 8 Family member A), MAGE-1, MAGE-2, MAGE-3, MAGE-A, MAGE-A3, MAGE-A6, MART-1 (melan A), MCSP (melanoma-associated chondroitin sulfate proteoglycan), melanoma-associated antigen (MAGE)-A1, mesothelin, MHC/peptide complexes (e.g., MICA, MICB, midkin, MRP-3, MUC16, mucin 1 (MUC1), MUM-1, murine cytomegalovirus (MCMV), NAG, NCAM (neural cell adhesion molecule), Nectin-4, Nestin, NKG2D (natural killer group 2 member D) ligands, NKTR, NSEP1, NY-ESO, NY-ESO-1, OLIG2, oncofetal antigen, P1A, p53, PAP, PD-1, PD-L1, pl20ctn, pl5, Pmell l7, PRAME (preferentially expressed antigen of melanoma), progesterone receptor, PROX1, PSA (prostate specific antigen), PSCA (prostate stem cell antigen ), PSMA, PSMA (prostate specific membrane antigen), RAE-1 proteins, RAGE, ras, RBPSUH, RCAS1, ROR1, ROR2, RTN4, SART1, SART2, SART3, SCP-I, SIRPα (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), Smad family of tumor antigens, SOX10, SOX11, SOX2, SSX-2 (HOM-MEL- 40), SSX-4, SSX-5, SSX-I, SSX-I, STEAP1 (six transmembrane epithelial antigen of the prostate 1), Survivin, survivin, TAG72 (tumor-associated glycoprotein 72), T-cell receptor/CD3-zeta chain, TNKS2, TPBG (trophoblast glycoprotein), TPR, Trop-2, TRP-1, TRP-2, Tyrosinase, U2AF1L, UL16-binding protein-like transcript 1 (Multl), UPAR, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, WT-1, αvβ6 or another integrin, β- catenin, β1,6-Ν, β-catenin, γ-catenin, and antigens from HIV, HBV, HCV, HPV, and other pathogens, a patient-specific neoantigen, or an immunogenic peptide thereof, and any combination thereof. [0046] For any of the methods provided herein (e.g., described above), in some aspects, the weight ratio of the SLB to the MSR is between about 10:1 and about 1:20. In some aspects, the SLB comprises a lipid selected from the group consisting of (DMPC), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), palmitoyl-oleoylphosphatidylcholine (POPC), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylethanolamine (DMPE) and dipalmitoylphosphatidylethanolamine (DPPE), 1-stearoyl-2-myristoyl-sn- glycero-3-phosphocholine (8:0-14:0 PC), or a combination thereof. In some aspects, the PCS retains a continuous, fluid architecture for at least 14 days. In some aspects, the dry weight ratio of the MSR to the T-cell activating/co-stimulatory molecules is between 1 :1 to 50:1. [0047] For any of the methods provided herein (e.g., described above), in some aspects, the concentration of potassium ion is higher than about 10 mM, higher than about 15 mM, higher than about 20 mM, higher than about 25 mM, higher than about 30 mM, higher than about 35 mM, higher than about 40 mM, higher than about 45 mM, higher than about 50 mM, higher than about 55 mM, higher than about 60 mM, higher than about 65 mM, higher than about 70 mM, higher than about 75 mM, higher than about 80 mM, higher than about 85 mM, or higher than about 90 mM. In some aspects, the concentration of potassium ion is selected from the group consisting of about 40 mM, about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, and about 80 mM. In some aspects, the concentration of potassium ion is between about 30 mM and about 80 mM, between about 40 mM and about 80 mM, between about 50 mM and 80 mM, between about 60 mM and about 80 mM, between about 70 mM and about 80 mM, between about 40 mM and about 70 mM, between about 50 mM and about 70 mM, between about 60 mM and about 70 mM, between about 40 mM and about 60 mM, between about 50 mM and about 60 mM, or between about 40 mM and about 50 mM. In some aspects, the concentration of potassium ion is about 50 mM, about 60 mM, or about 70 mM. [0048] For any of the methods provided herein (e.g., described above), in some aspects, the medium further comprises sodium ion. In some aspects, the medium further comprises NaCl. In some aspects, the medium comprises less than about 140 mM, less than about 130 mM, less than about 120 mM, less than about 110 mM, less than about 100 mM, less than about 90 mM, less than about 80 mM, less than about 70 mM, less than about 60 mM, less than about 50 mM, or less than about 40 mM NaCl. [0049] For any of the methods provided herein (e.g., described above), in some aspects, the medium is hypotonic or isotonic. In some aspects, the medium is hypotonic, and wherein the sum of the potassium ion concentration and the sodium ion concentration, multiplied by two is less than 280 mM. In some aspects, the medium is hypotonic, and wherein the sum of the potassium ion concentration and the sodium ion concentration, multiplied by two is more than 240 mM and less than 280 mM. In some aspects, the medium is isotonic, and wherein the sum of the potassium ion concentration and the sodium ion concentration, multiplied by two is more than or equal to 280 mM and less than 300 mM. [0050] In some aspects, the concentration of potassium ion is about 60 mM, and the concentration of NaCl is less than about 80 mM, less than about 75 mM, less than about 70 mM, less than about 65 mM, or less than about 60 mM. In some aspects, the concentration of potassium ion is about 55 mM, and the concentration of NaCl is less than about 85 mM, less than about 80 mM, less than about 75 mM, less than about 70 mM, or less than about 65 mM. In some aspects, the concentration of potassium ion is about 50 mM, and the concentration of NaCl is less than about 90 mM, less than about 85 mM, less than about 80 mM, less than about 75 mM, or less than about 70 mM. [0051] For any of the methods provided herein (e.g., described above), in some aspects, the medium further comprises one or more cytokines. In some aspects, the one or more cytokines comprise Interleukin-2 (IL-2), Interleukin-7 (IL-7), Interleukin-21 (IL-21), Interleukin-15 (IL-15), or any combination thereof. In some aspects, the one or more cytokines comprise IL-2, IL-7, and IL-15. [0052] In some aspects, the medium comprises IL-2 at a concentration from about 50 IU/mL to about 500 IU/mL. In some aspects, the concentration of IL-2 is about 50 IU/mL, about 60 IU/mL, about 70 IU/mL, about 80 IU/mL, about 90 IU/mL, about 100 IU/mL, about 125 IU/mL, about 150 IU/mL, about 175 IU/mL, about 200 IU/mL, about 225 IU/mL, about 250 IU/mL, about 275 IU/mL, about 300 IU/mL, about 350 IU/mL, about 400 IU/mL, about 450 IU/mL, or about 500 IU/mL. In some aspects, the concentration of IL-2 is between about 100 IU/mL to about 300 IU/mL. In some aspects, the concentration of IL-2 is about 200 IU/mL. In some aspects, the medium comprises IL-21 at a concentration from about 50 IU/mL to about 500 IU/mL. In some aspects, the concentration of IL-21 is about 50 IU/mL, about 60 IU/mL, about 70 IU/mL, about 80 IU/mL, about 90 IU/mL, about 100 IU/mL, about 125 IU/mL, about 150 IU/mL, about 175 IU/mL, about 200 IU/mL, about 225 IU/mL, about 250 IU/mL, about 275 IU/mL, about 300 IU/mL, about 350 IU/mL, about 400 IU/mL, about 450 IU/mL, or about 500 IU/mL. In some aspects, the concentration of IL-21 is between about 100 IU/mL to about 300 IU/mL. In some aspects, the concentration of IL-21 is about 200 IU/mL. In some aspects, the medium comprises IL-7 at a concentration from about 500 IU/mL to about 1,500 IU/mL. In some aspects, the concentration of IL-7 is about 500 IU/mL, about 550 IU/mL, about 600 IU/mL, about 650 IU/mL, about 700 IU/mL, about 750 IU/mL, about 800 IU/mL, about 850 IU/mL, about 900 IU/mL, about 950 IU/mL, about 1,000 IU/mL, about 1,050 IU/mL, about 1,100 IU/mL, about 1,150 IU/mL, about 1,200 IU/mL, about 1,250 IU/mL, about 1,300 IU/mL, about 1,350 IU/mL, about 1,400 IU/mL, about 1,450 IU/mL, or about 1,500 IU/mL. In some aspects, the concentration of IL-7 is about 1,000 IU/mL to about 1,400 IU/mL. In some aspects, the concentration of IL-7 is about 1,200 IU/mL. In some aspects, the medium comprises IL-15 at a concentration from about 50 IU/mL to about 500 IU/mL. In some aspects, the concentration of IL-15 is about 50 IU/mL, about 60 IU/mL, about 70 IU/mL, about 80 IU/mL, about 90 IU/mL, about 100 IU/mL, about 125 IU/mL, about 150 IU/mL, about 175 IU/mL, about 200 IU/mL, about 225 IU/mL, about 250 IU/mL, about 275 IU/mL, about 300 IU/mL, about 350 IU/mL, about 400 IU/mL, about 450 IU/mL, or about 500 IU/mL. In some aspects, the concentration of IL-15 is between about 100 IU/mL to about 300 IU/mL. In some aspects, the concentration of IL-15 is about 200 IU/mL. [0053] For any of the methods provided herein (e.g., described above), in some aspects, the medium further comprises a cell expansion agent. In some aspects, the cell expansion agent comprises a GSK3B inhibitor, an ACLY inhibitor, a PI3K inhibitor, an AKT inhibitor, or any combination thereof. In some aspects, the PI3K inhibitor is selected from hydroxyl citrate, LY294002, pictilisib, CAL101, IC87114, and any combination thereof. In some aspects, the AKT inhibitor is selected from MK2206, A443654, AKTi-VIII, and any combination thereof. [0054] For any of the methods provided herein (e.g., described above), in some aspects, the medium further comprises calcium ion, glucose, or any combination thereof. [0055] In some aspects, the medium further comprises glucose, and wherein the concentration of glucose is more than about 10 mM. In some aspects, the concentration of glucose is from about 10 mM to about 25 mM, from about 10 mM to about 20 mM, from about 15 mM to about 25 mM, from about 15 mM to about 20 mM, from about 15 mM to about 19 mM, from about 15 mM to about 18 mM, from about 15 mM to about 17 mM, from about 15 mM to about 16 mM, from about 16 mM to about 20 mM, from about 16 mM to about 19 mM, from about 16 mM to about 18 mM, from about 16 mM to about 17 mM, from about 17 mM to about 20 mM, from about 17 mM to about 19 mM, or from about 17 mM to about 18 mM. In some aspects, the concentration of glucose is about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 21 mM, about 22 mM, about 23 mM, about 24 mM, or about 25 mM. In some aspects, the concentration of glucose is about 15.4 mM, about 15.9 mM, about 16.3 mM, about 16.8 mM, about 17.2 mM, or about 17.7 mM. [0056] In some aspects, the medium further comprises calcium ion, and wherein the concentration of calcium ion is more than about 0.4 mM. In some aspects, the concentration of calcium ion is from about 0.4 mM to about 2.5 mM, from about 0.5 mM to about 2.0 mM, from about 1.0 mM to about 2.0 mM, from about 1.1 mM to about 2.0 mM, from about 1.2 mM to about 2.0 mM, from about 1.3 mM to about 2.0 mM, from about 1.4 mM to about 2.0 mM, from about 1.5 mM to about 2.0 mM, from about 1.6 mM to about 2.0 mM, from about 1.7 mM to about 2.0 mM, from about 1.8 mM to about 2.0 mM, from about 1.2 to about 1.3 mM, from about 1.2 to about 1.4 mM, from about 1.2 to about 1.5 mM, from about 1.2 to about 1.6 mM, from about 1.2 to about 1.7 mM, from about 1.2 to about 1.8 mM, from about 1.3 to about 1.4 mM, from about 1.3 to about 1.5 mM, from about 1.3 to about 1.6 mM, from about 1.3 to about 1.7 mM, from about 1.3 to about 1.8 mM, from about 1.4 to about 1.5 mM, from about 1.4 to about 1.6 mM, from about 1.4 to about 1.7 mM, from about 1.4 to about 1.8 mM, from about 1.5 to about 1.6 mM, from about 1.5 to about 1.7 mM, from about 1.5 to about 1.8 mM, from about 1.6 to about 1.7 mM, from about 1.6 to about 1.8 mM, or from about 1.7 to about 1.8 mM. In some aspects, the concentration of calcium ion is about 1.0 mM, about 1.1 mM, about 1.2 mM, about 1.3 mM, about 1.4 mM, about 1.5 mM, about 1.6 mM, about 1.7 mM, about 1.8 mM, about 1.9 mM, or about 2.0 mM. [0057] For any of the methods provided herein (e.g., described above), in some aspects, the immune cells are CD3 ⁺ , CD45RO-, CCR7 ⁺ , CD45RA ⁺ , CD62L ⁺ , CD27 ⁺ , CD28 ⁺ , or TCF7 ⁺ , or any combination thereof, following the culturing. In some aspects, the immune cells comprise T cells, B cells, regulatory T cells (Treg), tumor infiltrating lymphocytes (TIL), natural killer (NK) cells, natural killer T (NKT) cells, or any combination thereof. In some aspects, the immune cells have been engineered in vitro or ex vivo. [0058] For any of the methods provided herein (e.g., described above), in some aspects, the gene editing tool comprises a shRNA, siRNA, miRNA, antisense oligonucleotides, CRISPR, zinc finger nuclease, TALEN, meganuclease, restriction endonuclease, or any combination thereof. In some aspects, the gene editing tool is CRISPR. [0059] For any of the methods provided herein (e.g., described above), in some aspects, the NR4A family member comprises NR4A1, NR4A2, NR4A3, or combinations thereof. In some aspects, the gene editing tool comprises a guide RNA comprising, consisting of, or consisting essentially of the sequence set forth in any one of SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 161, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 186, SEQ ID NO: 194, and SEQ ID NO: 196. [0060] For any of the methods provided herein (e.g., described above), in some aspects, the c-Jun polypeptide comprises an amino acid sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 13. In some aspects, the c-Jun polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 13. In some aspects, the nucleotide sequence encoding the c-Jun polypeptide comprises: (a) a nucleic acid sequence having at least 89%, at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 1; (b) a nucleic acid sequence having at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 2; (c) a nucleic acid sequence having at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 3; (d) a nucleic acid sequence having at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 4; (e) a nucleic acid sequence having at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 5; (f) a nucleic acid sequence having at least 88%, at least 89%, at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 6; (g) a nucleic acid sequence having at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 7; (h) a nucleic acid sequence having at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 8; (i) a nucleic acid sequence having at least 55%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 9; (j) a nucleic acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 10; or (k) a nucleic acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% sequence identity to the nucleic acid sequence as set forth in SEQ ID NO: 11. [0061] Also provided herein is a population of immune cells prepared by any of the methods provided herein. Some aspects of the present disclosure is related to a pharmaceutical composition comprising any of the population of immune cells described herein, and a pharmaceutically acceptable carrier. [0062] Also provided herein is a method of treating or preventing a disease or condition in a subject in need thereof comprising administering to the subject any of the population of immune cells or pharmaceutical compositions provided herein. In some aspects, the disease or condition comprises a cancer. [0063] In some aspects, the method further comprises administering at least one additional therapeutic agent to the subject. In some aspects, the at least one additional therapeutic agent comprises a chemotherapeutic drug, targeted anti-cancer therapy, oncolytic drug, cytotoxic agent, immune-based therapy, cytokine, surgical procedure, radiation procedure, activator of a costimulatory molecule, immune checkpoint inhibitor, a vaccine, a cellular immunotherapy, or any combination thereof. In some aspects, the immune checkpoint inhibitor comprises an anti-PD-1 antibody, anti-PD-L1 antibody, anti-LAG-3 antibody, anti-CTLA-4 antibody, anti-GITR antibody, anti-TIM3 antibody, or any combination thereof. BRIEF DESCRIPTION OF THE FIGURES [0064] FIG.1 provides schematic of different methods of culturing and modifying T cells (e.g., CAR T cells). As further described in Example 1, with the "control process" (top drawing), the activating with TRANSACT ^™ , transducing (e.g., with a ligand-binding construct), and editing (e.g., with a NR4A family member-targeting gRNA) steps all occur on separate days. In contrast, with the exemplary methods provided herein, two or more of the steps occur on the same day. For instance, with "PCS process A" (middle drawing), the activating with PCS, transducing, and editing all occur within a single day. With "PCS process B" (bottom drawing), the activating with PCS and transducing occur on the same day. However, the editing occurs on a separate day (e.g., two days after the activating and transducing). [0065] FIGs. 2A and 2B show the percentage of NR4A3-edited T cells present after culturing T cells (isolated from multiple donors) using the methods as described in FIG.1. In FIG. 2A, PCS process A is compared to the control process, with and without c-Jun overexpression (left and right panels, respectively) for three separate donors. In FIG.2B, PCS process B is compared to the control process for two separate donors. [0066] FIGs. 3A and 3B show the percentage of T cells with a memory phenotype (as evidenced by CD45RA ⁺ and CCR7 ⁺ expression) after culturing and modifying the T cells using one of the following methods: (a) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and not modified to exhibit reduced expression of NR4A3 (first bar in each set of the donors; "TA no EP"), (b) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and then two days later, modified to exhibit reduced expression of NR4A3 (second bar in each set of the donors; "TA D2 EP"; i.e., control process described in FIG.1), (c) activated with PCS in MRM and not modified to exhibit reduced expression of NR4A3 (third bar in each set of the donors; "PCS no EP"), and (d) concurrently activated PCS in MRM and modified to exhibit reduced expression of NR4A3 (fourth bar in each set of the donors; "PCS D0 EP"; i.e., PCS process A). T cells from the different groups were further modified to: (1) express anti-ROR1 CAR alone (FIG.3A) or (2) expression anti-ROR1 CAR and exhibit increased expression of a c-Jun protein (FIG. 3B). [0067] FIGs. 4A and 4B show the activated state of T cells (as evidenced by PD1 ⁺ and CD25 ⁺ expression) after culturing and modifying the T cells using one of the following methods: (a) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and not modified to exhibit reduced expression of NR4A3 (first bar in each set of the donors; "TA no EP"), (b) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and then two days later, modified to exhibit reduced expression of NR4A3 (second bar in each set of the donors; "TA D2 EP"; i.e., control process described in FIG.1), (c) activated with PCS in MRM and not modified to exhibit reduced expression of NR4A3 (third bar in each set of the donors; "PCS no EP"), and (d) concurrently activated PCS in MRM and modified to exhibit reduced expression of NR4A3 (fourth bar in each set of the donors; "PCS D0 EP"; i.e., PCS process A described in FIG.1). T cells from the different groups were further modified to: (1) express anti-ROR1 CAR alone (FIG.4A) or (2) expression anti-ROR1 CAR and exhibit increased expression of a c-Jun protein (FIG.4B). [0068] FIGs.5A and 5B show successive anti-ROR1 lysis of A549-NLR tumor cells and H1975-NLR tumor cells, respectively, by T cells modified and cultured as described herein. Specifically, T cells isolated from three different donors were cultured and modified using one of the following methods: (a) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and not modified to exhibit reduced expression of NR4A3 ("TA no EP"), (b) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and then two days later, modified to exhibit reduced expression of NR4A3 ("TA D2 EP; i.e., control process described in FIG.1), (c) activated with PCS in MRM and not modified to exhibit reduced expression of NR4A3 ("PCS no EP"), and (d) concurrently activated PCS in MRM and modified to exhibit reduced expression of NR4A3 ("PCS D0 EP"; i.e., PCS process A described in FIG.1). Each of the T cells were modified to express an anti-ROR1 CAR. Lysis of H1975-NLR target cells were quantified by measuring total NLR intensity. NLR intensity was normalized relative to the starting intensity after replating for each round of stimulation. NLR – NucLight Red. Each graph represents a separate donor. [0069] FIG. 6 shows successive anti-ROR1 lysis of A549-NLR tumor cells by T cells modified and cultured using one of the following methods: (a) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and not modified to exhibit reduced expression of NR4A3 ("TA no EP"), (b) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and then two days later, modified to exhibit reduced expression of NR4A3 ("TA D2 EP"; i.e., control process described in FIG.1), (c) activated with PCS in MRM and not modified to exhibit reduced expression of NR4A3 ("PCS no EP"), and (d) concurrently activated PCS in MRM and modified to exhibit reduced expression of NR4A3 ("PCS D0 EP"; i.e., PCS process A described in FIG.1). Each of the T cells were modified to express an anti-ROR1 CAR and exhibit an increased expression of a c-Jun protein. Lysis of H1975-NLR target cells were quantified by measuring total NLR intensity. NLR intensity was normalized relative to the starting intensity after replating for each round of stimulation. NLR – NucLight Red. Each graph represents a separate donor. [0070] FIGs.7A and 7B show successive anti-ROR1 lysis of H1975-NLR tumor cells by T cells modified and cultured using one of the following methods: (a) activated with PCS in MRM at 1X concentration and not modified to exhibit reduced expression of NR4A3 ("PCS (1X) no EP"), (b) activated with PCS in MRM at 0.8X concentration and not modified to exhibit reduced expression of NR4A3 ("PCS (0.8X) no EP"), (c) activated with PCS in MRM at 0.6X concentration and not modified to exhibit reduced expression of NR4A3 ("PCS (0.6X) no EP"), (d) activated with PCS in MRM at 1X concentration and two days later modifying the cells to exhibit reduced expression of NR4A3 (with 2 µM of gRNA) ("PCS (1X) D2 EP"), (e) activated with PCS in MRM at 0.8X concentration and two days later modifying the cells to exhibit reduced expression of NR4A3 (with 2 µM of gRNA) ("PCS (0.8X) D2 EP"), (f) activated with PCS in MRM at 0.6X concentration and two days later modifying the cells to exhibit reduced expression of NR4A3 ("PCS (0.6X) D2 EP") (with 2 µM of gRNA), (g) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and not modified to exhibit reduced expression of NR4A3 ("TA no EP"), (h) activated with a control substrate platform (e.g., TRANSACT ^™ ) and two days later modified to exhibit reduced expression of NR4A3 (with either 0.6 µM or 2 µM of gRNA) ("TA D2 EP"), and (i) concurrently activated PCS in MRM at 0.8X concentration and modified to exhibit reduced expression of NR4A3. The methods used in (d), (e), and (f) are also referred to herein as "PCS process B." The method used in (i) is also referred to herein as "PCS process A." The method used in (h) is also referred to herein as "control process." Each of the T cells were modified to express an anti-ROR1 CAR. Lysis of H1975- NLR target cells were quantified by measuring total NLR intensity. NLR intensity was normalized relative to the starting intensity after replating for each round of stimulation. NLR – NucLight Red. Each graph represents a separate donor. FIG.7A provides the results using T cells isolated from donor #1. FIG. 7B provides the results using T cells isolated from donor #2. [0071] FIGs.8A, 8B, and 8C provide comparison of IFN-γ, IL-2, and TNF-α production, respectively, by T cells (isolated from three different donors) after four or five rounds of antigen stimulation. The T cells were modified and cultured using one of the following methods: (a) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and not modified to exhibit reduced expression of NR4A3 (1 ^st bar for each of the stims; "TA no EP"), (b) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and then two days later, modified to exhibit reduced expression of NR4A3 (2 ^nd bar for each of the stims; "TA D2 EP"; i.e., control process described in FIG.1), (c) activated with PCS in MRM and not modified to exhibit reduced expression of NR4A3 (3 ^rd bar for each of the stims; "PCS no EP"), and (d) concurrently activated with PCS in MRM and modified to exhibit reduced expression of NR4A3 (fourth bar in each set of the donors) (4 ^th bar for each of the stims; "PCS D2 EP"; i.e., PCS process A described in FIG.1). In the top row, the T cells were modified to express anti-ROR1 CAR. In the bottom row, the T cells were modified to express anti-ROR1 CAR and also exhibit increased expression of a c-Jun protein. [0072] FIGs.9A, 9B, and 9C provide comparison of IFN-γ, IL-2, and TNF-α production, respectively, by T cells (isolated from two different donors) after four or five rounds of antigen stimulation (see x-axis). The T cells were modified and cultured using one of the following methods: (a) activated with PCS in MRM and no modification to reduced expression of NR4A3 ("PCS no EP"), (b) concurrently activated with PCS in MRM and modified to exhibit reduced expression of NR4A3 ("PCS D0 EP"; i.e., PCS process A described in FIG.1), (c) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and not modified to exhibit reduced expression of NR4A3 ("TA no EP"), (d) activated with a control substrate platform (e.g., TRANSACT ^™ ) in MRM and then two days later, modified to exhibit reduced expression of NR4A3 ("TA D2 EP"; i.e., control process described in FIG.1), and (e) activated with PCS in MRM and then two days later, modified to exhibit reduced expression of NR4A3 ("PCS D2 EP"; i.e., PCS process B described in FIG.1). [0073] FIG. 10 provides a table summarizing the effect of different culturing and modifying methods provided herein on both production and T cell function. "Process A" comprises activating (e.g., with PCS in MRM), transducing (e.g., with an anti-ROR1 CAR construct), and modifying (e.g., with a NR4A3-targeting gRNA) all on the same day. "Process B" comprises first activating the T cells with PCS in MRM and then, transducing the activated cells on the same day. At least about 24 hours later (e.g., 2 days later), the cells were modified with a NR4A3-targeting gRNA. [0074] FIG. 11 provides schematic of an additional exemplary method of culturing and modifying T cells used in Example 4 (see top row). Specifically, T cells were electroporated with a NR4A-targeting gene editing tool (e.g., NR4A3-targeting guide RNA described herein) and then cultured overnight in MRM (see day -1). Then, the following day, the NR4A-edited T cells were activated with PCS in the absence of exogenous IL-2, IL-7, and IL-15 and subsequently transduced with an anti-ROR1 CAR construct (e.g., c-Jun-R12 CAR) (see day 0). Afterwards, the T cells were cultured in MRM for seven days to promote further expansion of the T cells and then analyzed. For comparison, the control process (described in more detail in FIG.1) is also provided (see bottom row). [0075] FIGs. 12A-12F provide comparison of various production parameters after culturing and modifying T cells using either a control substrate platform (e.g., TRANSACT ^™ ) or different lots of PCS lacking IL-2, IL-7, and IL-15 (also referred to herein as "cytokine-free PCS"). The specific methods of culturing and modifying the T cells used were as described in FIG. 11. The different production parameters shown include: (a) T cell yield (defined as total viable cell number at harvest, i.e., day 7, over the total number of cells initially stimulated, i.e., day 0) (FIG.12A), (b) CD8 ⁺ T cell frequency (defined as the % of CD8 ⁺ cells in live CD3 ⁺ CD45 ⁺ T cells) (FIG.12B), (c) transduction efficiency (defined as the % of EGFR ⁺ cells in live CD3 ⁺ CD45 ⁺ T cells) (FIG.12C); (d) phenotypic memory profile as measured using flow cytometry with CD45RA expression along the y-axis and CCR7 expression along the x-axis (FIG.12D); (e) stemness profile as measured using flow cytometry with TCF expression along the y-axis and CD39 expression along the x-axis (FIG.12E); and (f) activation state as measured using flow cytometry with PD1 expression along the y-axis and CD25 expression along the x-axis (FIG.12F). T cells isolated from three different donors were used: DN1, DN2, and DN3. [0076] FIGs.13A and 13B show successive anti-ROR1 lysis of A549-NLR tumor cells by T cells modified and cultured using either a control substrate platform (e.g., TRANSACT ^™ ) or different lots of cytokine-free PCS. The specific methods of culturing and modifying the T cells used were as described in FIG. 11. In FIG. 13A, the modified T cells and tumor cells were cultured at a 1:1 ratio. In FIG.13B, the modified T cells and tumor cells were cultured at a 1:10 ratio. Each of the T cells were modified to express an anti-ROR1 CAR and exhibit an increased expression of a c-Jun protein. Lysis of A595-NLR target cells were quantified by measuring total NLR intensity. NLR intensity was normalized relative to the starting intensity after replating for each round of stimulation. NLR – NucLight Red. Each graph represents a separate donor. [0077] FIG. 14 shows successive anti-ROR1 lysis of H1975-NLR tumor cells by T cells modified and cultured using either a control substrate platform (e.g., TRANSACT ^™ ) or different lots of cytokine-free PCS. The specific methods of culturing and modifying the T cells used were as described in FIG. 11. Each of the T cells were modified to express an anti-ROR1 CAR and exhibit an increased expression of a c-Jun protein. The modified T cells and tumor cells were cultured at a 1:5 ratio. Each of the T cells were modified to express an anti-ROR1 CAR. Lysis of H1975-NLR target cells were quantified by measuring total NLR intensity. NLR intensity was normalized relative to the starting intensity after replating for each round of stimulation. NLR – NucLight Red. Each graph represents a separate donor. [0078] FIGs.15A-15B show improved in vivo anti-tumor activity of NR4A3 g4-edited and NR4A3 g47-edited ROR1 CAR T cells with c-Jun overexpression modified and cultured as described in FIG. 11. As further described in Example 4, the modified T cells were administered to NSG mice implanted with subcutaneous flank H1975 xenograft tumors, and then tumor volume (FIG. 15A) and T cell numbers in peripheral blood (FIG. 15B) were assessed at various time points. The modified T cells were administered at one of two doses: 0.4 x 10 ⁶ cells /mouse (left panels, low dose) or 2 x 10 ⁶ cells/mouse (right panels, high dose). Error bars represent mean +/- SEM. Average tumor volume curves are truncated when 20% of mice/group were removed from the study due to humane endpoints. [0079] FIGs. 16A and 16B show the percentage of TCF-7 expression in NR4A3-edited, control CD19-edited, or non-edited CD3 ⁺ ROR1 CAR T cells with c-Jun overexpression in cryopreserved CAR T cells generated in MRM with or without PCS in three independent research-scale healthy donors (FIG. 16A) and two independent clinical-scale healthy donors (FIG.16B). Error bars represent mean +/- SEM. [0080] FIGs. 17A and 17B show the percentage of NR4A3 genomic editing in NR4A3- edited T cells with c-Jun overexpression generated in MRM with or without PCS by next- generation sequencing in three independent research-scale healthy donors (FIG.17A) and two independent clinical-scale healthy donors (FIG. 17B). Error bars represent mean +/- SEM. [0081] FIGs.18A and 18B show the percentage of NR4A3 protein expression in NR4A3- edited, control CD19-edited, or non-edited CD3 ⁺ ROR1 CAR T cells with c-Jun overexpression generated in MRM with or without PCS following a 2-hour PMA+ionomycin stimulation in three independent research-scale healthy donors (FIG. 18A) and two independent clinical-scale healthy donors (FIG.18B) (Stim, filled circles). Unstim cells (opened circles, without PMA+ionomycin) were used as a negative control. Error bars represent mean +/- SEM. Unpaired t-test of stimulated conditions were used for statistical analysis. ns – not significant, * p < 0.05, ** p < 0.005, *** p < 0.001. [0082] FIGs. 19A–19G show successive anti-ROR1 lysis of A549-NLR NSCLC at 1:10 E:T ratio (FIG. 19A), H1975-NLR NSCLC at 1:10 E:T ratio (FIG. 19B), BxPC3-NLR pancreatic cancer at 1:10 E:T ratio (FIG. 19C), H2452-NLR mesothelioma at 1:10 E:T ratio (FIG.19D), MDA-MB-231-NLR triple negative breast cancer at 1:1 E:T ratio (FIG. 19E), SW620-NLR colorectal cancer at 1:1 E:T ratio (FIG. 19F), and SK-OV-3-NLR ovarian cancer at 1:1 E:T ratio (FIG.19G) by c-Jun overexpressing NR4A3-edited, control CD19-edited, and non-edited ROR1 CAR T cells generated in MRM with or without PCS in 1-3 independent research-scale healthy donors (top row; Donor #1, Donor #2, and/or Donor #3) or 2 independent clinical-scale healthy donors (bottom row; Donor #4 and Donor #5) in the sequential stimulation assay. Lysis of NLR target cells were quantified by measuring total NLR intensity. NLR intensity was normalized relative to the starting intensity after replating for each round of stimulation. NLR – NucLight Red. [0083] FIG.20 shows successive anti-ROR1 lysis of H1975-NLR NSCLC tumor cells at 1:25 E:T ratio by c-Jun overexpressing NR4A3-edited or non-edited ROR1 CAR T cells generated in MRM with or without PCS in 4 independent research-scale NSCLC patient donors (NSCLC-1 to NSCLC-4) in the sequential stimulation assay. Lysis of NLR target cells were quantified by measuring total NLR intensity. NLR intensity was normalized relative to the starting intensity after replating for each round of stimulation. NLR – NucLight Red. [0084] FIGs. 21A–21G show secreted interferon-gamma (IFN- ^^) (left) and interleukin-2 (IL-2) (right) produced from c-Jun overexpressing NR4A3-edited, control CD19-edited, and non-edited ROR1 CAR T cells generated in MRM with or without PCS during the sequential stimulation assay corresponding to FIGs. 19A-19G with the following tumor cells: A549-NLR NSCLC at 1:10 E:T ratio (FIG.21A), H1975-NLR NSCLC at 1:10 E:T ratio (FIG. 21B), BxPC3-NLR pancreatic cancer at 1:10 E:T ratio (FIG. 21C), H2452- NLR mesothelioma at 1:10 E:T ratio (FIG. 21D), MDA-MB-231-NLR triple negative breast cancer at 1:1 E:T ratio (FIG.21E), SW620-NLR colorectal cancer at 1:1 E:T ratio (FIG.21F), and SK-OV-3-NLR ovarian cancer at 1:1 E:T ratio (FIG.21G). Supernatants were collected 24 hours after each replating and cytokines were quantified by MSD. Error bars represent mean +/- SD of triplicate wells. [0085] FIG. 22 shows the fold change in CD3 ⁺ ROR1 CAR T cell numbers of c-Jun overexpressing NR4A3-edited, control CD19-edited, and non-edited ROR1 CAR T cells generated in MRM with or without PCS from the fourth round of a H1975-NLR sequential stimulation assay at 1:1 E:T ratio in three independent research-scale healthy donors (left) and two independent clinical-scale healthy donors (right). Fold change was calculated as (CD3 ⁺ ROR1 CAR T cell numbers from Stim 4 / CD3 ⁺ ROR1 CAR T cell numbers plated for Stim 1). [0086] FIGs. 23A and 23B show the percentage of TIM-3 (left), CD39 (middle), and CD127 (right) expression from c-Jun overexpressing NR4A3-edited, control CD19-edited, and non-edited ROR1 CAR T cells generated in MRM with or without PCS after four rounds of H1975-NLR sequential stimulation at a 1:1 E:T ratio in three independent research-scale healthy donors (FIG. 23A) and two independent clinical-scale healthy donors (FIG. 23B). Error bars represent mean +/- SEM. Tukey’s mixed-effects one-way ANOVA (research-scale donors) and unpaired t-test (clinical-scale donors) were used for statistical analysis. * p < 0.05, ** p < 0.005. [0087] FIGs. 24A-24E show single cell Multiome data (RNA+ATAC) of NR4A3 KO + c-Jun + MRM + PCS and non-edited + c-Jun + MRM CD8 ⁺ ROR1 CAR T cells collected on day 15 of serial stimulation assay from 2 donors. (FIG.24A) UMAP representation of NR4A3 KO + c-Jun + MRM + PCS and non-edited + c-Jun + MRM CD8 ⁺ ROR1 CAR T cells; (FIG. 24B) Identified terminally exhausted clusters (highlighted) in the 2 donors (left); RNA expression of TIGIT (middle); and chromVar enrichment score of EOMES motif (right, JASPAR ID MA0800.1) on the UMAP representation; (FIG. 24C) Proportions of terminally exhausted clusters in the 2 donors; (FIG. 24D) Significantly lower enrichment score for exhaustion-associated gene sets in NR4A3 KO + c-Jun + MRM + PCS CD8 ⁺ ROR1 CAR T cells compared to non-edited + c-Jun + MRM CD8 ⁺ ROR1 CAR T cells, in pseudobulk RNA-Seq data analysis; (FIG.24E) RNA expression of genes with global differential expression between NR4A3 KO + c-Jun + MRM + PCS and non- edited + c-Jun + MRM CD8 ⁺ ROR1 CAR T cells on the UMAP representation (terminally exhausted clusters were removed). Genes down-regulated in NR4A3 KO + c-Jun + MRM + PCS: ENTPD1, LAYN, LYST; Genes up-regulated in NR4A3 KO + c-Jun + MRM + PCS: GNLY, IL7R. [0088] FIGs. 25A-25C show improved in vivo efficacy of NR4A3-edited ROR1 CAR T cells with c-Jun overexpression generated in MRM with or without PCS. Tumor volume (FIG.25A), peripheral blood CAR T cell numbers (FIG. 25B), and survival (FIG. 25C) of NSG mice implanted with subcutaneous flank H1975 xenograft tumors are shown. Mice were treated i.v. with a single dose of 1 x 10 ⁶ mock non-transduced non-edited T cells or 1 x 10 ⁶ (upper panels, high dose), 0.3 x 10 ⁶ (middle panels, medium dose), or 0.1 x 10 ⁶ (lower panels, low dose) CAR T cells per mouse of NR4A3-edited, control CD19-edited, or non- edited ROR1 CAR T cells with c-Jun overexpression generated in MRM with or without PCS formulation when mean tumor volumes reached an average of 100-140 mm ³ . n = 6- 10 mice per group. Error bars represent mean +/- SEM. Average tumor volume curves are truncated when 20% or more mice/group were removed from the study due to humane endpoints. Graphs show data from two independent research-scale healthy donors. DETAILED DESCRIPTION OF THE DISCLOSURE [0089] The efficacy of cellular immunotherapy is dependent on a number of factors including the persistence, multipotency, and asymmetric cell division of the cell product that is infused into the patient. The media and methods used in culturing and/or engineering (also referred to herein as "modifying") of the cells used for cell therapy can profoundly affect the metabolic, epigenetic, and phenotypic attributes of these cells thereby affecting their therapeutic potential. The present disclosure is generally directed to the use of certain agents (e.g., programmable cell-signaling scaffold, medium comprising potassium ion at a concentration higher than 5 mM, and gene editing tools that specifically target a NR4A family member) to enhance such attributes of cells (e.g., immune cells) that are useful for cell therapy. As is apparent from the present disclosure, the cells described herein have been (a) contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM and (b) modified (i.e., edited) to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member (e.g., NR4A1, NR4A2, and/or NR4A3), as compared to corresponding cells which have not been modified. Unless indicated otherwise, a reduced expression level of a NR4A family member can comprise a reduced gene expression and/or reduced protein expression. In some aspects, the cells described herein have been further modified (i.e., transduced) to exhibit increased expression of a c-Jun protein, as compared to corresponding cells which have not been further modified. Non-limiting examples of the various aspects are provided throughout the present disclosure. Terms [0090] In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application. [0091] Throughout the disclosure, the term "a" or "an" entity refers to one or more of that entity; for example, "a chimeric polypeptide," is understood to represent one or more chimeric polypeptides. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein. In addition, "or" is used to mean an open list of the components in the list. For example, “wherein X comprises A or B” means X comprises A, X comprises B, X comprises A and B, or X comprises A or B and any other components. [0092] Furthermore, "and/or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a phrase such as "A and/or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). [0093] It is understood that wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of" and/or "consisting essentially of" are also provided. [0094] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. [0095] Units, prefixes, and symbols are denoted in their Système International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range, unless otherwise explicitly stated. [0096] Abbreviations used herein are defined throughout the present disclosure. Various aspects of the disclosure are described in further detail in the following subsections. [0097] The terms "about" or "comprising essentially of" refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, "about" or "comprising essentially of" can mean within 1 or more than 1 standard deviation per the practice in the art. Alternatively, "about" or "comprising essentially of" can mean a range of up to 10% (e.g., a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value)). For example, "about 55 mM," as used herein, includes 49.5 mM to 60.5 mM. Furthermore, particularly with respect to biological systems or processes, the terms can mean up to an order of magnitude or up to 5-fold of a value. When particular values or compositions are provided in the application and claims, unless otherwise stated, the meaning of "about" or "comprising essentially of" should be assumed to be within an acceptable error range for that particular value or composition. [0098] As used herein, the term "approximately," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In some aspects, the term "approximately", like the term “about”, refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). [0099] As described herein, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. [0100] As used herein, the term "culturing" (including any derivatives thereof) refers to the process in which cells (e.g., T cells and/or NK cells) are maintained, sustained, propagated, and/or modified under a controlled condition. For instance, unless indicated otherwise, culturing can comprise the step of contacting cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, culturing can comprise the step of modifying the cells, e.g., to exhibit a reduced expression of a NR4A family member, to exhibit an increased expression of a c-Jun protein, and/or to express a ligand binding protein (e.g., CAR and/or TCR). In some aspects, culturing can comprise the step of maintaining and/or expanding the cells after the contacting and modifying are performed. As used herein, "culturing" includes the growth of cells, e.g., immune cells, e.g., one or more engineered immune cell disclosed herein, during cell expansion, or cell engineering (e.g., transduction with a construct for expressing a CAR, a TCR, or a TCRm). In some aspects, the cultured cells are obtained from a subject, e.g., a human subject/patient. In some aspects, the cultured cells comprise immune cells obtained from a human subject/patient. In some aspects, the cultured cells comprise one or more engineered immune cell disclosed herein. In some aspects, the cultured cells comprise T cells or NK cells obtained from a human subject/patient. In some aspects, the T cells and/or NK cells are purified prior to the culture. In some aspects, the T cells and/or NK cells are tumor- infiltrating T cells and/or NK cells. In some aspects, the cultured cells comprise one or more engineered immune cell disclosed herein. [0101] The term "control media," “conventional culture media,” or "reference culture media" as used herein refers to any media in comparison to a metabolic reprogramming media (MRM) disclosed herein (e.g., comprising potassium ion at a concentration higher than 5 mM). Control media can comprise the same components as the metabolic reprogramming media except certain ion concentrations, e.g., potassium ion. In some aspects, metabolic reprogramming media described herein are prepared from control media by adjusting one or more ion concentrations, e.g., potassium ion concentration, as described herein. In some aspects, control media comprise basal media, e.g., CTS™ OPTMIZER™. In some aspects, control media thus comprises one or more additional components, including, but not limited to, amino acids, glucose, glutamine, T cell stimulators, antibodies, substituents, etc. that are also added to the metabolic reprogramming media, but control media have certain ion concentrations different from the metabolic reprogramming media. In some aspects, the control media does not comprise programmable cell-signaling scaffolds (PCS), as disclosed herein. Unless indicated otherwise, the terms "media" and "medium" can be used interchangeably. [0102] As used herein, the term "edited" (and grammatical variant thereof) refers to the process by which cells (e.g., T cells and/or NK cells) have been modified such that the cells are functionally and/or structurally different from corresponding non-modified cells. Unless indicated otherwise, the expression "editing the immune cells to exhibit a reduced expression level of a NR4A family member" (or equivalent thereof) and the expression "modifying the immune cells to exhibit a reduced expression level of a NR4A family member" (or equivalent thereof) can be used interchangeably. More specifically, as further described herein, cells (e.g., T cells and/or NK cells) provided herein have been edited such that the cells exhibit reduced expression of a NR4A protein and/or gene as compared to non-edited cells. Accordingly, the term "NR4A-edited" as used herein refers to a reduced expression of one or more members of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3). In some aspects, NR4A-edited cells (e.g., NR4A1-edited, NR4A2-edited, and/or NR4A3-edited) exhibit no expression of one or more members of the NR4A family. In some aspects, NR4A-edited cells exhibit some expression of a member of the NR4A family but at much reduced level compared to corresponding non-edited cells. In some aspects, compared to corresponding non-edited cells, NR4A expression in a NR4A-edited cells provided herein is reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%. Unless indicated otherwise, the terms "edited," "knock out," and "deficient" (including any derivatives thereof) are used interchangeably in the present disclosure. Therefore, in some aspects, "NR4A-edited," "NR4A-knock out," and "NR4A-deficient" refer to the same type of immune cells. [0103] As used herein, the expression "transducing immune cells to exhibit an increased expression level of a c-Jun polypeptide" (or equivalent thereof) refers to the process of modifying the immune cells such that the immune cells express higher level of a c-Jun polypeptide as compared to immune cells that have not been transduced. Non-limiting examples of transducing immune cells to exhibit increased expression of a c-Jun are provided elsewhere in the present disclosure. Unless indicated otherwise, "transducing immune cells to exhibit an increased expression level of a c-Jun polypeptide" (or equivalent thereof) can be used interchangeably with "modifying immune cells to exhibit an increased expression level of a c-Jun polypeptide" (or equivalent thereof). Similarly, the expression "transducing immune cells to express a ligand-binding protein" (or equivalent thereof) refers to the process of modifying the immune cells such that the immune cells express a ligand-binding protein. As described herein, in some aspects, the immune cells do not naturally express the ligand-binding protein. Non-limiting examples of transducing immune cells to express a ligand-binding protein is also provided elsewhere in the present disclosure. Unless indicated otherwise, "transducing immune cells to express a ligand- binding protein" (or equivalent thereof) can be used interchangeably with "modifying immune cells to express a ligand-binding protein (or equivalent thereof). [0104] As further described herein, immune cells described herein differ from corresponding immune cells that naturally exist in nature. For instance, in some aspects, immune cells described herein have been engineered or modified, e.g., (a) contacted with a PCS, (b) edited to exhibit a reduced expression level of a NR4A family member, (c) transduced to express a ligand-binding protein, (d) transduced to exhibit an increased expression of a c-Jun polypeptide, or (e) any combination of (a) to (d). Based on the disclosures provided in the present application, a skilled artisan will understand that the terms "modified," "edited," "transduced," and "engineered" (or grammatical variants thereof) can be used interchangeably. [0105] The term "expand" or "expansion," as used herein in reference to immune cell culture refers to the process of stimulating or activating the cells and culturing the cells. The expansion process can lead to an increase in the proportion or the total number of desired cells, e.g., an increase in the proportion or total number of less differentiated immune cells, in a population of cultured cells, after the cells are stimulated or activated and cultured. Expansion does not require that all cell types in a population of cultured cells are increased in number. Rather, in some aspects, only a subset of cells in a population of cultured cells are increased in number during expansion, while the number of other cell types cannot change or can decrease. [0106] As used herein, the term "yield" refers to the total number of cells following a culture method or a portion thereof. In some aspects, the term "yield" refers to a particular population of cells, e.g., stem-like T cells in a population of T cells. The yield can be determined using any methods, including, but not limited to, estimating the yield based on a representative sample. Non-limiting example of determining yield is provided in FIG.2. [0107] As used herein, the term "metabolic reprogramming media," "metabolic reprogramming medium," or "MRM," refers to a medium of the present disclosure, wherein the medium has an increased potassium ion concentration. In some aspects, the metabolic reprogramming media comprises potassium ion at a concentration higher than 5 mM. Accordingly, unless indicated otherwise, "medium comprising potassium ion at a concentration higher than 5 mM" and "metabolic reprogramming media" can be used interchangeably in the present disclosure. In some aspects, the metabolic reprogramming media comprises potassium ion at a concentration higher than 40 mM. In some aspects, the metabolic reprogramming media comprises a concentration of potassium ion of at least about 10 mM, at least about 15 mM, at least about 20 mM, at least about 25 mM, at least about 30 mM, at least about 35 mM, at least about 40 mM, at least about 45 mM, at least about 50 mM, at least about 55 mM, at least about 60 mM, at least about 65 mM, at least about 70 mM, at least about 75 mM, at least about 80 mM, at least about 85 mM, at least about 90 mM, at least about 95 mM, or at least about 100 mM. In some aspects, the metabolic reprogramming media comprises about 40 mM to about 80 mM NaCl, about 40 mM to about 90 mM KCl, about 0.5 mM to about 2.8 mM calcium, and about 10 mM to about 24 mM glucose. In some aspects, the metabolic reprogramming media further comprises an osmolality of about 250 to about 300 mOsmol. In some aspects, the metabolic reprogramming medium further comprises programmable cell-signaling scaffolds (PCS) as disclosed herein. [0108] As used herein, the term "higher than" means greater than but not equal to. For example, "higher than 5 mM" means any amount that is more than 5 mM, but which does not include 5 mM. [0109] As used herein, the term "tonicity" refers to the calculated effective osmotic pressure gradient across a cell membrane, represented by the sum of the concentration of potassium ion and the concentration of sodium chloride (NaCl), multiplied by two. Tonicity can be expressed in terms of the osmolality (mOsm/kg) or osmolarity (mOsm/L) of the solution, e.g., the media. Osmolality and osmolarity are measurements of the solute osmotic concentration of a solvent per mass (osmolality) and per volume (osmolarity). As used herein, an isotonic medium has a tonicity of about 280 mOsm/L (e.g., ([K ⁺ ] + [NaCl]) X 2 = 280). [0110] As used herein, a hypotonic solution has a tonicity of less than 280 mOsm/L (e.g., ([K ⁺ ] + [NaCl]) X 2 < 280). In some aspects, a hypotonic medium has a tonicity from at least about 210 mOsm/L to less than about 280 mOsm/L. In some aspects, a hypotonic medium has a tonicity from at least about 220 mOsm/L to less than about 280 mOsm/L. In some aspects, a hypotonic medium has a tonicity from at least about 230 mOsm/L to less than about 280 mOsm/L. In some aspects, a hypotonic medium has a tonicity from at least about 240 mOsm/L to less than about 280 mOsm/L. In some aspects, a hypotonic medium described herein has a tonicity of about 250 mOsm/L. [0111] As used herein, a hypertonic solution has a tonicity of greater than 300 mOsm/L (e.g., ([K ⁺ ] + [NaCl]) X 2 > 300). In some aspects, a hypertonic medium described herein has a tonicity of about 320 mOsm/L. In some aspects, the tonicity of the solution, e.g., medium is adjusted by increasing or decreasing the concentration of potassium ions and NaCl. In some aspects, the tonicity of a medium can be maintained by offsetting the increase of one solute with a decrease in a second solute. For example, increasing the concentration of potassium ion in a medium without changing the concentration of sodium ions can increase the tonicity of the medium. However, if the concentration of potassium ions is increased and the concentration of sodium ions is decreased, the tonicity of the original medium can be maintained. [0112] As used herein, the terms "potassium," "potassium ion," "potassium cation," and "K ⁺ " are used interchangeably to refer to elemental potassium. Elemental potassium exists in solution as a positive ion. However, it would be readily apparent to a person of ordinary skill in the art that standard means of preparing a solution comprising potassium ion include diluting a potassium containing salt (e.g., KCl) into a solution. As such, a solution, e.g., a medium, comprising a molar (M) concentration of potassium ion, can be described as comprising an equal molar (M) concentration of a salt comprising potassium. [0113] As used herein, the terms "sodium ion" and "sodium cation" are used interchangeably to refer to elemental sodium. Elemental sodium exists in solution as a monovalent cation. However, it would be readily apparent to a person of ordinary skill in the art that standard means of preparing a solution comprising sodium ion include diluting a sodium-containing salt (e.g., NaCl) into a solution. As such, a solution, e.g., a medium, comprising a molar (M) concentration of sodium ion, can be described as comprising an equal molar (M) concentration of a salt comprising sodium. [0114] As used herein, the terms "calcium ion" and "calcium cation" are used interchangeably to refer to elemental calcium. Elemental calcium exists in solution as a divalent cation. However, it would be readily apparent to a person of ordinary skill in the art that standard means of preparing a solution comprising calcium ion include diluting a calcium-containing salt (e.g., CaCl ₂ ) into a solution. As such, a solution, e.g., a medium, comprising a molar (M) concentration of calcium ion, can be described as comprising an equal molar (M) concentration of a salt comprising calcium. [0115] As used herein, the term "immune cell" refers to a cell of the immune system. In some aspects, the immune cell is selected from a T lymphocyte ("T cell"), B lymphocyte ("B cell"), natural killer (NK) cell, natural killer T lymphocytes (NKT cells), macrophage, eosinophil, mast cell, dendritic cell or neutrophil. As used herein, a "population" of cells refers to a collection of more than one cell, e.g., a plurality of cells. In some aspects, the population of cells comprises more than one immune cell, e.g., a plurality of immune cells. In some aspects, the population of cells is comprises a heterogeneous mixture of cells, comprising multiple types of cells, e.g., a heterogeneous mixture of immune cells and non- immune cells. In some aspects, the population of cells comprises a plurality of T cells. [0116] As used herein, the term "reference immune cell" (or "reference cell") refers to a cell which has not been modified and/or cultured using the methods provided herein. For example, in some aspects, a reference cell comprises a cell (e.g., corresponding immune cell) that has not been contacted with PCS in MRM and edited as described herein (e.g., with any of the NR4A member targeting gRNA sequences). In some aspects, a reference cell comprises such a cell (which has not been contacted with PCS and modified as described herein) cultured in a medium of the present disclosure (e.g., comprising potassium ion at a concentration higher than 5 mM). In some aspects, a reference cell comprises such a cell (which has not been contacted with PCS and modified as described herein) cultured in a medium that does not comprise potassium ion at a concentration higher than 5 mM (i.e., reference medium). In some aspects, a reference cell comprises a cell which has been modified as described herein (e.g., contacted with PCS and edited to exhibit reduced expression of a NR4A member) but cultured in the reference medium. Accordingly, unless indicated otherwise, reference cell can comprise any of the following: (1) a cell (e.g., corresponding immune cell) which has not been modified as described herein (e.g., has not been contacted with PCS in MRM and edited with a NR4A-specific gRNA sequence); (2) a cell (e.g., corresponding immune cell) which has neither been modified as described herein nor cultured in a medium of the present disclosure; (3) a cell (e.g., corresponding immune cell) which has not been modified as described herein but cultured in a medium of the present disclosure; (4) a cell (e.g., corresponding immune cell) which has been modified as described herein but cultured in a reference medium; or (5) any combination of (1) to (4). Based on at least the present disclosure, it will be apparent to those skilled in the arts the scope of the term "reference cell" when used herein. [0117] As used herein, the terms "T cell" and "T lymphocyte" are interchangeable and refer to any lymphocytes produced or processed by the thymus gland. Non-limiting classes of T cells include effector T cells and T helper (Th) cells (such as CD4 ⁺ or CD8 ⁺ T cells). In some aspects, the T cell is a Th1 cell. In some aspects, the T cell is a Th2 cell. In some aspects, the T cell is a Tc17 cell. In some aspects, the T cell is a Th17 cell. In some aspects, the T cell is a T _reg cell. In some aspects, the T cell is a tumor-infiltrating cell (TIL). [0118] As used herein, the term "memory" T cells refers to T cells that have previously encountered and responded to their cognate antigen (e.g., in vivo, in vitro, or ex vivo) or which have been stimulated, e.g., with an anti-CD3 antibody (e.g., in vitro or ex vivo). Immune cells having a "memory-like" phenotype upon secondary exposure, such memory T cells can reproduce to mount a faster and stronger immune response than during the primary exposure. In some aspects, memory T cells comprise central memory T cells (T _CM cells), effector memory T cells (TEM cells), tissue resident memory T cells (TRM cells), stem cell-like memory T cells (TSCM cells), or any combination thereof. [0119] As used herein, the term "stem cell-like memory T cells," "T memory stem cells," or "T _SCM cells" refers to memory T cells that express CD95, CD45RA, CCR7, and CD62L and are endowed with the stem cell-like ability to self-renew and the multipotent capacity to reconstitute the entire spectrum of memory and effector T cell subsets. [0120] As used herein, the term "central memory T cells" or "T _CM cells" refers to memory T cells that express CD45RO, CCR7, and CD62L. Central memory T cells are generally found within the lymph nodes and in peripheral circulation. [0121] As used herein, the term "effector memory T cells" or "T _EM cells" refers to memory T cells that express CD45RO but lack expression of CCR7 and CD62L. Because effector memory T cells lack lymph node-homing receptors (e.g., CCR7 and CD62L), these cells are typically found in peripheral circulation and in non-lymphoid tissues. [0122] As used herein, the term "tissue resident memory T cells" or "TRM cells" refers to memory T cells that do not circulate and remain resident in peripheral tissues, such as skin, lung, and gastrointestinal tract. In some aspects, tissue resident memory T cells are also effector memory T cells. [0123] As used herein, the term "naïve T cells" or "TN cells" refers to T cells that express CD45RA, CCR7, and CD62L, but which do not express CD95. T _N cells represent the most undifferentiated cell in the T cell lineage. The interaction between a T _N cell and an antigen presenting cell (APC) induces differentiation of the TN cell towards an activated TEFF cell and an immune response. [0124] As used herein, the term "stemness," "stem cell-like," "stem-like," or "less- differentiated" refers to an immune cell (e.g., a T cell, an NK cell, or a TIL), that expresses markers consistent with a more naïve phenotype. For example, a less differentiated T cell can express one or more marker characteristic of a T _N or a T _SCM cell. In some aspects, a "less-differentiated" or "stem-like" T cell expresses CD45RA, CCR7, and CD62L. In some aspects, a "less-differentiated" or "stem-like" T cell expresses CD45RA, CCR7, CD62L, and TCF7. In some aspects, a "less-differentiated" or "stem-like" T cell does not express CD45RO or is CD45RO ^low . In some aspects, the methods disclosed herein promote immune cells (e.g., T cells and/or NK cells) having a less-differentiated phenotype. Without being bound by any particular mechanism, in some aspects, the methods disclosed herein block, inhibit, or limit differentiation of less-differentiated immune cells (e.g., T cells and/or NK cells), resulting in an increased number of stem-like cells in culture. For example, it is generally thought that to effectively control tumors, adoptive transfer of less-differentiated immune cells, e.g., T cells and/or NK cells, with a stem cell-like memory or central memory phenotype are preferred. See Gattinoni, L., et al., J. Clin. Invest. 115:1616–1626 (2005), Gattinoni, L., et al. Nat Med 15(7):808-814 (2009), Lynn, R.C., et al., Nature 576(7786): 293-300 (2019); Gattinoni, L., et al. Nat Rev 12:671-684 (2012), Klebanoff, C., et al., J. Immunother 35(9):651-670 (2012) and Gattinoni, L., et al., Nat Med 17(10): 1290-1297 (2011). [0125] Stemness is characterized by the capacity to self-renew, the multipotency, and the persistence of proliferative potential. In some aspects, stemness is characterized by a particular gene signature, e.g., a combined pattern of expression across a multitude of genes. In some aspects, the stem-like cells can be identified by a transcriptome analysis, e.g., using stemness gene signatures disclosed herein. In some aspects, the gene signature comprises one or more genes selected from ACTN1, DSC1, TSHZ2, MYB, LEF1, TIMD4, MAL, KRT73, SESN3, CDCA7L, LOC283174, TCF7, SLC16A10, LASS6, UBE2E2, IL7R, GCNT4, TAF4B, SULT1B1, SELP, KRT72, STXBP1, TCEA3, FCGBP, CXCR5, GPA33, NELL2, APBA2, SELL, VIPR1, FAM153B, PPFIBP2, FCER1G, GJB6, OCM2, GCET2, LRRN1, IL6ST, LRRC16A, IGSF9B, EFHA2, LOC129293, APP, PKIA, ZC3H12D, CHMP7, KIAA0748, SLC22A17, FLJ13197, NRCAM, C5orf13, GIPC3, WNT7A, FAM117B, BEND5, LGMN, FAM63A, FAM153B, ARHGEF11, RBM11, RIC3, LDLRAP1, PELI1, PTK2, KCTD12, LMO7, CEP68, SDK2, MCOLN3, ZNF238, EDAR, FAM153C, FAAH2, BCL9, C17orf48, MAP1D, ZSWIM1, SORBS3, IL4R, SERPINF1, C16orf45, SPTBN1, KCNQ1, LDHB, BZW2, NBEA, GAL3ST4, CRTC3, MAP3K1, HLA-DOA, RAB43, SGTB, CNN3, CWH43, KLHL3, PIM2, RGMB, C16orf74, AEBP1, SNORD115-11, SNORD115-11, GRAP, and any combination thereof (see, e.g., Gattinoni et al., Nature Medicine 17(10):1290-97 (2011)). In some aspects, the gene signature comprises one or more gene selected from NOG, TIMD4, MYB, UBE2E2, FCER1G, HAVCR1, FCGBP, PPFIBP2, TPST1, ACTN1, IGF1R, KRT72, SLC16A10, GJB6, LRRN1, PRAGMIN, GIPC3, FLNB, ARRB1, SLC7A8, NUCB2, LRRC7, MYO15B, MAL, AEBP1, SDK2, BZW2, GAL3ST4, PITPNM2, ZNF496, FAM117B, C16orf74, TDRD6, TSPAN32, C18orf22, C3orf44, LOC129293, ZC3H12D, MLXIP, C7orf10, STXBP1, KCNQ1, FLJ13197, LDLRAP1, RAB43, RIN3, SLC22A17, AGBL3, TCEA3, NCRNA00185, FAM153B, FAM153C, VIPR1, MMP19, HBS1L, EEF2K, SNORA5C, UBASH3A, FLJ43390, RP6-213H19.1, INPP5A, PIM2, TNFRSF10D, SNRK, LOC100128288, PIGV, LOC100129858, SPTBN1, PROS1, MMP28, HES1, CACHD1, NSUN5C, LEF1, TTTY14, SNORA54, HSF2, C16orf67, NSUN5B, KIAA1257, NRG2, CAD, TARBP1, STRADB, MT1F, TMEM41B, PDHX, KDM6B, LOC100288322, UXS1, LGMN, NANOS2, PYGB, RASGRP2, C14orf80, XPO6, SLC24A6, FAM113A, MRM1, FBXW8, NDUFS2, KCTD12, and any combination thereof (see, e.g., Gattinoni, L., et al., Nat Med 17(10): 1290-1297 (2011)). [0126] As used herein, the term "effector-like" or "effector cell-like" refers to tumor cell killing capacity and cytokine polyfunctionality, e.g., ability of a cell to produce inflammatory cytokines and/or cytotoxic molecules. In some aspects, an effector-like cell is characterized by specific markers expressed by the cell. In some aspects, those effector- like markers comprise one or more of pSTAT5 ⁺ , STAT5 ⁺ , pSTAT3 ⁺ , and STAT3 ⁺ . In some aspects, the effector-like marker comprises a STAT target selected from the group consisting of AKT1, AKT2, AKT3, BCL2L1, CBL, CBLB, CBLC, CCND1, CCND2, CCND3, CISH, CLCF1, CNTF, CNTFR, CREBBP, CRLF2, CSF2, CSF2RA, CSF2RB, CSF3, CSF3R, CSH1, CTF1, EP300, EPO, EPOR, GH1, GH2, GHR, GRB2, IFNA1, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, IFNA2, IFNA21, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNAR1, IFNAR2, IFNB1, IFNE, IFNG, IFNGR1, IFNGR2, IFNK, IFNL1, IFNL2, IFNL3, IFNLR1, IFNW1, IL10, IL10RA, IL10RB, IL11, IL11RA, IL12A, IL12B, IL12RB1, IL12RB2, IL13, IL13RA1, IL13RA2, IL15, IL15RA, IL19, IL2, IL20, IL20RA, IL20RB, IL21, IL21R, IL22, IL22RA1, IL22RA2, IL23A, IL23R, IL24, IL26, IL2RA, IL2RB, IL2RG, IL3, IL3RA, IL4, IL4R, IL5, IL5RA, IL6, IL6R, IL6ST, IL7, IL7R, IL9, IL9R, IRF9, JAK1, JAK2, JAK3, LEP, LEPR, LIF, LIFR, MPL, MYC, OSM, OSMR, PIAS1, PIAS2, PIAS3, PIAS4, PIK3CA, PIK3CB, PIK3CD, PIK3CG, PIK3R1, PIK3R2, PIK3R3, PIK3R5, PIM1, PRL, PRLR, PTPN11, PTPN6, SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS7, SOS1, SOS2, SPRED1, SPRED2, SPRY1, SPRY2, SPRY3, SPRY4, STAM, STAM2, STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6, TPO, TSLP, TYK2, and any combination thereof. In some aspects, the effector- like cells are characterized by a transcriptome analysis. In some aspects, the effector-like marker comprises a marker disclosed in Kaech et al., Cell 111:837-51 (2002); Tripathi et al., J. Immunology 185:2116-24 (2010); and/or Johnnidis et al., Science Immunology 6:eabe3702 (Jan.15, 2021), each of which is incorporated by reference herein in its entirety. [0127] In some aspects, the effector-like cells are characterized using an effector- associated gene set described in Gattinoni, L., et al., Nat Med 17(10):1290-97 (2011). In some aspects, the gene signature for effector-like cells comprises one or more genes selected from MTCH2, RAB6C, KIAA0195, SETD2, C2orf24, NRD1, GNA13, COPA, SELT, TNIP1, CBFA2T2, LRP10, PRKCI, BRE, ANKS1A, PNPLA6, ARL6IP1, WDFY1, MAPK1, GPR153, SHKBP1, MAP1LC3B2, PIP4K2A, HCN3, GTPBP1, TLN1, C4orf34, KIF3B, TCIRG1, PPP3CA, ATG4D, TYMP, TRAF6, C17orf76, WIPF1, FAM108A1, MYL6, NRM, SPCS2, GGT3P, GALK1, CLIP4, ARL4C, YWHAQ, LPCAT4, ATG2A, IDS, TBC1D5, DMPK, ST6GALNAC6, REEP5, ABHD6, KIAA0247, EMB, TSEN54, SPIRE2, PIWIL4, ZSCAN22, ICAM1, CHD9, LPIN2, SETD8, ZC3H12A, ULBP3, IL15RA, HLA-DQB2, LCP1, CHP, RUNX3, TMEM43, REEP4, MEF2D, ABL1, TMEM39A, PCBP4, PLCD1, CHST12, RASGRP1, C1orf58, C11orf63, C6orf129, FHOD1, DKFZp434F142, PIK3CG, ITPR3, BTG3, C4orf50, CNNM3, IFI16, AK1, CDK2AP1, REL, BCL2L1, MVD, TTC39C, PLEKHA2, FKBP11, EML4, FANCA, CDCA4, FUCA2, MFSD10, TBCD, CAPN2, IQGAP1, CHST11, PIK3R1, MYO5A, KIR2DL3, DLG3, MXD4, RALGDS, S1PR5, WSB2, CCR3, TIPARP, SP140, CD151, SOX13, KRTAP5-2, NF1, PEA15, PARP8, RNF166, UEVLD, LIMK1, CACNB1, TMX4, SLC6A6, LBA1, SV2A, LLGL2, IRF1, PPP2R5C, CD99, RAPGEF1, PPP4R1, OSBPL7, FOXP4, SLA2, TBC1D2B, ST7, JAZF1, GGA2, PI4K2A, CD68, LPGAT1, STX11, ZAK, FAM160B1, RORA, C8orf80, APOBEC3F, TGFBI, DNAJC1, GPR114, LRP8, CD69, CMI, NAT13, TGFB1, FLJ00049, ANTXR2, NR4A3, IL12RB1, NTNG2, RDX, MLLT4, GPRIN3,, ADCY9, CD300A, SCD5, ABI3, PTPN22, LGALS1, SYTL3, BMPR1A, TBK1, PMAIP1, RASGEF1A,, GCNT1, GABARAPL1, STOM, CALHM2, ABCA2, PPP1R16B, SYNE2, PAM, C12orf75, CLCF1, MXRA7, APOBEC3C, CLSTN3, ACOT9, HIP1, LAG3, TNFAIP3, DCBLD1, KLF6, CACNB3, RNF19A, RAB27A, FADS3, DLG5, APOBEC3D, TNFRSF1B, ACTN4, TBKBP1, ATXN1, ARAP2, ARHGEF12, FAM53B, MAN1A1, FAM38A, PLXNC1, GRLF1, SRGN, HLA-DRB5, B4GALT5, WIPI1, PTPRJ, SLFN11, DUSP2, ANXA5, AHNAK, NEO1, CLIC1, EIF2C4, MAP3K5, IL2RB, PLEKHG1, MYO6, GTDC1, EDARADD, GALM, TARP, ADAM8, MSC, HNRPLL, SYT11, ATP2B4, NHSL2, MATK, ARHGAP18, SLFN12L, SPATS2L, RAB27B, PIK3R3, TP53INP1, MBOAT1, GYG1, KATNAL1, FAM46C, ZC3HAV1L, ANXA2P2, CTNNA1, NPC1, C3AR1, CRIM1, SH2D2A, ERN1, YPEL1, TBX21, SLC1A4, FASLG, PHACTR2, GALNT3, ADRB2, PIK3AP1, TLR3, PLEKHA5, DUSP10, GNAO1, PTGDR, FRMD4B, ANXA2, EOMES, CADM1, MAF, TPRG1, NBEAL2, PPP2R2B, PELO, SLC4A4, KLRF1, FOSL2, RGS2, TGFBR3, PRF1, MYO1F, GAB3, C17orf66, MICAL2, CYTH3, TOX, HLA-DRA, SYNE1, WEE1, PYHIN1, F2R, PLD1, THBS1, CD58, FAS, NETO2, CXCR6, ST6GALNAC2, DUSP4, AUTS2, C1orf21, KLRG1, TNIP3, GZMA, PRR5L, PRDM1, ST8SIA6, PLXND1, PTPRM, GFPT2, MYBL1, SLAMF7, FLJ16686,, GNLY, ZEB2, CST7, IL18RAP, CCL5, KLRD1, KLRB1, and any combination thereof (see, e.g., Gattinoni, L., et al., Nat Med 17(10):1290-97 (2011). [0128] In the presence of prolonged antigen exposure, such as in many cancers, more differentiated immune cells, e.g., effector and effector memory T cells, often become exhausted and lose their anti-tumor function. Biomarkers, e.g., T cell markers, can be measured using any methods. In some aspects, T cells are identified using antibody-staining following by gated flow cytometry. [0129] As used herein, the term "basal" media refers to any starting media that is supplemented with one or more of the additional elements disclosed herein, e.g., potassium, sodium, calcium, glucose, IL-2, IL-7, IL-15, IL-21, programmable cell-signaling scaffold (PCS), or any combination thereof. The basal media can be any media for culturing immune cells, e.g., T cells and/or NK cells. In some aspects, the basal media comprises a balanced salt solution (e.g., PBS, DPBS, HBSS, EBSS), Dulbecco's Modified Eagle's Medium (DMEM), Click’s medium, Minimal Essential Medium (MEM), Basal Medium Eagle (BME), F-10, F-12, RPMI 1640, Glasgow Minimal Essential Medium (GMEM), alpha Minimal Essential Medium (alpha MEM), Iscove's Modified Dulbecco's Medium (IMDM), M199, OPTMIZER ^TM Pro, OPTMIZER™ CTS™ T-Cell Expansion Basal Medium (ThermoFisher), OPTMIZER ^TM , OPTMIZER™ Complete, IMMUNOCULT™ XF (STEMCELL™ Technologies), AIM V™, TEXMACS™ medium, PRIME-XV ^® T cell CDM, X-VIVO ^TM 15 (Lonza), TRANSACT™ TIL expansion medium, or any combination thereof. In some aspects, the basal medium is serum free. In some aspects, the basal media comprises PRIME-XV ^® T cell CDM. In some aspects, the basal media comprises OPTMIZER ^TM . In some aspects, the basal media comprises OPTMIZER ^TM Pro. In some aspects, the basal medium further comprises immune cell serum replacement (ICSR). For example, in some aspects, the basal medium comprises OPTMIZER™ Complete supplemented with ICSR, AIM V™ supplemented with ICSR, IMMUNOCULT™ XF supplemented with ICSR, RPMI supplemented with ICSR, TEXMACS™ supplemented with ICSR, or any combination thereof. In some aspects, suitable basal media include Click's medium, OPTMIZER™ (CTS™) medium, STEMLINE ^® T cell expansion medium (Sigma-Aldrich), AIM V™ medium (CTS™), TEXMACS™ medium (Miltenyi Biotech), IMMUNOCULT™ medium (Stem Cell Technologies), PRIME-XV® T-Cell Expansion XSFM (Irvine Scientific), Iscoves medium, and/or RPMI-1640 medium. In some aspects, the basal media comprises NaCl free CTS™ OPTMIZER™. In some aspects, the basal media comprises one or more sodium salt in addition to the NaCl. [0130] As used herein, the term "cytokine" refers to small, secreted proteins released by cells that have a specific effect on the interactions and communications between cells. Non- limiting examples of cytokines include interleukins (e.g., interleukin (IL)-1, IL-2, IL-4, IL- 7, IL-9, IL-13, IL-15, IL-3, IL-5, IL-6, IL-11, IL-10, IL-20, IL-14, IL-16, IL-17, IL-21 and IL-23), interferons (IFN; e.g., IFN-α, IFN-β, and IFN-γ), tumor necrosis factor (TNF) family members, and transforming growth factor (TGF) family members. Some aspects of the present disclosure are directed to methods of culturing and/or expanding immune cells, e.g., T cells and/or NK cells or one or more engineered immune cell disclosed herein, in a medium comprising a cytokine. In some aspects, the cytokine is an interleukin. In some aspects, the cytokine comprises IL-2, IL-7, IL-15, IL-21 or any combination thereof. IL-2 (UniProtKB – P60568) is produced by T cells in response to antigenic or mitogenic stimulation. IL-2 is known to stimulate T cell proliferation and other activities crucial to regulation of the immune response. IL-7 (UniProtKB - P13232) is a hematopoietic growth factor capable of stimulating the proliferation of lymphoid progenitors. IL-7 is believed to play a role in proliferation during certain stages of B-cell maturation. IL-15 (UniProtKB - P40933), like IL-2, is a cytokine that stimulates the proliferation of T-lymphocytes. IL-21 (UniProtKB - Q9HBE4) is a cytokine with immunoregulatory activity. IL-21 is thought to promote the transition between innate and adaptive immunity and to induce the production of IgG1 and IgG3 in B-cells. IL-21 can also play a role in proliferation and maturation of natural killer (NK) cells in synergy with IL-15, and IL-21 can regulate proliferation of mature B- and T-cells in response to activating stimuli. In synergy with IL-15 and IL-18, IL-15 also stimulates interferon gamma production in T-cells and NK cells, and IL-21 can also inhibit dendritic cell activation and maturation during a T-cell-mediated immune response. [0131] As used herein, the term “endogenous expression” or “endogenous expression levels” or “endogenous levels” (or grammatical variants thereof) refers to gene and/or protein expression (e.g., amount, kinetics, etc.) that is naturally occurring (e.g., the gene and/or protein is not directly manipulated by non-naturally-occurring engineering). For example, in some aspects, a modified cell disclosed herein does not express endogenous levels of a NR4A3 gene and/or protein (e.g., expresses no NR4A3 or expresses reduced level of NR4A3 as compared to corresponding non-modified cell), but because the two NR4A1 and NR4A2 genes have not been knocked down (e.g., by CRISPR, e.g., a non- naturally occurring engineering) the modified cells exhibit endogenous expression of NR4A1 and NR4A2 gene and/or NR4A1 and NR4A2 protein. Similarly, in some aspects, a modified cell disclosed herein has been edited such that the modified cell does not express endogenous level of NR4A2 (e.g., expresses no NR4A2 or expresses reduced level of NR4A2 as compared to corresponding non-modified cell), but because the NR4A1 and NR4A3 have not been knocked down, the modified cell exhibits endogenous expression of the NR4A1 and NR4A2 (gene and/or protein). In some aspects, a modified cell disclosed herein has been edited such that modified cell does not express endogenous level of NR4A1 (e.g., expresses no NR4A1 or expresses reduced level of NR4A1 as compared to corresponding non-modified cell), but because the NR4A2 and NR4A3 have not been knocked down, the modified cell exhibits endogenous expression of the NR4A2 and NR4A3 (gene and/or protein). In some aspects, a modified cell disclosed herein has been edited such that the modified cell does not express endogenous level of NR4A1 and NR4A2 (e.g., expresses no NR4A1 and NR4A2 or expresses reduced level of NR4A1 and NR4A2 as compared to corresponding non-modified cell), but because the NR4A3 has not been knocked down, the modified cell exhibits endogenous expression of the NR4A3 (gene and/or protein). In some aspects, a modified cell disclosed herein has been edited such that the modified cell does not express endogenous level of NR4A1 and NR4A3 (e.g., expresses no NR4A1 and NR4A3 or expresses reduced level of NR4A1 and NR4A3 as compared to corresponding non-modified cell), but because the NR4A2 has not been knocked down, the modified cell exhibits endogenous expression of the NR4A2 (gene and/or protein). In some aspects, a modified cell disclosed herein has been edited such that the modified cell does not express endogenous level of NR4A1 and NR4A2 (e.g., expresses no NR4A1 and NR4A2 or expresses reduced level of NR4A1 and NR4A2 as compared to corresponding non-modified cell), but because the NR4A3 has not been knocked down, the modified cell exhibits endogenous expression of the NR4A3 (gene and/or protein). In some aspects, a modified cell disclosed herein has been edited such that the modified cell does not express endogenous level of NR4A2 and NR4A3 (e.g., expresses no NR4A2 and NR4A3 or expresses reduced level of NR4A2 and NR4A3 as compared to corresponding non- modified cell), but because the NR4A1 has not been knocked down, the modified cell exhibits endogenous expression of the NR4A1 (gene and/or protein). [0132] As used herein the term "reduced levels," "lower levels," "reduced expression levels," or "lower levels" (or variants thereof) refers both to reduction in physical levels (e.g., less gene sequence due to edition from the genome, or less protein due a decrease in protein expression) and to reduction in function. For example, a reduction in level of NR4A3 gene can refer to a decrease in gene function, e.g., due to the introduction of a mutation introducing a stop codon or a frame shift, to an epigenetic modification that would alter transcription, or to a mutation or other change on a promoter gene or another gene that regulates NR4A3 expression. In some aspects, a reduction in level of NR4A3 gene in a modified cell refers to a decrease in the amount (e.g., concentration) of genomic DNA, pre- mRNA, and/or mRNA that is capable of encoding a functional NR4A3 protein, e.g., wild type NR4A3 protein, compared to a reference cell. Similarly, a reduction in NR4A3 protein can refer to changes resulting in the expression of a functional NR4A3 protein, e.g., wild type NR4A3 protein, including but not limited to changes (e.g., mutations or post- translational modifications) that cause a loss of function (partial or complete), or to the activity of molecules that bind to functional sites of NR4A3 altering, e.g., its interaction with other cell signaling partners. [0133] As used herein, "administering" refers to the physical introduction of a therapeutic agent or a composition comprising a therapeutic agent to a subject, using any of the various methods and delivery systems. The different routes of administration for a therapeutic agent are described herein (e.g., an immune cell or a population of immune cells modified to express a reduced level of one or more members of the NR4A family, and cultured as described herein). Exemplary routes of administration include intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, intrasterna, oral, rectal, topical, epidermal, mucosal, intranasal, vaginal, rectal, sublingual administration, and combinations thereof. Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods. [0134] The phrase "parenteral administration" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intraperitoneal, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intratumoral, intracapsular, intraorbital, intracardiac, intradermal, transtracheal, intratracheal, pulmonary, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraventricular, intravitreal, epidural, and intrasternal injection and infusion, as well as in vivo electroporation. [0135] Alternatively, a therapeutic agent described herein (e.g., an immune cell edited to express a reduced level of one or more members of the NR4A family, and cultured as described herein) can be administered via a non-parenteral route, such as a topical, epidermal, or mucosal route of administration, for example, intranasally, orally, vaginally, rectally, sublingually, or topically. Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods. [0136] As used herein, "cell engineering" or "cell modification" (including derivatives thereof) refers to the targeted modification of a cell, e.g., an immune cell disclosed herein. In some aspects, the cell engineering comprises viral genetic engineering, non-viral genetic engineering, introduction of receptors to allow for tumor specific targeting (e.g., a chimeric binding protein) introduction of one or more endogenous genes that improve T cell function, introduction of one or more synthetic genes that improve immune cell, e.g., T cell, function, or any combination thereof. As further described elsewhere in the present disclosure, in some aspects, a cell can be engineered or modified with a transcription activator (e.g., CRISPR/Cas system-based transcription activator), wherein the transcription activator is capable of inducing and/or increasing the endogenous expression of a protein of interest. In some aspects, a cell (e.g., T cells and/or NK cells) can be engineered or modified with a gene editing tool (e.g., gRNAs provided herein) to reduce the expression of one or more of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3). [0137] As used herein, the term "antigen" refers to any natural or synthetic immunogenic substance, such as a protein, peptide, or hapten. As used herein, the term "cognate antigen" refers to an antigen which an immune cell (e.g., T cell) recognizes and thereby, induces the activation of the immune cell (e.g., triggering intracellular signals that induce effector functions, such as cytokine production, and/or for proliferation of the cell). In some aspects, the antigen comprises a tumor antigen. In some aspects, the antigen comprises a neoantigen. [0138] A "cancer" refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and can also metastasize to distant parts of the body through the lymphatic system or bloodstream. "Cancer" as used herein comprises primary, metastatic and recurrent cancers. Unless indicated otherwise, the terms "cancer" and "tumor" can be used interchangeably. [0139] The term "hematological malignancy" or "hematological cancer" refers to mammalian cancers and tumors of the hematopoietic and lymphoid tissues. Non-limiting examples of hematological malignancies include those affecting tissues of the blood, bone marrow, lymph nodes, and lymphatic system, including acute lymphoblastic leukemia (ALL), chronic lymphocytic lymphoma (CLL), small lymphocytic lymphoma (SLL), acute myelogenous leukemia (AML), chronic myelogenous leukemia (CIVIL), acute monocytic leukemia (AMoL), Hodgkin's lymphoma, and non-Hodgkin's lymphomas. Hematological malignancies are also referred to as "liquid tumors." Liquid tumor cancers include, but are not limited to, leukemias, myelomas, and lymphomas, as well as other hematological malignancies. [0140] A "solid tumor," as used herein, refers to an abnormal mass of tissue. Solid tumors can be benign or malignant. Non-limiting examples of solid tumors include sarcomas, carcinomas, and lymphomas, such as cancers of the lung, breast, prostate, colon, rectum, and bladder. The tissue structure of a solid tumor includes interdependent tissue compartments including the parenchyma (cancer cells) and the supporting stromal cells in which the cancer cells are dispersed, and which can provide a supporting microenvironment. [0141] In some aspects, the cancer is selected from adrenal cortical cancer, advanced cancer, anal cancer, aplastic anemia, bile duct cancer, bladder cancer, bone cancer, bone metastasis, brain tumors, brain cancer, breast cancer, childhood cancer, cancer of unknown primary origin, Castleman disease, cervical cancer, colon/rectal cancer, endometrial cancer, esophagus cancer, Ewing family of tumors, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gestational trophoblastic disease, Hodgkin disease, Kaposi sarcoma, renal cell carcinoma, laryngeal and hypopharyngeal cancer, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myelomonocytic leukemia, liver cancer, non- small cell lung cancer, small cell lung cancer, lung carcinoid tumor, lymphoma of the skin, malignant mesothelioma, multiple myeloma, myelodysplastic syndrome, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary tumors, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma in adult soft tissue, basal and squamous cell skin cancer, melanoma, small intestine cancer, stomach cancer, testicular cancer, throat cancer, thymus cancer, thyroid cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macroglobulinemia, Wilms tumor and secondary cancers caused by cancer treatment. In some aspects, the cancer is selected from chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, myxoid/round cell liposarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, choriocarcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, immunoblastic sarcoma of B cells, lymphoma, immunoblastic sarcoma of T-cells, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukosarcoma, malignant mesenchymoma sarcoma, parosteal sarcoma, reticulocytic sarcoma, Rous sarcoma, serocystic sarcoma, synovial sarcoma, or telangiectaltic sarcoma. In some aspects, the cancer is selected from acra- lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, metastatic melanoma, nodular melanoma, subungal melanoma, or superficial spreading melanoma. In some aspects, the cancer is selected from acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatiniform carcinoma, gelatinous carcinoma, giant cell carcinoma, carcinoma gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair-matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma, Hurthle cell carcinoma, hyaline carcinoma, hypemephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky-cell carcinoma, large-cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, carcinoma medullare, medullary carcinoma, melanotic carcinoma, carcinoma molle, mucinous carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidernoid carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, naspharyngeal carcinoma, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prickle cell carcinoma, pultaceous carcinoma, renal cell carcinoma of kidney, reserve cell carcinoma, carcinoma sarcomatodes, schneiderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet-ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tuberous carcinoma, verrucous carcinoma, or carcinoma viflosum. In some aspects, the cancer is selected from Leukemia, Hodgkin's Disease, Non- Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, breast cancer, ovarian cancer, lung cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, small-cell lung tumors, primary brain tumors, stomach cancer, colon cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, papillary thyroid cancer, neuroblastoma, neuroendocrine cancer, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, cervical cancer, endometrial cancer, adrenal cortical cancer, prostate cancer, Müllerian cancer, ovarian cancer, peritoneal cancer, fallopian tube cancer, or uterine papillary serous carcinoma. In some aspects, the cancer is selected from metastatic melanoma, non-small cell lung cancer, myeloma, esophageal cancer, synovial sarcoma, gastric cancer, breast cancer, hepatocellular cancer, head and neck cancer, ovarian cancer, prostate cancer, bladder cancer, or any combination thereof. [0142] As used herein, the term "immune response" refers to a biological response within a vertebrate against foreign agents, which response protects the organism against these agents and diseases caused by them. An immune response is mediated by the action of a cell of the immune system (e.g., a T lymphocyte, B lymphocyte, natural killer (NK) cell, NKT cell, macrophage, eosinophil, mast cell, dendritic cell or neutrophil) and soluble macromolecules produced by any of these cells or the liver (including antibodies, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and/or elimination from the vertebrate's body of invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues. An immune reaction includes, e.g., activation or inhibition of a T cell, e.g., an effector T cell or a Th cell, such as a CD4 ⁺ or CD8 ⁺ T cell, or the inhibition of a Treg cell. As used herein, the terms "T cell" and "T lymphocytes" are interchangeable and refer to any lymphocytes produced or processed by the thymus gland. In some aspects, a T cell is a CD4 ⁺ T cell. In some aspects, a T cell is a CD8 ⁺ T cell. In some aspects, a T cell is a NKT cell. [0143] As used herein, the term "anti-tumor immune response" refers to an immune response against a tumor antigen. [0144] A "subject" includes any human or nonhuman animal. The term "nonhuman animal" includes, but is not limited to, vertebrates such as nonhuman primates, sheep, dogs, and rodents such as mice, rats and guinea pigs. In some aspects, the subject is a human. The terms "subject," "patient," "individual," and "host" are used interchangeably herein. As used herein, the phrase "subject in need thereof" includes subjects, such as mammalian subjects, that would benefit, e.g., from administration of immune cells, e.g., edited to exhibit reduced expression of one or more members of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3) , and cultured using the methods provided herein, as described herein to control tumor growth. [0145] The term "therapeutically effective amount" or "therapeutically effective dosage" refers to an amount of an agent (e.g., an immune cell edited to exhibit reduced expression of a NR4A family member and cultured as described herein) that provides the desired biological, therapeutic, and/or prophylactic result. That result can be reduction, amelioration, palliation, lessening, delaying, and/or alleviation of one or more of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. In reference to solid tumors, an effective amount comprises an amount sufficient to cause a tumor to shrink and/or to decrease the growth rate of the tumor (such as to suppress tumor growth) or to prevent or delay other unwanted cell proliferation. In some aspects, an effective amount is an amount sufficient to delay tumor development. In some aspects, an effective amount is an amount sufficient to prevent or delay tumor recurrence. An effective amount can be administered in one or more administrations. [0146] The effective amount of the composition (e.g., immune cells as described herein, e.g., edited to exhibit reduced expression of a NR4A family member and cultured as described herein) can, for example, (i) reduce the number of cancer cells; (ii) reduce tumor size; (iii) inhibit, delay, slow to some extent and can stop cancer cell infiltration into peripheral organs; (iv) inhibit (i.e., slow to some extent and can stop tumor metastasis); (v) inhibit tumor growth; (vi) prevent or delay occurrence and/or recurrence of tumor; and/or (vii) relieve to some extent one or more of the symptoms associated with the cancer. [0147] In some aspects, a "therapeutically effective amount" is the amount of a composition disclosed herein (e.g., an immune cell edited to exhibit reduced expression of a NR4A family member, and cultured as described herein), which is clinically proven to effect a significant decrease in cancer or slowing of progression (regression) of cancer, such as an advanced solid tumor. The ability of a therapeutic agent of the present disclosure (e.g., an immune cell modified and cultured as described herein) to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays. [0148] The terms "effective" and "effectiveness" with regard to a treatment include both pharmacological effectiveness and physiological safety. Pharmacological effectiveness refers to the ability of a composition disclosed herein (e.g., immune cells modified and cultured as described herein) to promote cancer regression in the patient. Physiological safety refers to the level of toxicity, or other adverse physiological effects at the cellular, organ, and/or organism level (adverse effects) resulting from administration of a composition disclosed herein (e.g., immune cells modified and cultured as described herein). [0149] The terms "chimeric antigen receptor" and "CAR," as used herein, refer to a set of polypeptides, typically two in the simplest form, which when in an immune effector cell, provides the cell with specificity for a target cell, typically a cancer cell, and with intracellular signal generation. In some aspects, a CAR comprises at least an extracellular antigen-binding domain, a transmembrane domain and a cytoplasmic signaling domain (also referred to herein as "an intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule and/or costimulatory molecule as defined below. In some aspects, the set of polypeptides are in the same polypeptide chain, e.g., comprise a chimeric fusion protein. In some aspects, the set of polypeptides are not contiguous with each other, e.g., are in different polypeptide chains. In some aspects, the set of polypeptides include a dimerization switch that, upon the presence of a dimerization molecule, can couple the polypeptides to one another, e.g., can couple an antigen-binding domain to an intracellular signaling domain. In some aspects, the stimulatory molecule of the CAR is the zeta chain associated with the T cell receptor complex (e.g., CD3 zeta). In some aspects, the cytoplasmic signaling domain comprises a primary signaling domain (e.g., a primary signaling domain of CD3-zeta). In some aspects, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule as defined below. In some aspects, the costimulatory molecule is chosen from the costimulatory molecules described herein, e.g., 4-1BB (i.e., CD137), CD27, and/or CD28. [0150] In some aspects, the CAR comprises a chimeric fusion protein comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule, wherein the antigen-binding domain and the transmembrane domain are linked by a CAR spacer. In some aspects, the CAR comprises a chimeric fusion protein comprising an antigen-binding domain linked to a transmembrane domain via a CAR spacer and an intracellular signaling domain comprising a functional signaling domain derived from a costimulatory molecule and a functional signaling domain derived from a stimulatory molecule. In some aspects, the CAR comprises a chimeric fusion protein comprising an antigen-binding domain linked to a transmembrane domain via a CAR spacer and an intracellular signaling domain comprising two functional signaling domains derived from one or more costimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. In some aspects, the CAR comprises a chimeric fusion protein comprising an antigen-binding domain linked to a transmembrane domain via a CAR spacer and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more costimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. In some aspects, the CAR comprises an optional leader sequence at the amino- terminus (N-terminus) of the CAR. In some aspects, the CAR further comprises a leader sequence at the N-terminus of the antigen-binding domain, wherein the leader sequence is optionally cleaved from the antigen-binding domain (e.g., a scFv) during cellular processing and localization of the CAR to the cellular membrane. [0151] The antigen-specific extracellular domain of a chimeric antigen receptor recognizes and specifically binds an antigen, typically a surface-expressed antigen of a malignancy. An antigen-specific extracellular domain specifically binds an antigen when, for example, it binds the antigen with an affinity constant or affinity of interaction (K _D ) between about 0.1 pM to about 10 µM, for example, about 0.1 pM to about 1 µM or about 0.1 pM to about 100 nM. Methods for determining the affinity of interaction are known in the art. An antigen-specific extracellular domain suitable for use in a CAR of the present disclosure can be any antigen-binding polypeptide, a wide variety of which are known in the art. In some aspects, the antigen-binding domain is a single chain Fv (scFv). Other antibody-based recognition domains such as cAb VHH (camelid antibody variable domains) and humanized versions thereof, lgNAR VH (shark antibody variable domains) and humanized versions thereof, sdAb VH (single domain antibody variable domains), and "camelized" antibody variable domains are also suitable for use in a CAR of the present disclosure. In some aspects, T cell receptor (TCR) based recognition domains, such as single chain TCR (scTv, i.e., single chain two-domain TCR containing VαVβ) are also suitable for use in the chimeric binding proteins of the present disclosure. [0152] As used herein, the term "T cell receptor" or "TCR" refers to a heterodimer composed of 2 different transmembrane polypeptide chains: an α chain and a β chain, each consisting of a constant region, which anchors the chain inside the T-cell surface membrane, and a variable region, which recognizes and binds to the antigen presented by MHCs. The TCR complex is associated with 6 polypeptides forming 2 heterodimers, CD3γε and CD3δε, and 1 homodimer CD3 which together forms the CD3 complex. T- cell receptor-engineered T-cell therapy utilizes the modification of T cells that retain these complexes to specifically target the antigens expressed by particular tumor cells. As used herein, the term "TCR" includes naturally occurring TCRs and engineered TCRs. [0153] As used herein, an "engineered TCR" or "engineered T-cell receptor" refers to a T- cell receptor (TCR) engineered to specifically bind with a desired affinity to a major histocompatibility complex (MHC)/peptide target antigen that is selected, cloned, and/or subsequently introduced into a population of immune cells, e.g., T cells and/or NK cells. [0154] A "TCR mimic" or a "TCRm" refers to a type of engineered chimeric TCR comprising an antigen binding domain (e.g., derived from an antibody) that recognize epitopes comprising both the peptide and the MHC-I molecule, similar to the recognition of such complexes by the TCR on T cells. The TCR mimic further comprises a T cell receptor module (TCRM) capable of recruiting at least one TCR-associated signaling molecule. Exemplary TCR mimics are described for example in U.S. Patent No. 10,822,413, which is incorporated herein by reference in its entirety. [0155] The terms "nucleic acids," "nucleic acid molecules, "nucleotides," "nucleotide(s) sequence," and "polynucleotide" can be used interchangeably and refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Single stranded nucleic acid sequences refer to single-stranded DNA (ssDNA) or single- stranded RNA (ssRNA). Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences can be described herein according to the normal convention of giving only the sequence in the 5’ to 3’ direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi- synthetic DNA. A "nucleic acid composition" of the disclosure comprises one or more nucleic acids as described herein. As described herein, in some aspects, a polynucleotide of the present disclosure can comprise a single nucleotide sequence encoding a single protein ("monocistronic"). In some aspects, a polynucleotide of the present disclosure is polycistronic (i.e., comprises two or more cistrons). In some aspects, each of the cistrons of a polycistronic polynucleotide can encode for a protein disclosed herein. In some aspects, each of the cistrons can be translated independently of one another. [0156] As used herein, the term “polypeptide” encompasses both peptides and proteins, unless indicated otherwise. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a single polypeptide or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some aspects, a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. [0157] As used herein, the term "fragment" of a polypeptide refers to an amino acid sequence of a polypeptide that is shorter than the naturally-occurring sequence, N- and/or C-terminally deleted or any part of the polypeptide deleted in comparison to the naturally occurring polypeptide. Thus, a fragment does not necessarily need to have only N- and/or C- terminal amino acids deleted. A polypeptide in which internal amino acids have been deleted with respect to the naturally occurring sequence is also considered a fragment. [0158] As used herein, the term "functional fragment" refers to a polypeptide fragment that retains polypeptide function. Accordingly, in some aspects, a functional fragment of an Ig hinge, retains the ability to position an antigen-binding domain (e.g., an scFv) in a chimeric binding protein at a distance from a target epitope (e.g., a tumor antigen) such that the antigen-binding domain (e.g., an scFv) can effectively interact with the target epitope (e.g., a tumor antigen). Non-limiting examples of such activity are further described elsewhere in the present disclosure. [0159] A "recombinant" polypeptide or protein refers to a polypeptide or protein produced via recombinant DNA technology. Recombinantly produced polypeptides and proteins expressed in engineered host cells are considered isolated for the purpose of the disclosure, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique. The polypeptides encoded by the polynucleotides disclosed herein can be recombinantly produced using methods known in the art. In some aspects, the polypeptides encoded by the polynucleotides of the present disclosure are produced by cells, e.g., T cells, following transfection with at least one polynucleotide or vector encoding the polypeptides described here. [0160] As used herein, a "coding region," "coding sequence," or "translatable sequence" is a portion of polynucleotide which consists of codons translatable into amino acids. Although a "stop codon" (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region. The boundaries of a coding region are typically determined by a start codon at the 5' terminus, encoding the amino terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl terminus of the resulting polypeptide. [0161] The terms "complementary" and "complementarity" refer to two or more oligomers (i.e., each comprising a nucleobase sequence), or between an oligomer and a target gene, that are related with one another by Watson-Crick base-pairing rules. For example, the nucleobase sequence "T-G-A (5' to 3')," is complementary to the nucleobase sequence "A- C-T (3' to 5')." Complementarity can be "partial," in which less than all of the nucleobases of a given nucleobase sequence are matched to the other nucleobase sequence according to base pairing rules. For example, in some aspects, complementarity between a given nucleobase sequence and the other nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Accordingly, in some aspects, the term "complementary" refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a target nucleic acid sequence (e.g., NR4A1, NR4A2, and/or NR4A2). Or, there can be "complete" or "perfect" (100%) complementarity between a given nucleobase sequence and the other nucleobase sequence to continue the example. In some aspects, the degree of complementarity between nucleobase sequences has significant effects on the efficiency and strength of hybridization between the sequences. [0162] The term "expression" as used herein refers to a process by which a polynucleotide produces a gene product, for example, a ligand-binding protein. It includes, without limitation, transcription of the polynucleotide into messenger RNA (mRNA) and the translation of an mRNA into a polypeptide. Expression produces a "gene product." As used herein, a gene product can be either a nucleic acid, e.g., a messenger RNA produced by transcription of a gene, or a polypeptide which is translated from a transcript. Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation or splicing, or polypeptides with post translational modifications, e.g., methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage. [0163] As used herein, the term "identity" refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules. The term "identical" without any additional qualifiers, e.g., polynucleotide A is identical to polynucleotide B, implies the polynucleotide sequences are 100% identical (100% sequence identity). Describing two sequences as, e.g., "70% identical," is equivalent to describing them as having, e.g., "70% sequence identity." A "reference nucleotide sequence," when used herein as a comparison to a nucleotide sequence of the disclosure, refers to a polynucleotide sequence essentially identical to the nucleotide sequence of the disclosure except that sequence is not optimized. For example, in some aspects, the reference nucleotide sequence comprises the wild-type JUN nucleic acid sequence set forth in SEQ ID NO: 11. [0164] Calculation of the percent identity of two polypeptide or polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second polypeptide or polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In some aspects, the length of a sequence aligned for comparison purposes is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the length of the reference sequence. The amino acids at corresponding amino acid positions, or bases in the case of polynucleotides, are then compared. [0165] When a position in the first sequence is occupied by the same amino acid or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. [0166] Suitable software programs that can be used to align different sequences (e.g., polynucleotide sequences) are available from various sources. One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of programs available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov). Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, e.g., Needle, Stretcher, Water, or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at worldwideweb.ebi.ac.uk/Tools/psa. [0167] Sequence alignments can be conducted using methods known in the art such as MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc. [0168] Different regions within a single polynucleotide or polypeptide target sequence that aligns with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer. [0169] In some aspects, the percentage identity (%ID) or of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID = 100 x (Y/Z), where Y is the number of amino acid residues (or nucleobases) scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence. [0170] One skilled in the art will appreciate that the generation of a sequence alignment for the calculation of a percent sequence identity is not limited to binary sequence-sequence comparisons exclusively driven by primary sequence data. It will also be appreciated that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data. A suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at worldwidewebtcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually. [0171] As used herein, the terms "isolated," "purified," "extracted," and grammatical variants thereof are used interchangeably and refer to the state of a preparation of desired composition of the present disclosure that has undergone one or more processes of purification. In some aspects, isolating or purifying as used herein is the process of removing, including partially removing (e.g., a fraction), a composition of the present disclosure (e.g., a modified immune cell expressing a reduced level of a NR4A1, NR4A2, and/or NR4A3) from a sample containing contaminants. [0172] In some aspects, an isolated composition has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount. In some aspects, an isolated composition has an amount and/or concentration of desired composition of the present disclosure, at or above an acceptable amount and/or concentration and/or activity. In some aspects, the isolated composition is enriched as compared to the starting material from which the composition is obtained. This enrichment can be by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% as compared to the starting material. [0173] In some aspects, isolated preparations are substantially free of residual biological products. In some aspects, the isolated preparations are 100% free, at least about 99% free, at least about 98% free, at least about 97% free, at least about 96% free, at least about 95% free, at least about 94% free, at least about 93% free, at least about 92% free, at least about 91% free, or at least about 90% free of any contaminating biological matter. Residual biological products can include abiotic materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolites. [0174] The term "linked" as used herein refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively. The first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence. The term "linked" means not only a fusion of a first polynucleotide sequence to a second polynucleotide sequence at the 5'-end or the 3'-end, but also includes insertion of the whole first polynucleotide sequence (or the second polynucleotide sequence) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence, respectively). The first polynucleotide sequence can be linked to a second polynucleotide sequence by a phosphodiester bond or a linker. The linker can be, e.g., a polynucleotide. [0175] "Treatment" or "therapy" (including any grammatical derivatives thereof) of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, a subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down, or preventing the onset, progression, development, severity, or recurrence of a symptom, complication, condition, or biochemical indicia associated with a disease. In some aspects, the terms refers to inducing an immune response in a subject against an antigen. [0176] The terms "prevent," "preventing," and variants thereof as used herein, refer partially or completely delaying onset of an disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and/or condition; partially or completely delaying progression from a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some aspects, preventing an outcome is achieved through prophylactic treatment. [0177] As used herein the term "therapeutically effective amount" is the amount of reagent or pharmaceutical compound comprising a composition disclosed herein (e.g., modified immune cell described herein) that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof. [0178] A therapeutically effective amount can be a "prophylactically effective amount" as prophylaxis can be considered therapy. As used herein, "prophylactic" refers to a therapeutic or course of action used to prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition. As used herein, a "prophylaxis" refers to a measure taken to maintain health and prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition. [0179] As used herein, the term "promoter" refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3' to a promoter sequence. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters." Promoters that cause a gene to be expressed in a specific cell type are commonly referred to as "cell-specific promoters" or "tissue-specific promoters." Promoters that cause a gene to be expressed at a specific stage of development or cell differentiation are commonly referred to as "developmentally-specific promoters" or "cell differentiation-specific promoters." Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as "inducible promoters" or "regulatable promoters." It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity. [0180] As used herein, the terms "ug" and "uM" are used interchangeably with "μg" and "μΜ," respectively. [0181] Various aspects of the disclosure are described in further detail in the following subsections. Methods of Modifying and Culturing [0182] Some aspects of the present disclosure provide a method of preparing a population of immune cells (e.g., human immune cells) for immunotherapy comprising: (a) contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. Some aspects of the present disclosure provide a method of increasing the yield of immune cells during ex vivo or in vitro culture comprising: (a) contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. Some aspects of the present disclosure is related to a method of increasing the stemness of immune cells during ex vivo or in vitro culture comprising: (a) contacting immune cells with a programmable cell- signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. Some aspects of the present disclosure provide a method of increasing both stemness and yield of immune cells during ex vivo or in vitro culture comprising: (a) contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. Some aspects of the present disclosure provide a method of expanding a population of stem-like immune cells ex vivo or in vitro comprising: (a) contacting immune cells with programmable cell-signaling scaffolds (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been edited. [0183] In some aspects, the contacting of the immune cells with PCS and the editing the immune cells to exhibit a reduced expression level of the NR4A family can occur non- concurrently. In some aspects, the editing occurs after the contacting. For example, in some aspects, the editing occurs at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about seven days, at least about eight days, at least about nine days, or at least about 10 days after the contacting. In some aspects, the editing occurs about two days after the contacting of the immune cells with the PCS. In some aspects, the contacting can occur after the editing. In some aspects, the contacting occurs at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about seven days, at least about eight days, at least about nine days, or at least about 10 days after the editing. In some aspects, the contacting occurs about one day after the editing. In some aspects, the contacting can occur both before the editing and after the editing. As is apparent from the present disclosure, in some aspects, the editing and the contacting occur concurrently. [0184] As is apparent from the present disclosure, in some aspects, immune cells (e.g., T cells and/or NK cells) are: (i) activated (i.e., contacted) with PCS in MRM, (ii) transduced with a ligand-binding construct (such that the immune cells express the encoded ligand- binding protein), and (iii) edited to exhibit reduced expression of a NR4A family member. In some aspects, immune cells (e.g., T cells and/or NK cells) are: (i) contacted with PCS in MRM, (ii) transduced to exhibit an increased expression of a c-Jun polypeptide, and (iii) edited to exhibit reduced expression of a NR4A family member. In some aspects, immune cells (e.g., T cells and/or NK cells) are: (i) contacted with PCS in MRM, (ii) transduced to both express a ligand-binding protein and exhibit an increased expression of a c-Jun polypeptide, and (iii) edited to exhibit reduced expression of a NR4A family member. As further described herein, for such aspects, the contacting, editing, and transducing can occur concurrently (e.g., within a single day). In some aspects, the contacting, editing, and/or transducing occur sequentially (e.g., over a course of two or more days). [0185] In some aspects, the activating (i.e., contacting) with PCS, transducing to express a ligand-binding protein, and editing to exhibit reduced NR4A family member expression all occur concurrently (e.g., within a single day). As further described herein, in some aspects, immune cells can be further transduced to exhibit an increased expression level of a c-Jun polypeptide. For example, in some aspects, the ligand-binding construct can further comprise a nucleotide sequence encoding the c-Jun polypeptide. In some aspects, each of the activating (i.e., contacting) with PCS, transducing with a ligand-binding construct, editing to reduce NR4A family member expression, and transducing the immune cells to increase c-Jun expression can all occur concurrently. An example of such a culturing process is referred to herein as "PCS process A" (see FIG.1). [0186] In some aspects, two of the above steps (i.e., activating, transducing, and editing) occur concurrently (e.g., within a single day), while the third step occurs later on a separate day. For instance, in some aspects, the activating with PCS and transducing (i.e., to express a ligand-binding protein and/or to increase a c-Jun polypeptide expression) occur concurrently, and the editing occurs after the activating and the transducing. In some aspects, the editing occurs at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about seven days, at least about eight days, at least about nine days, or at least about 10 days after the activating and the transduce. In some aspects, the editing occurs about two days later. An example of such a culturing process is referred to herein as "PCS process B" (see FIG.1). [0187] In some aspects, the editing (i.e., to reduce NR4A expression) occurs prior to the cells being contacted with PCS. In some aspects, the editing occurs prior to the cells being transduced (e.g., to express a ligand-binding protein and/or to increase a c-Jun polypeptide expression). In some aspects, the editing occurs prior to both the contacting and the transducing. For example, in some aspects, the editing occurs at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about seven days, at least about eight days, at least about nine days, or at least about 10 days prior to the cells being contacted with PCS. In some aspects, the editing occurs at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about seven days, at least about eight days, at least about nine days, or at least about 10 days prior to the immune cells being transduced (e.g., to express a ligand-binding protein and/or to exhibit increased c-Jun polypeptide expression). In some aspects, the editing occurs at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about seven days, at least about eight days, at least about nine days, or at least about 10 days prior to both the contacting and the transducing. In some aspects, the editing occurs about one day prior to the contacting and the transducing (see, e.g., FIG.11). [0188] As demonstrated herein, in some aspects, the contacting and the editing can occur concurrently. As used herein, the term "concurrently" refers to two or more events (e.g., contacting with PCS and editing to exhibit reduced expression of the NR4A family member) occurring at the same time or within a single day (i.e., 24-hour period). For instance, as is apparent from the present disclosure, any of the individual steps described herein (e.g., contacting with PCS in MRM, transducing (e.g., with a ligand-binding construct, c-Jun polypeptide construct, or both), and/or editing with a NR4A family member targeting gene editing tool) can occur sequentially (e.g., cells are first contacted with PCS and then subsequently edited to exhibit reduced expression of a NR4A family member) and yet still be considered to occur concurrently, where the individual steps all occur within a single day. Accordingly, in some aspects, methods can be performed sequentially and yet be considered to occur concurrently. As used herein, the term "non- concurrently" refers to when two or more events (e.g., contacting with PCS and editing to exhibit reduced expression of the NR4A family member) do not occur within a single day (e.g., cells are first activated with PCS in MRM and then two days later, the cells are edited to exhibit reduced expression of a NR4A family member). [0189] Where the individual steps of the methods provided herein (e.g., contacting with PCS, transducing with a ligand-binding and/or c-Jun construct, and/or editing with a NR4A family member targeting gene editing tool) occur sequentially, in some aspects, the individual steps occur continuously, such that there can be some overlap in the individual steps. For example, in some aspects, after the immune cells are activated with PCS in MRM, the immune cells are immediately transduced such that the transducing occurs in the same MRM as the activating. In some aspects, where the individual steps occur continuously (e.g., activating and transducing), one or more additional components can be added to the medium during the later steps, such that the medium used during the earlier steps and the medium used during the later steps differ. For example, in some aspects, immune cells are activated with PCS in MRM that lack any cytokine, and then immediately transduced with a ligand-binding and/or c-Jun construct and/or edited with a NR4A family member targeting gene editing tool in the same MRM, except that exogenous cytokine (e.g., IL-2, IL-7, and/or IL-15) is added to the MRM during the editing and/or transducing. [0190] In some aspects, where the individual steps of the methods occur sequentially, two or more of the steps are performed non-continuously (i.e., two or more of the steps are separated by an intervening step). For example, in some aspects, after the immune cells are activated with PCS, the immune cells are not immediately edited. Instead, the immune cells are cultured in a separate medium (i.e., different from the medium used to activate the cells with PCS) and then subsequently edited, such that the activating and the transducing are performed in different media. [0191] To further illustrate, in some aspects, immune cells (e.g., T cells and/or NK cells) are cultured in a medium comprising potassium ion at a concentration higher than 5 mM, wherein the medium further comprises a programmable cell-signaling scaffold (PCS) and a gene editing tool that specifically targets a NR4A family member. Where immune cells are cultured in such a medium, in some aspects, the immune cells are contacted with both the PCS and the gene editing tool. In some aspects, the immune cells can be first contacted with PCS in MRM and then edited to exhibit reduced expression level of the NR4A family member with the proviso that both the contacting and the editing occur within a single day. [0192] As further described herein, in some aspects, the medium can additionally comprises an agent that is capable of increasing the expression of a c-Jun protein in the immune cells (e.g., nucleotide sequence encoding a c-Jun protein and/or a transcriptional activator that is capable of increasing the expression level of an endogenous c-Jun protein in the immune cells). Accordingly, in some aspects, immune cells (e.g., T cells and/or NK cells) are cultured in a medium comprising potassium ion at a concentration higher than 5 mM, wherein the medium further comprises: (a) a programmable cell-signaling scaffold (PCS), (b) a gene editing tool that specifically targets a NR4A family member, and (c) an agent that is capable of increasing the expression of a c-Jun protein in the immune cells. Where immune cells are cultured in such a medium, in some aspects, the immune cells are contacted with the PCS, the gene editing tool, and the agent. In some aspects, the immune cells are first contacted with PCS in MRM and then subsequently edited to exhibit reduced expression level of a NR4A family member and transduced to exhibit an increased expression of a c-Jun protein, with the proviso that the contacting and the editing all occur within a single day. [0193] Therefore, in some aspects, immune cells (e.g., T cells and/or NK cells) cultured and modified as described herein have been further modified (or transduced) to exhibit increased expression of a c-Jun protein. In some aspects, the immune cells can be transduced to exhibit increased expression of a c-Jun protein prior to contacting the cells with the PCS in a medium comprising potassium ion at a concentration higher than 5 mM. Accordingly, in some aspects, the immune cells are contacted with the PCS after the immune cells have been transduced to exhibit increased expression of a c-Jun protein. In some aspects, the immune cells are contacted with the PCS at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about seven days, at least about eight days, at least about nine days, or at least about 10 days after the immune cells are transduced to exhibit an increased expression of a c-Jun protein. In some aspects, immune cells can be modified (or transduced) to exhibit an increased expression of a c-Jun protein after the immune cells are contacted with the PCS in a medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, the immune cells are transduced to exhibit an increased expression of a c-Jun protein at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about seven days, at least about eight days, at least about nine days, or at least about 10 days after the immune cells are contacted with the PCS. In some aspects, immune cells can be transduced to exhibit increased expression of the c-Jun protein while the immune cells are contacted with the PCS in a medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, the immune cells can be transduced to exhibit increased expression of a c-Jun protein before editing the immune cells to exhibit reduced expression of a NR4A family member. In some aspects, the immune cells can be transduced to exhibit increased expression of a c-Jun protein after editing the immune cells to exhibit reduced expression of a NR4A family member. In some aspects, the immune cells can be transduced to exhibit increased expression of a c-Jun protein while the immune cells are edited to exhibit reduced expression level of a NR4A family member. [0194] In some aspects, after the contacting and the editing, the immune cells are further cultured. In some aspects, after the contacting and the editing, the immune cells are further cultured in an additional medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, the additional medium is the same as the medium used when contacting the immune cells with the PCS. In some aspects, the additional medium is different as the medium used when contacting the immune cells with the PCS. In some aspects, the additional medium does not comprise PCS, such that the immune cells are not contacted with the PCS when further cultured in the additional medium. In some aspects, after the contacting and the editing, the immune cells are further cultured in the additional medium (e.g., comprising potassium ion at a concentration higher than 5 mM) for at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about eight days, at least about nine days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, or at least about 14 days. In some aspects, after the contacting and the editing, the immune cells are further cultured in the additional medium for about eight days. [0195] As further described elsewhere in the present disclosure, in some aspects, immune cells (e.g., T cells and/or NK cells) cultured and modified as described herein express a ligand binding protein (e.g., CAR and/or TCR). In some aspects, the immune cells have been modified (or transduced) to express the ligand binding protein. For instance, in some aspects, immune cells can be transduced to express the ligand binding protein prior to contacting the cells with the PCS in a medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, immune cells can be transduced to express the ligand binding protein after the immune cells are contacted with the PCS in a medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, immune cells can be transduced to express the ligand binding protein while the immune cells are contacted with the PCS in a medium comprising potassium ion at a concentration higher than 5 mM. In some aspects, the immune cells can be transduced to express the ligand binding protein before editing the immune cells to exhibit reduced expression of a NR4A family member. In some aspects, the immune cells can be transduced to express the ligand binding protein after editing the immune cells to exhibit reduced expression of a NR4A family member. In some aspects, the immune cells can be transduced to express the ligand binding protein while the immune cells are edited to exhibit reduced expression level of a NR4A family member. [0196] As described herein, immune cells that have been contacted with PCS, edited to exhibit reduced NR4A family member expression, and transduced to express a ligand- binding protein can be further modified to exhibit an increased expression of a c-Jun polypeptide. Accordingly, in some aspects, immune cells described herein have been: (a) contacted with a PCS, (b) edited to exhibit reduced expression of a NR4A family member, (c) transduced to express a ligand-binding protein, and (d) transduced to exhibit an increased c-Jun polypeptide expression. In some aspects, such immune cells have been transduced to comprise a nucleotide sequence encoding the ligand binding protein, such that the immune cells express the ligand-binding protein. In some aspects, such immune cells have been transduced to comprise a nucleotide sequence encoding the c-Jun polypeptide, such that the expression of the c-Jun polypeptide is increased in the immune cells. In some aspects, such immune cells have been transduced to comprise a first nucleotide sequence encoding the ligand-binding protein and a second nucleotide sequence encoding the c-Jun polypeptide, such that the immune cells express the ligand-binding protein and the expression of the c-Jun polypeptide is increased in the immune cells. In some aspects, such immune cells have been transduced to comprise a transcriptional activator that is capable of increasing the expression level of an endogenous c-Jun protein in the immune cells. [0197] As described and demonstrated herein, the culturing and editing methods provided herein can be useful in enhancing certain aspects of immune cells (e.g., T cells and/or NK cells). According, some aspects of the present disclosure is related to a method of improving one or more properties of a population of immune cells (e.g., in response to persistent antigen stimulation) comprising: (a) contacting immune cells with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM, and (b) editing the immune cells to exhibit a reduced expression level of a nuclear receptor subfamily 4A (NR4A) family member as compared to corresponding immune cells which have not been editing, wherein after the contacting and the editing, the one or more properties of the population of immune cells is improved as compared to a reference population of immune cells. [0198] In some aspects, the one or more properties of immune cells that can be enhanced using the methods provided herein include: (a) an ability to produce a cytokine, (b) an ability to down-regulate an exhaustion marker, (c) an ability to proliferate, (d) an ability to kill tumor cells, and (e) any combination thereof. In some aspects, the cytokine comprises an IFN-γ, TNF-α, IL-2, or combinations thereof. [0199] In some aspects, immune cells useful for the present disclosure are CD3 ⁺ , CD45RO- , CCR7 ⁺ , CD45RA ⁺ , CD62L ⁺ , CD27 ⁺ , CD28 ⁺ , or TCF7 ⁺ , or any combination thereof, following the culturing and the modifying. In some aspects, the immune cells comprise T cells, B cells, regulatory T cells (Treg), tumor infiltrating lymphocytes (TIL), natural killer (NK) cells, natural killer T (NKT) cells, or any combination thereof. In some aspects, the immune cells have been engineered in vitro or ex vivo. [0200] Additional disclosure relating to the PCS, medium comprising potassium ion at a concentration higher than 5 mM, NR4A-targeting gene editing tools, and agents that are capable of increasing the expression of a c-Jun protein that can be used with the present disclosure are provided below. Metabolic Reprogramming Media (MRM) [0201] Some aspects of the present disclosure are directed to methods of contacting immune cells (e.g., T cells and/or NK cells) with PCS in a culture condition (e.g., media) and editing the cells to exhibit reduced expression of a NR4A family member, wherein the culture condition (e.g., certain ion concentrations, tonicity of the media, cytokines, and/or any combination thereof) is capable of reducing, limiting or preventing the differentiation of the immune cells, thereby affecting or improving their use in cell therapy, e.g., adoptive cell therapy. More specifically, as described herein, in some aspects, immune cells (e.g., T cells and/or NK cells) are contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM (also referred to herein as "metabolic reprogramming media" or "MRM") and edited to exhibit a reduced expression level of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3) as compared to corresponding immune cells which have not been edited. In some aspects, the activating and editing can occur concurrently (e.g., in the same day). In some aspects, the activating and editing can occur non-concurrently (i.e., on separate days). In some aspects, the immune cells are further modified to express a ligand binding protein (e.g., CAR and/or TCR) and/or exhibit an increased expression of a c-Jun protein. For instance, in some aspects, the immune cells are further transduced with a nucleotide sequence encoding the ligand-binding protein, such that the immune cells express the ligand-binding protein. In some aspects, the immune cells are further transduced with a nucleotide sequence encoding the c-Jun polypeptide, such that the immune cells express an increased expression level of the c-Jun polypeptide. In some aspects, the immune cells are further transduced with a first nucleotide sequence encoding the ligand-binding protein and a second nucleotide sequence encoding the c-Jun polypeptide, such that after the transducing, the immune cells express the ligand-binding protein and the expression of the c-Jun polypeptide in the immune cells is increased. As further described herein, in some aspects, after the activating, the editing, and/or the transducing, the immune cells can be further cultured in additional MRM. In some aspects, the additional MRM is the same as the MRM used to activate the immune cells. In some aspects, the additional MRM is different compared to the MRM used to activate the immune cells (e.g., does not comprise the PCS). [0202] In some aspects, as demonstrated herein, the immune cells cultured as described herein (e.g., contacted with PCS in MRM and edited to exhibit reduced expression of a NR4A family member) have a higher proportion of stem-like cells, as compared to reference immune cells, e.g., corresponding cells which have been cultured using conventional methods, e.g., in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or not comprising PCS. In some aspects, the immune cells cultured as described herein (e.g., contacted with PCS in MRM and edited to exhibit reduced expression of a NR4A family member) have a higher proportion of effector-like cells as compared to the reference immune cells. In some aspects, the immune cells cultured as described herein (e.g., contacted with PCS in MRM and edited to exhibit reduced expression of a NR4A family member) have a higher proportion of both stem-like and effector-like cells as compared to the reference immune cells. In some aspects, the immune cells cultured as described herein (e.g., contacted with PCS in MRM and edited to exhibit reduced expression of a NR4A family member) have a higher proliferative potential as compared to the reference immune cells. [0203] Some aspects of the present disclosure are directed to methods of preparing a population of immune cells (e.g., T cells and/or NK cells edited to exhibit a reduced expression of a member of the NR4A family), comprising contacting the immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM (e.g., a metabolic reprogramming medium disclosed herein) and editing the immune cells to exhibit reduced expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3). Some aspects of the present disclosure are directed to methods of preparing a population of T cells comprising contacting the T cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM (e.g., a metabolic reprogramming medium disclosed herein) and editing the immune cells to exhibit reduced expression of a NR4A family member. In some aspects, the present disclosure provides methods of preparing immune cells (e.g., T cells and/or NK cells), comprising contacting the immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM (e.g., higher than 40 mM, e.g., between 55 mM and 70 mM) and editing the immune cells to exhibit reduced expression of a NR4A family member, wherein the medium is capable of preserving a stem-like phenotype (e.g., minimal differentiation) of the immune cells. In some aspects, the present disclosure provides methods of preparing T cells comprising contacting the T cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM (e.g., higher than 40 mM, e.g., between 55 mM and 70 mM) and editing the T cells to exhibit reduced expression of a NR4A family member, wherein the medium is capable of preserving a stem-like phenotype (e.g., minimal differentiation) of the T cells. In some aspects, the cultured cells have more stem-like phenotypes (e.g., less differentiated) than reference immune cells, e.g., corresponding cells cultured in a medium having a lower potassium concentration and/or not comprising PCS. In some aspects, the medium further comprises interleukin (IL)-2, IL-21, IL-7, IL-15, or any combination thereof. In some aspects, the medium does not comprise a cytokine. For example, in some aspects, the medium provided herein (e.g., comprising potassium ion at a concentration higher than 5 mM) does not comprise IL-2. In some aspects, the medium does not comprise IL-15. In some aspects, the medium does not comprise IL-7. In some aspects, the medium does not comprise each of IL-2, IL-7, and IL-15. [0204] As is apparent from the present disclosure, MRM can be used in one or more steps of the methods provided herein. For example, where the methods provided herein comprises (a) activating the immune cells with PCS, (b) transducing the immune cells with a ligand-binding protein, and (c) editing with a NR4A-targeting gene editing tool, in some aspects, each of the activating, transducing, and editing can occur in MRM. In some aspects, the MRM in each of steps are the same. In some aspects, the MRM in one or more of the steps are different. In some aspects, the MRM used in activating the immune cells with PCS does not comprise a cytokine. In some aspects, the MRM used in activating the immune cells with PCS does not comprise IL-2, IL-7, and/or IL-15. In some aspects, where the transducing with a ligand-binding protein and/or editing with a NR4A family member targeting gene editing tool is performed after the activating with PCS, the transducing and/or editing can also occur in the same MRM, except that exogenous cytokine (e.g., IL- 2, IL-7, and/or IL-15) is added to the MRM. In some aspects, the medium provided herein (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises a sodium ion (e.g., NaCl), calcium ion, glucose, or any combination thereof. Additional aspects of such components are provided elsewhere in the present disclosure. [0205] In some aspects, a population of immune cells provided herein (e.g., T cells and/or NK cells contacted with PCS in MRM and edited to exhibit a reduced expression of a member of the NR4A family) has an increased number (or percentage) of stem-like cells relative to a population of reference immune cells, e.g., corresponding cells cultured using conventional methods, e.g., in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or not comprising PCS. Unless indicated otherwise, the term "number" and "percentage" can be used interchangeably when characterizing the cells modified and/or culture as described herein. In some aspects, a population of T cells provided herein (e.g., contacted with PCS in MRM and edited to exhibit a reduced expression of a member of the NR4A family) has an increased number of stem-like T cells relative to a population of reference T cells, e.g., corresponding T cells cultured using conventional methods, e.g., in a medium having less than 5 mM potassium ion and/or not comprising PCS. In some aspects, the immune cells modified and cultured as described herein (e.g., contacted with PCS in MRM and edited to exhibit reduced expression of a NR4A family member) have increased expression of markers characteristic of stem-like cells relative to the starting population of immune cells (i.e., prior to the culturing). In some aspects, the T cells modified and cultured as described herein have increased expression of markers characteristic of stem-like cells relative to the starting population of T cells (i.e., prior to the culturing). Non-limiting examples of markers characteristic of stem-like cells are provided elsewhere in the present disclosure. [0206] Accordingly, some aspects of the present disclosure are related to methods increasing the stemness of immune cells (e.g., T cells and/or NK cells) during ex vivo or in vitro culture comprising contacting immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit a reduced expression of a NR4A family member as compared to corresponding immune cells which have not been edited. As is apparent from at least the above disclosure, in some aspects, after the culturing, the number of stem-like immune cells present in the culture is increased compared to a reference method (e.g., corresponding method where the cells are cultured in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or does not comprise PCS). [0207] In some aspects, the starting population of immune cells (which can be modified and cultured as described herein) comprises immune cells (e.g., T cells and/or NK cells) obtained from a human subject. In some aspects, the starting population of immune cells comprises T cells obtained from a human subject. In some aspects, the starting population of immune T cells comprises TN cells, TSCM cells, TCM cells, TEM cells, or any combination thereof. [0208] Increased cell multipotency (or stemness) can be measured using any methods known in the art. In some aspects, cell stemness is measured by antibody staining followed by gated flow cytometry. In some aspects, the cell stemness is measured by autophagy flux. In some aspects, the cell stemness is measured by glucose uptake. In some aspects, the cell stemness is measured by fatty acid uptake. In some aspects, the cell stemness is measured by mitochondrial biomass. In some aspects, the cell stemness is measured by RNA quantification/expression analysis (e.g., microarray, qPCR (taqman), RNA-Seq., single- cell RNA-Seq., or any combinations thereof). In some aspects, the cell stemness is measured by transcripts that are linked to a metabolism assay (e.g., a seahorse metabolism assay, analysis of extracellular acidification rate (ECAR); analysis of oxygen consumption rate (OCR); analysis of spare respiratory capacity; and/or analysis of mitochondrial membrane potential). In some aspects, stemness is measured using one or more in vivo or in vitro functional assays (e.g., assaying cell persistence, antitumor capacity, antitumor clearance, viral clearance, multipotency, cytokine release, cell killing, or any combination thereof). [0209] In some aspects, the differentiation status of the immune cells provided herein (e.g., T cells and/or NK cells contacted with PCS in MRM and edited to exhibit a reduced expression of a member of the NR4A family) is characterized by increased numbers of cells expressing markers typical of less differentiated cells. In some aspects, the differentiation status of the T cells provided herein (e.g., contacted with PCS in MRM and edited to exhibit a reduced expression of a member of the NR4A family) is characterized by increased numbers (or percentage) of cells expressing markers typical of less differentiated T cells. Accordingly, some aspects of the present disclosure are related to methods of altering the phenotypic expression of immune cells comprising contacting immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit reduced expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3) as compared to corresponding immune cells which have not been edited. As further detailed below, in some aspects, the phenotypic marker is selected from CCR7, CD45RA, CD62L, CD27, CD28, TCF7, or combinations thereof. [0210] In some aspects, an increase in the number of stem-like cells is characterized by increased numbers of T cells expressing markers typical of T _N and/or T _SCM cells. In some aspects, an increase in the number of stem-like T cells is characterized by increased numbers of cells expressing markers typical of TSCM cells. In some aspects, the T cell population provided herein (e.g., modified and cultured as described herein) exhibits an increased number of cells that express CD45RA. In some aspects, the T cell population provided herein exhibits an increased number of cells that express CCR7. In some aspects, the T cell population provided herein exhibits an increased number of cells that express CD62L. In some aspects, the T cell population provided herein exhibits an increased number of cells that express CD28. In some aspects, the T cell population provided herein exhibits an increased number of cells that express CD95. In some aspects, the cells provided herein (e.g., modified and/or cultured as described herein) are CD45RO ^low . In some aspects, the cells provided herein do not express CD45RO. In some aspects, the cell population provided herein exhibits an increased number of cells (e.g., CD4 ⁺ and/or CD8 ⁺ T cells) that are CD45RA ⁺ and CCR7 ⁺ . In some aspects, the cell population provided herein exhibits an increased number of cells that are CD45RA ⁺ , CCR7 ⁺ , and CD62L ⁺ . In some aspects, the cell population provided herein (e.g., modified and/or cultured as described herein) exhibits an increased number of cells that are CD95 ⁺ , CD45RA ⁺ , CCR7 ⁺ , and CD62L ⁺ . In some aspects, the cell population provided herein exhibits an increased number of cells that express TCF7. In some aspects, the cell population provided herein exhibits an increased number of cells that have the following phenotypic expression: CD45RO ^lo/- CCR7 ⁺ CD45RA ⁺ CD62L ⁺ CD27 ⁺ CD28 ⁺ TCF7 ⁺ . In some aspects, the T cell population provided herein (e.g., modified and/or cultured as described herein) exhibits an increased number of cells that are CD45RA ⁺ , CCR7 ⁺ , CD62L ⁺ , and TCF7 ⁺ . In some aspects, the T cell population provided herein exhibits an increased number of cells that are CD95 ⁺ , CD45RA ⁺ , CCR7 ⁺ , CD62L ⁺ , and TCF7 ⁺ . In some aspects, the T cell population provided herein exhibits an increased number of cells that are CD3 ⁺ , CD45RA ⁺ , CCR7 ⁺ , CD62L ⁺ , and TCF7 ⁺ . In some aspects, the T cell population provided herein exhibits an increased number of cells that are CD3 ⁺ , CD95 ⁺ , CD45RA ⁺ , CCR7 ⁺ , CD62L ⁺ , and TCF7 ⁺ . In some aspects, the cells provided herein (e.g., modified and/or cultured as described herein) express CD27. In some aspects, the T cell population provided herein exhibits an increased number of cells that are CD27 ⁺ , CD3 ⁺ , CD45RA ⁺ , CCR7 ⁺ , CD62L ⁺ , and TCF7 ⁺ . In some aspects, the T cell population provided herein exhibits an increased number of cells that are CD27 ⁺ , CD3 ⁺ , CD95 ⁺ , CD45RA ⁺ , CCR7 ⁺ , CD62L ⁺ , and TCF7 ⁺ . In some aspects, the T cell population provided herein exhibits an increased number of cells that are CD39- and CD69-. In some aspects, the T cell population provided herein exhibits an increased number of cells that are TCF7 ⁺ and CD39-. In some aspects, the cell population provided herein exhibits an increased number of T _SCM cells. In some aspects, the cell population provided herein exhibits an increased number of T _N cells. In some aspects, the cell population provided herein exhibits an increased number of TSCM and TN cells. In some aspects, the cell population provided herein (e.g., modified and/or cultured as described herein) exhibits an increased number of stem-like T cells. In some aspects, the T cells are CD4 ⁺ cells; in some aspects, the T cells are CD8 ⁺ cells. In some aspects, the T cells comprise both CD4 ⁺ T cells and CD8+ T cells. [0211] In some aspects, after the culturing (e.g., contacting the immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the cells to exhibit reduced expression of a NR4A family member), the number of stem-like cells within the population of cells is increased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, relative to that of a population of reference cells (e.g., corresponding cells that were cultured in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or does not comprise PCS). In some aspects, after the culturing, the number of stem-like cells is increased by at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 4.5-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1000-fold, relative to that of the population of reference cells. [0212] In some aspects, after the culturing (e.g., contacting the immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the cells to exhibit reduced expression level of a NR4A family member), stem-like T cells constitute at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the total number of CD8 ⁺ T cells within the population of cells. In some aspects, after the culturing (e.g., contacting the immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the cells to exhibit reduced expression level of a NR4A family member), stem-like T cells constitute at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the total number of CD4 ⁺ T cells within the population of cells. [0213] As described herein, cells that are useful for the present disclosure (e.g., T cells and/or NK cells) have been modified such that they differ (structurally and/or functionally) from corresponding cells that exists in nature. For instance, unless indicated otherwise, the cells described herein have been edited to exhibit: a reduced expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3), as compared to corresponding cells that have not been modified. In some aspects, the cells useful for the present disclosure are further modified to express a ligand binding protein (e.g., CAR or engineered TCR). In some aspects, the cells useful for the present disclosure have also been modified to exhibit an increased expression of a c-Jun protein, as compared to corresponding cells that have not been modified to exhibit an increased expression of the c-Jun protein. Accordingly, in some aspects, cells provided herein have been modified to exhibit a reduced expression of a NR4A family member and express a ligand-binding protein (e.g., CAR and/or TCR). In some aspects, cells provided herein have been modified to exhibit a reduced expression of a NR4A family member and an increased expression of a c-Jun protein, as compared to a corresponding cell that has not been modified. In some aspects, cells provided herein (e.g., T cells and/or NK cells) have been modified to: (i) express a ligand-binding protein (e.g., CAR and/or TCR), (ii) exhibit a reduced expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3), and (iii) exhibit an increased expression of a c-Jun protein. When making such modifications to immune cells (e.g., T cells and/or NK cells), the modifying can occur prior to, during, and/or after the culturing methods provided herein (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM). In some aspects, the immune cells are modified before culturing the immune cells according to the methods disclosed herein. In some aspects, the immune cells are modified after culturing the immune cells according to the methods disclosed herein. In some aspects, the immune cells are cultured as described herein (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM) during the modifying. [0214] Accordingly, in some aspects, the culturing methods of the present disclosure (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM) can be used to edit immune cells (e.g., T cells and/or NK cells) to exhibit a reduced expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3). In some aspects, the culturing methods provided herein can be used to edit immune cells to exhibit a reduced expression of a member of the NR4A family, as compared to reference cells (e.g., corresponding immune cells that have not been modified and/or corresponding immune cells that were modified in a medium that does not comprise potassium ion at a concentration higher than 5 mM). In some aspects, when modified using the methods provided herein (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM), the immune cells exhibit a reduced expression of a member of the NR4A family, and a greater percentage of the immune cells are stem-like cells (e.g., CD45RA ⁺ and CCR7 ⁺ ), as compared to reference cells (e.g., corresponding immune cells that were modified in a medium that does not comprise potassium ion at a concentration higher than 5 mM). In some aspects, when modified using the methods provided herein (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM), the immune cells (a) express a ligand-binding protein (e.g., CAR or engineered TCR) and (b) exhibit a reduced expression of a member of the NR4A family, and a greater percentage of the immune cells are stem-like cells (e.g., CD45RA ⁺ and CCR7 ⁺ ), as compared to reference cells (e.g., corresponding immune cells that were modified in a medium that does not comprise potassium ion at a concentration higher than 5 mM). [0215] In some aspects, the culturing methods provided herein (e.g., contacting immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the cells to exhibit reduced expression of a NR4A family member) can be useful in enhancing one or more of the above-described modifications to immune cells (e.g., T cells and/or NK cells). For instance, in some aspects, when modified using the methods provided herein (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM), the immune cells exhibit greater reduction in the expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3), as compared to reference cells (e.g., corresponding cells modified in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or does not comprise PCS). In some aspects, compared to the reference cells, the expression of a member of the NR4A family is decreased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%. [0216] In some aspects, when modified using the methods provided herein (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM), the immune cells exhibit greater expression of a ligand binding protein (e.g., CAR or engineered TCR) as compared to reference cells (e.g., corresponding cells modified in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or does not comprise PCS). In some aspects, the expression of the ligand binding protein is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 100%, as compared to the reference cells. In some aspects, the expression of the ligand binding protein is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1000-fold as compared to the reference cells. [0217] As further described elsewhere in the present disclosure, modified immune cells provided herein (e.g., T cells and/or NK cells contacted with PCS in MRM and edited to exhibit a reduced expression of a NR4A family member) can be further modified to express a ligand-binding protein (e.g., CAR or engineered TCR) (e.g., transduced with a nucleotide sequence encoding the ligand-binding protein). Accordingly, in some aspects, when modified using the methods provided herein (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM), the immune cells exhibit: (a) greater expression of a ligand binding protein (e.g., CAR or engineered TCR), and (b) greater reduction in the expression of a member of the NR4A family, as compared to reference cells (e.g., corresponding cells modified in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or does not comprise PCS). As further described elsewhere in the present disclosure, such improved modifications can allow for greater therapeutic potential of the immune cells provided herein (e.g., T cells and/or NK cells modified and culture as described herein). [0218] Not to be bound by any one theory, in some aspects, the improved modifications to immune cells described above is associated with an increased transduction efficiency (e.g., of the gene editing tool that is capable of reducing the expression of a member of the NR4A family, an agent capable of increasing the expression of a c-Jun protein, and/or a nucleotide sequence encoding a ligand-binding protein). As used herein, the term "transduction efficiency" refers to: (i) the amount of material (e.g., exogenous polynucleotide, transcriptional activator, and/or gene editing tool) (also referred to herein as "payload") that can be physically introduced into a cell within a defined period of time; (ii) the amount of time it takes to physically introduce a given amount of material into a cell; (iii) the level to which a target material, e.g., an exogenous polynucleotide, i.e., a transgene, is taken up by a population of cells (e.g., the percentage of cells that express the transgene); or (iv) any combination of (i)-(iii). In some aspects, by increasing transduction efficiency, the culturing and modifying methods provided herein can allow for a greater amount of a payload (e.g., an exogenous nucleotide sequence, transcriptional activator, and/or gene editing tool) to be introduced into a cell and/or decrease the amount of time required to introduce a given amount of a payload (e.g., an exogenous nucleotide sequence, transcriptional activator, and/or gene editing tool). Not to be bound by any one theory, in some aspects, such an effect can increase the expression of the encoded protein (e.g., ligand-binding protein and/or c-Jun) in the modified immune cell as compared to reference cells (e.g., corresponding immune cells not cultured in a medium comprising potassium ion at a concentration higher than 5 mM and/or not comprising PCS). In some aspects, such an effect can decrease the expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3) in the modified immune cell as compared to the reference cells. In some aspects, such an effect can both increase the expression of the encoded protein (e.g., ligand- binding protein and/or c-Jun) and decrease the expression of a member of the NR4A family in the modified immune cell, as compared to the reference cells. [0219] In some aspects, when immune cells (e.g., T cells and/or NK cells) are modified using the methods provided herein (e.g., contacting the immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the cells to exhibit reduced expression of a NR4A family member), the transduction efficiency is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to that observed with a reference method (e.g., in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or does not comprise PCS). In some aspects, compared to the reference method, the transduction efficiency is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10- fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30- fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50- fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1000-fold. In certain aspects, culturing the cells, e.g., T cells and/or NK cells, under the conditions disclosed herein, e.g., in a hypotonic or isotonic medium comprising at least about 5 mM potassium ion, results in higher transduction efficiency. In some aspects, transduction efficiency is at least about 2-fold greater in cells, e.g., T cells and/or NK cells, cultured in hypotonic or isotonic medium comprising at least about 60 mM potassium ion, according to the methods disclosed herein, as compared to cells, e.g., T cells and/or NK cells, cultured in medium comprising 4 mM potassium ion or less. In some aspects, transduction efficiency is at least about 2.5-fold greater in cells, e.g., T cells and/or NK cells, cultured in hypotonic or isotonic medium comprising at least about 65 mM potassium ion, according to the methods disclosed herein, as compared to cells, e.g., T cells and/or NK cells, cultured in medium comprising 4 mM potassium ion or less. [0220] In some aspects, the immune cells (e.g., T cells and/or NK cells) are modified using a viral vector. In some aspects, the vector comprises a lentiviral vector, adenoviral vector, adeno-associated viral vector, vaccinia vector, herpes simplex viral vector, and Epstein- Barr viral vector. In some aspects, the viral vector comprises a retrovirus. In some aspects, the viral vector comprises a lentivirus. In some aspects, the viral vector comprises an AAV. [0221] In some aspects, the immune cells are modified using a non-viral method. In some aspects, the non-viral method includes the use of a transposon. In some aspects, use of a non-viral method of delivery permits reprogramming of immune cells, e.g., T cells and/or NK cells, and direct infusion of the cells into the subject. In some aspects, the polynucleotide encoding a gene of interest can be inserted into the genome of a target cell (e.g., a T cell) or a host cell (e.g., a cell for recombinant expression of the encoded proteins) by using CRISPR/Cas systems and genome edition alternatives such as zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and meganucleases (MNs). [0222] In some aspects, the immune cells, e.g., T cells and/or NK cells, are cultured according to the methods disclosed herein, e.g., contacted with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and edited to exhibit reduced expression of a NR4A family member, for the entirety of ex vivo culture, e.g., from the time the immune cells, e.g., T cells and/or NK cells, are isolated from a subject, through activating (e.g., with PCS), growing, expansion, modifying, and until administration into a subject in need of adoptive cell therapy. In some aspects, the T cells are cultured according to the methods disclosed herein, e.g., contacted with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and edited to exhibit reduced expression of a NR4A family member, for the entirety of ex vivo culture, e.g., from the time the T cells are isolated from a subject, through activating (e.g., with PCS) growing, expansion, engineering, and until administration into a subject in need of adoptive cell therapy. [0223] In some aspects, the immune cells, e.g., T cells and/or NK cells, are cultured according to the methods disclosed herein for the duration of expansion. In some aspects, the immune cells, e.g., T cells and/or NK cells, are cultured according to the methods disclosed herein until the total number of viable immune cells is at least about 10 ⁴ , at least about 5 x 10 ⁴ , at least about 10 ⁵ , at least about 5 x 10 ⁵ , at least about 10 ⁶ , at least about 5 x 10 ⁶ , at least about 1 x 10 ⁷ , at least about 5 x 10 ⁷ , at least about 1 x 10 ⁸ , at least about 5 x 10 ⁸ , at least about 1 x 10 ⁹ , at least about 5 x 10 ⁹ , at least about 1 x 10 ¹⁰ , at least about 5 x 10 ¹⁰ , at least about 1 x 10 ¹¹ , at least about 5 x 10 ¹¹ , at least about 1 x 10 ¹² , or at least about 5 x 10 ¹² total cells. In some aspects, the T cells are cultured according to the methods disclosed herein until the total number of viable T cells is at least about 10 ⁴ , at least about 5 x 10 ⁴ , at least about 10 ⁵ , at least about 5 x 10 ⁵ , at least about 10 ⁶ , at least about 5 x 10 ⁶ , at least about 1 x 10 ⁷ , at least about 5 x 10 ⁷ , at least about 1 x 10 ⁸ , at least about 5 x 10 ⁸ , at least about 1 x 10 ⁹ , at least about 5 x 10 ⁹ , at least about 1 x 10 ¹⁰ , at least about 5 x 10 ¹⁰ , at least about 1 x 10 ¹¹ , at least about 5 x 10 ¹¹ , at least about 1 x 10 ¹² , or at least about 5 x 10 ¹² total T cells. [0224] Accordingly, some aspects of the present disclosure are directed to methods of expanding a population of stem-like immune cells ex vivo or in vitro comprising contacting immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit a reduced expression of a NR4A family member as compared to corresponding immune cells which have not been edited. [0225] In some aspects, expanding the immune cells (e.g., T cells and/or NK cells) described herein in a medium comprising potassium ion at a concentration higher than 5 mM can help improve cell yield (i.e., the number of cells resulting from the expansion). In some aspects, the methods provided herein (e.g., activating, expanding, modifying, and/or culturing in a medium comprising potassium ion at a concentration higher than 5 mM) can help improve both cell yield and increase the stemness of the cells. [0226] Accordingly, some aspects of the present disclosure is related to a method of increasing the yield of immune cells during ex vivo or in vitro culture comprising contacting immune cells with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and editing the immune cells to exhibit reduced expression of a NR4A family member as compared to corresponding immune cells which have not been edited. In some aspects, the yield of the immune cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to that observed with a reference method (e.g., corresponding method performed in a medium that does not comprise potassium ion at a concentration higher than 5 mM and/or does not comprise PCS). In some aspects, compared to the reference method, the yield of the immune cells is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15- fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35- fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75- fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1000-fold. [0227] As is apparent from at least the above disclosure, some aspects of the present disclosure is directed to a method of increasing both stemness and yield of immune cells during ex vivo or in vitro culture comprising contacting immune cells in a medium comprising potassium ion at a concentration higher than 5 mM and editing immune cells to exhibit a reduced expression of a NR4A family member as compared to corresponding immune cells which have not been edited. In some aspects, both the stemness and yield of the immune cells are increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to that observed with a reference method (e.g., corresponding method performed in a medium that does not comprise potassium ion at a concentration higher than 5 mM). In some aspects, compared to the reference method, both the stemness and yield of the immune cells are increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1000-fold. [0228] In some aspects, the medium disclosed herein (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises a cell expansion agent. As used herein, a "cell expansion agent" refers to an agent, e.g., small molecule, polypeptide, or any combination thereof, that promotes the in vitro and/or ex vivo growth and proliferation of cultured cells, e.g., immune cells (e.g., T cells and/or NK cells). In some aspects, the cell expansion agent comprises a PI3K inhibitor. In some aspects, the medium further comprises an AKT inhibitor. In some aspects, the medium further comprises a PI3K inhibitor and an AKT inhibitor. In some aspects, the PI3K inhibitor comprises LY294002. In some aspects, the PI3K inhibitor comprises IC87114. In some aspects, the PI3K inhibitor comprises idelalisib (see, e.g., Peterson et al., Blood Adv. 2(3):210-23 (2018)). In some aspects, the medium further comprises a GSK3B inhibitor. In some aspects, the GSK3B inhibitor comprises TWS119. In some aspects, the medium further comprises an ACLY inhibitor. In some aspects, the ACLY inhibitor comprises potassium hydroxycitrate tribasic monohydrate. In some aspects, the PI3K inhibitor comprises hydroxyl citrate. In some aspects, the PI3K inhibitor comprises pictilisib. In some aspects, the PI3K inhibitor comprises CAL-101. In some aspects, the AKT inhibitor comprises MK2206, A443654, or AKTi-VIII (CAS 612847-09-3). [0229] In some aspects, a medium described herein (e.g., comprising potassium ion at a concentration higher than 5 mM) comprises a mitochondrial fuel. In some aspects, a medium described herein comprises O-Acetyl-L-carnitine hydrochloride. In some aspects, a medium described herein comprises at least about 0.1 mM, at least about 0.5 mM, at least about 1.0 mM, at least about 5 mM, or at least about 10 mM O-Acetyl-L-carnitine hydrochloride. In some aspects, a medium described herein comprises at least about 1.0 mM O-Acetyl-L-carnitine hydrochloride. [0230] In some aspects, a medium described herein (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises one or more of (i) one or more cell expansion agents, (ii) sodium ion (e.g., NaCl), (iii) one or more saccharides, (iv) calcium ion, and (v) one or more cytokines. As is apparent from the present disclosure, in some aspects, the medium further comprises a PCS. Additional aspects of such components are further detailed below. Potassium [0231] Some aspects of the disclosure are directed to methods of culturing (e.g., contacting with PCS and editing to exhibit reduced expression of a NR4A family member) immune cells (e.g., T cells and/or NK cells) in a medium comprising an increased concentration of potassium ion (e.g., greater than about 5 mM, greater than about 40 mM, greater than about 45 mM, greater than about 50 mM, greater than about 55 mM, greater than about 60 mM, greater than about 65 mM, or greater than about 70 mM), relative to a reference medium which does not comprise potassium ion at a concentration higher than 5 mM. In some aspects, the metabolic reprogramming medium comprises at least about 5 mM to at least about 100 mM potassium ion, at least about 5 mM to at least about 90 mM potassium ion, at least about 5 mM to at least about 80 mM potassium ion, at least about 5 mM to at least about 75 mM potassium ion, at least about 5 mM to at least about 70 mM potassium ion, at least about 5 mM to at least about 65 mM potassium ion, at least about 5 mM to at least about 60 mM potassium ion, at least about 5 mM to at least about 55 mM potassium ion, at least about 5 mM to at least about 50 mM potassium ion, at least about 5 mM to at least about 45 mM potassium ion, at least about 5 mM to at least about 40 mM potassium ion, at least about 10 mM to at least about 80 mM potassium ion, at least about 10 mM to at least about 75 mM potassium ion, at least about 10 mM to at least about 70 mM potassium ion, at least about 10 mM to at least about 65 mM potassium ion, at least about 10 mM to at least about 60 mM potassium ion, at least about 10 mM to at least about 55 mM potassium ion, at least about 10 mM to at least about 50 mM potassium ion, at least about 10 mM to at least about 45 mM potassium ion, at least about 10 mM to at least about 40 mM potassium ion, at least about 20 mM to at least about 80 mM potassium ion, at least about 20 mM to at least about 75 mM potassium ion, at least about 20 mM to at least about 70 mM potassium ion, at least about 20 mM to at least about 65 mM potassium ion, at least about 20 mM to at least about 60 mM potassium ion, at least about 20 mM to at least about 55 mM potassium ion, at least about 20 mM to at least about 50 mM potassium ion, at least about 20 mM to at least about 45 mM potassium ion, at least about 20 mM to at least about 40 mM potassium ion, at least about 30 mM to at least about 80 mM potassium ion, at least about 30 mM to at least about 75 mM potassium ion, at least about 30 mM to at least about 70 mM potassium ion, at least about 30 mM to at least about 65 mM potassium ion, at least about 30 mM to at least about 60 mM potassium ion, at least about 30 mM to at least about 55 mM potassium ion, at least about 30 mM to at least about 50 mM potassium ion, at least about 30 mM to at least about 45 mM potassium ion, at least about 30 mM to at least about 40 mM potassium ion, at least about 40 mM to at least about 80 mM potassium ion, at least about 40 mM to at least about 75 mM potassium ion, at least about 40 mM to at least about 70 mM potassium ion, at least about 40 mM to at least about 65 mM potassium ion, at least about 40 mM to at least about 60 mM potassium ion, at least about 40 mM to at least about 55 mM potassium ion, at least about 40 mM to at least about 50 mM potassium ion, at least about 40 mM to at least about 45 mM potassium ion, at least about 45 mM to at least about 80 mM potassium ion, at least about 45 mM to at least about 75 mM potassium ion, at least about 45 mM to at least about 70 mM potassium ion, at least about 45 mM to at least about 65 mM potassium ion, at least about 45 mM to at least about 60 mM potassium ion, at least about 45 mM to at least about 55 mM potassium ion, at least about 45 mM to at least about 50 mM potassium ion, at least about 50 mM to at least about 80 mM potassium ion, at least about 50 mM to at least about 75 mM potassium ion, at least about 50 mM to at least about 70 mM potassium ion, at least about 50 mM to at least about 65 mM potassium ion, at least about 50 mM to at least about 60 mM potassium ion, or at least about 50 mM to at least about 55 mM potassium ion. [0232] In some aspects, the metabolic reprogramming medium comprises at least about 5 mM, at least about 10 mM, at least about 15 mM, at least about 20 mM, at least about 25 mM, at least about 30 mM, at least about 35 mM, at least about 40 mM, at least about 45 mM, at least about 50 mM, at least about 55 mM, at least about 60 mM, at least about 65 mM, at least about 70 mM, at least about 75 mM, or at least about 80 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 5 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 10 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 15 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 20 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 25 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 30 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 35 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 40 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 45 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 50 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 55 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 60 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 65 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 70 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 75 mM potassium ion. In some aspects, the metabolic reprogramming medium comprises at least about 80 mM potassium ion. [0233] In some aspects, the metabolic reprogramming medium comprises an increased concentration of potassium ion, e.g., at least about 5 mM potassium ion, and the medium is hypotonic. As further described elsewhere in the present disclosure, in some aspects, the metabolic reprogramming medium comprises potassium ion and NaCl, wherein the potassium ion is at a concentration between about 40 mM and about 80 mM and NaCl is at a concentration between about 30 mM and about 100 mM, and wherein the total concentration of potassium ion and NaCl is between about 110 and about 140 mM. [0234] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 5 mM to about 100 mM. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 5 mM to about 100 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 5 mM to about 90 mM, about 5 mM to about 80 mM, about 5 mM to about 70 mM, about 5 mM to about 60 mM, or about 5 mM to about 50 mM. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 5 mM to about 90 mM, about 5 mM to about 80 mM, about 5 mM to about 70 mM, about 5 mM to about 60 mM, or about 5 mM to about 50 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 25 mM to about 100 mM. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 25 mM to about 100 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 25 mM to about 90 mM, about 25 mM to about 80 mM, about 25 mM to about 70 mM, about 25 mM to about 60 mM, or about 25 mM to about 50 mM. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 25 mM to about 90 mM, about 25 mM to about 80 mM, about 25 mM to about 70 mM, about 25 mM to about 60 mM, or about 25 mM to about 50 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 40 mM to about 100 mM. In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 40 mM to about 100 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion is about 40 mM to about 90 mM, about 40 mM to about 85 mM, about 40 mM to about 80 mM, about 40 mM to about 75 mM, about 40 mM to about 70 mM, about 40 mM to about 65 mM, about 40 mM to about 60 mM, about 40 mM to about 55 mM, or about 40 mM to about 50 mM. In some aspects, the concentration of potassium ion is about 40 mM to about 90 mM, about 40 mM to about 85 mM, about 40 mM to about 80 mM, about 40 mM to about 75 mM, about 40 mM to about 70 mM, about 40 mM to about 65 mM, about 40 mM to about 60 mM, about 40 mM to about 55 mM, or about 40 mM to about 50 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion is about 50 mM to about 90 mM, about 50 mM to about 85 mM, about 50 mM to about 80 mM, about 50 mM to about 75 mM, about 50 mM to about 70 mM, about 50 mM to about 65 mM, about 50 mM to about 60 mM, or about 50 mM to about 55 mM. In some aspects, the concentration of potassium ion is about 50 mM to about 90 mM, about 50 mM to about 85 mM, about 50 mM to about 80 mM, about 50 mM to about 75 mM, about 50 mM to about 70 mM, about 50 mM to about 65 mM, about 50 mM to about 60 mM, or about 50 mM to about 55 mM, and wherein the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 50 mM potassium ion and less than about 90 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0235] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 50 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 50 mM to about 115 mM, about 50 mM to about 110 mM, about 50 mM to about 105 mM, about 50 mM to about 100 mM, about 50 mM to about 95 mM, about 50 mM to about 90 mM, about 50 mM to about 85 mM, about 50 mM to about 80 mM, about 50 mM to about 75 mM, about 50 mM to about 70 mM, about 50 mM to about 65 mM, about 50 mM to about 60 mM, or about 50 mM to about 55 mM. In some aspects, the medium is hypotonic. In some aspects, the medium comprises at least about 50 mM to about 120 mM potassium ion and less than about 90 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0236] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 55 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 55 mM to about 115 mM, about 55 mM to about 110 mM, about 55 mM to about 105 mM, about 55 mM to about 100 mM, about 55 mM to about 95 mM, about 55 mM to about 90 mM, about 55 mM to about 85 mM, about 55 mM to about 80 mM, about 55 mM to about 75 mM, about 55 mM to about 70 mM, about 55 mM to about 65 mM, or about 55 mM to about 60 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 55 mM to about 120 mM potassium ion and less than about 85 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl in a metabolic reprogramming medium of the present disclosure is between 110 mM and 140 mM. [0237] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 60 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 60 mM to about 115 mM, about 60 mM to about 110 mM, about 60 mM to about 105 mM, about 60 mM to about 100 mM, about 60 mM to about 95 mM, about 60 mM to about 90 mM, about 60 mM to about 85 mM, about 60 mM to about 80 mM, about 60 mM to about 75 mM, about 60 mM to about 70 mM, or about 60 mM to about 65 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 60 mM to about 120 mM potassium ion and less than about 80 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0238] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 65 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 65 mM to about 115 mM, about 65 mM to about 110 mM, about 65 mM to about 105 mM, about 65 mM to about 100 mM, about 65 mM to about 95 mM, about 65 mM to about 90 mM, about 65 mM to about 85 mM, about 65 mM to about 80 mM, about 65 mM to about 75 mM, or about 65 mM to about 70 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 65 mM to about 120 mM potassium ion and less than about 75 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0239] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 70 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 70 mM to about 115 mM, about 70 mM to about 110 mM, about 70 mM to about 105 mM, about 70 mM to about 100 mM, about 70 mM to about 95 mM, about 70 mM to about 90 mM, about 70 mM to about 85 mM, about 70 mM to about 80 mM, or about 70 mM to about 75 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 70 mM to about 120 mM potassium ion and less than about 70 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0240] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 75 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 75 mM to about 115 mM, about 75 mM to about 110 mM, about 75 mM to about 105 mM, about 75 mM to about 100 mM, about 75 mM to about 95 mM, about 75 mM to about 90 mM, about 75 mM to about 85 mM, or about 75 mM to about 80 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 75 mM to about 120 mM potassium ion and less than about 65 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0241] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 80 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 80 mM to about 115 mM, about 80 mM to about 110 mM, about 80 mM to about 105 mM, about 80 mM to about 100 mM, about 80 mM to about 95 mM, about 80 mM to about 90 mM, or about 80 mM to about 85 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 80 mM to about 120 mM potassium ion and less than about 60 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0242] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 85 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 85 mM to about 115 mM, about 85 mM to about 110 mM, about 85 mM to about 105 mM, about 85 mM to about 100 mM, about 85 mM to about 95 mM, or about 85 mM to about 90 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 85 mM to about 120 mM potassium ion and less than about 65 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0243] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 90 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 90 mM to about 115 mM, about 90 mM to about 110 mM, about 90 mM to about 105 mM, about 90 mM to about 100 mM, or about 90 mM to about 95 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 90 mM to about 120 mM potassium ion and less than about 50 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0244] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 95 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 95 mM to about 115 mM, about 95 mM to about 110 mM, about 95 mM to about 105 mM, or about 95 mM to about 100 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 95 mM to about 120 mM potassium ion and less than about 55 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0245] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 100 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 100 mM to about 115 mM, about 100 mM to about 110 mM, or about 100 mM to about 105 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 100 mM to about 120 mM potassium ion and less than about 50 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0246] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 105 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 105 mM to about 115 mM, or about 105 mM to about 110 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 105 mM to about 120 mM potassium ion and less than about 35 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0247] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 110 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 110 mM to about 115 mM. In some aspects, the medium is hypotonic. In some aspects, the metabolic reprogramming medium comprises at least about 110 mM to about 120 mM potassium ion and less than about 30 mM to about 20 mM NaCl. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0248] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 50 mM to about 90 mM. In some aspects, the concentration of potassium ion is about 50 mM to about 80 mM. In some aspects, the concentration of potassium ion is about 60 mM to about 90 mM. In some aspects, the concentration of potassium ion is about 60 mM to about 80 mM. In some aspects, the concentration of potassium ion is about 70 mM to about 90 mM. In some aspects, the concentration of potassium ion is about 70 mM to about 80 mM. In some aspects, the concentration of potassium ion is about 80 mM to about 90 mM. [0249] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 50 mM to about 90 mM, and the concentration of NaCl is less than about 90 mM to about 50 mM. In some aspects, the concentration of potassium ion is about 50 mM to about 80 mM, and the concentration of NaCl is less than about 90 mM to about 60 mM. In some aspects, the concentration of potassium ion is about 60 mM to about 90 mM, and the concentration of NaCl is less than about 90 mM to about 60 mM. In some aspects, the concentration of potassium ion is about 60 mM to about 80 mM, and the concentration of NaCl is less than about 80 mM to about 60 mM. In some aspects, the concentration of potassium ion is about 70 mM to about 90 mM, and the concentration of NaCl is less than about 70 mM to about 50 mM. In some aspects, the concentration of potassium ion is about 70 mM to about 80 mM, and the concentration of NaCl is less than about 70 mM to about 60 mM. In some aspects, the concentration of potassium ion is about 80 mM to about 90 mM, and the concentration of NaCl is less than about 60 mM to about 50 mM. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0250] In some aspects, the concentration of potassium ion in a metabolic reprogramming medium of the present disclosure is about 50 mM to about 55 mM. In some aspects, the concentration of potassium ion is about 50 mM to about 55 mM, and the concentration of NaCl is less than about 90 to about 85. In some aspects, the concentration of potassium ion is about 55 mM to about 60 mM. In some aspects, the concentration of potassium ion is about 55 mM to about 60 mM, and the concentration of NaCl is less than about 85 to about 80. In some aspects, the concentration of potassium ion is about 60 mM to about 65 mM. In some aspects, the concentration of potassium ion is about 60 mM to about 65 mM, and the concentration of NaCl is less than about 80 mM to about 75 mM. In some aspects, the concentration of potassium ion is about 65 mM to about 70 mM. In some aspects, the concentration of potassium ion is about 65 mM to about 70 mM, and the concentration of NaCl is less than about 75 mM to about 70 mM. In some aspects, the concentration of potassium ion is about 70 mM to about 75 mM. In some aspects, the concentration of potassium ion is about 70 mM to about 75 mM, and the concentration of NaCl is less than about 70 mM to about 65 mM. In some aspects, the concentration of potassium ion is about 75 mM to about 80 mM. In some aspects, the concentration of potassium ion is about 75 mM to about 80 mM, and the concentration of NaCl is less than about 65 mM to about 60 mM. In some aspects, the concentration of potassium ion is about 80 mM to about 85 mM. In some aspects, the concentration of potassium ion is about 80 mM to about 85 mM, and the concentration of NaCl is less than about 60 mM to about 55 mM. In some aspects, the concentration of potassium ion is about 85 mM to about 90 mM. In some aspects, the concentration of potassium ion is about 85 mM to about 90 mM, and the concentration of NaCl is less than about 55 mM to about 50 mM. In some aspects, the concentration of potassium ion is about 90 mM to about 95 mM. In some aspects, the concentration of potassium ion is about 90 mM to about 95 mM, and the concentration of NaCl is less than about 50 to about 45. In some aspects, the concentration of potassium ion is about 95 mM to about 100 mM. In some aspects, the concentration of potassium ion is about 95 mM to about 100 mM, and the concentration of NaCl is less than about 45 mM to about 40 mM. In some aspects, the concentration of potassium ion is about 100 mM to about 105 mM. In some aspects, the concentration of potassium ion is about 100 mM to about 105 mM, and the concentration of NaCl is less than about 40 mM to about 35 mM. In some aspects, the concentration of potassium ion is about 105 mM to about 110 mM. In some aspects, the concentration of potassium ion is about 105 mM to about 110 mM, and the concentration of NaCl is less than about 35 to about 30. In some aspects, the concentration of potassium ion is about 110 mM to about 115 mM. In some aspects, the concentration of potassium ion is about 110 mM to about 115 mM, and the concentration of NaCl is less than about 30 mM to about 25 mM. In some aspects, the concentration of potassium ion is about 115 mM to about 120 mM. In some aspects, the concentration of potassium ion is about 115 mM to about 120 mM, and the concentration of NaCl is less than about 25 mM to about 20 mM. In some aspects, the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0251] In some aspects, the concentration of potassium ion is about 40 mM to about 90 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 40 mM to about 80 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 40 mM to about 70 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 50 mM to about 90 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 50 mM to about 80 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 50 mM to about 70 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 55 mM to about 90 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 55 mM to about 80 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 55 mM to about 70 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 60 mM to about 90 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 60 mM to about 80 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 60 mM to about 70 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 65 mM to about 90 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 65 mM to about 80 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 65 mM to about 70 mM, wherein the medium is hypotonic or isotonic. [0252] In some aspects, the concentration of potassium ion is higher than about 4 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 4 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 5 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 5 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 6 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 6 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 7 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 7 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 8 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 8 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 9 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 9 mM, wherein the medium is hypotonic or isotonic. [0253] In some aspects, the concentration of potassium ion is higher than about 10 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 10 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 11 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 11 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 12 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 12 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 13 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 13 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion is higher than about 14 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 14 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 15 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 15 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 16 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 16 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 17 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 17 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 18 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 18 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 19 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 19 mM, wherein the medium is hypotonic or isotonic. [0254] In some aspects, the concentration of potassium ion is higher than about 20 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 20 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 21 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 21 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 22 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 22 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 23 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 23 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion is higher than about 24 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 24 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 25 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 25 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 26 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 26 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 27 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 27 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 28 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 28 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 29 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 29 mM, wherein the medium is hypotonic or isotonic. [0255] In some aspects, the concentration of potassium ion is higher than about 30 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 30 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 31 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 31 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 32 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 32 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 33 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 33 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion is higher than about 34 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 34 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 35 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 35 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 36 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 36 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 37 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 37 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 38 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 38 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 39 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 39 mM, wherein the medium is hypotonic or isotonic. [0256] In some aspects, the concentration of potassium ion is higher than about 40 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 40 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 41 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 41 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 42 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 42 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 43 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 43 mM, wherein the medium is hypotonic. In some aspects, the concentration of potassium ion is higher than about 44 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 44 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 45 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 45 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 46 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 46 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 47 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 47 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 48 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 48 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is higher than about 49 mM, wherein the medium is hypotonic or isotonic. In some aspects, the concentration of potassium ion is about 49 mM, wherein the medium is hypotonic or isotonic. [0257] In some aspects, the metabolic reprogramming medium comprising a high concentration of potassium ion is prepared by adding a sufficient amount of a potassium salt in a medium. In some aspects, non-limiting examples of potassium salt include potassium aminetrichloroplatinate, potassium aquapentachlororuthenate, potassium bis(oxalato)platinate(II) dihydrate, potassium bisulfate, potassium borohydride, potassium bromide, potassium carbonate, potassium chloride, potassium chromate, potassium dichromate, potassium dicyanoargentate, potassium dicyanoaurate, potassium fluoride, potassium fluorosulfate, potassium hexachloroiridate, potassium hexachloroosmate, potassium hexachloropalladate, potassium hexachloroplatinate, potassium hexachlororhenate, potassium hexacyanochromate, potassium hexacyanoferrate, potassium hexacyanoruthenate(II) hydrate, potassium hexafluoroantimonate, potassium hexafluoronickelate, potassium hexafluorophosphate, potassium hexafluorotitanate, potassium hexafluorozirconate, potassium hexahydroxoantimonate, potassium hexaiodoplatinate, potassium hexaiodorhenate, potassium hydroxide, potassium iodate, potassium iodide, potassium manganate, potassium metavanadate, potassium molybdate, potassium nitrate, potassium nitrosodisulfonate, potassium osmate(VI) dihydrate, potassium pentachloronitrosylruthenate, potassium perchlorate, potassium perrhenate, potassium perruthenate, potassium persulfate, potassium phosphate dibasic, potassium phosphate monobasic, potassium pyrophosphate, potassium selenocyanate, potassium selenocyanate, potassium stannate trihydrate, potassium sulfate, potassium tellurate hydrate, potassium tellurite, potassium tetraborate tetrahydrate, potassium tetrabromoaurate, potassium tetrabromopalladate, potassium tetrachloropalladate, potassium tetrachloroplatinate, potassium tetracyanopalladate, potassium tetracyanoplatinate, potassium tetrafluoroborate, potassium tetranitroplatinate, potassium tetrathionate, potassium p-toluenethiosulfonate, potassium hydroxycitrate tribasic monohydrate, or any combination thereof. In certain aspects, the potassium salt comprises potassium chloride (KCl). In certain aspects, the potassium salt comprises potassium gluconate. In certain aspects, the potassium salt comprises potassium citrate. In certain aspects, the potassium salt comprises potassium hydroxycitrate. Sodium [0258] As is apparent from at least the above disclosure, in some aspects, a medium useful for the present disclosure (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises a sodium ion. Accordingly, some aspects of the present disclosure are directed to methods of culturing (e.g., contacting with PCS and editing to exhibit reduced expression of a NR4A family member) immune cells in a medium comprising (i) potassium ion at a concentration of at least about 5 mM and (ii) sodium ion (e.g., NaCl) at a concentration of less than about 115 mM. In some aspects, the medium is hypotonic or isotonic. In some aspects, the target concentration of sodium (e.g., NaCl) is reached by starting with a basal medium comprising a higher concentration of sodium ion (e.g., NaCl), and diluting the solution to reach the target concentration of sodium ion (e.g., NaCl). In some aspects, the target concentration of sodium ion (e.g., NaCl) is reached by adding one or more sodium salts (e.g., more NaCl). Non-limiting examples of sodium salts include sodium (meta)periodate, sodium arsenyl tartrate hydrate, sodium azide, sodium benzyloxide, sodium bromide, sodium carbonate, sodium chloride, sodium chromate, sodium cyclohexanebutyrate, sodium ethanethiolate, sodium fluoride, sodium fluorophosphate, sodium formate, sodium hexachloroiridate(III) hydrate, sodium hexachloroiridate(IV) hexahydrate, sodium hexachloroplatinate(IV) hexahydrate, sodium hexachlororhodate(III), sodium hexafluoroaluminate, sodium hexafluoroantimonate(V), sodium hexafluoroarsenate(V), sodium hexafluoroferrate(III), sodium hexafluorophosphate, sodium hexafluorosilicate, sodium hexahydroxyplatinate(IV), sodium hexametaphosphate, sodium hydrogen difluoride, sodium hydrogen sulfate, sodium hydrogencyanamide, sodium hydroxide, sodium iodide, sodium metaborate tetrahydrate, sodium metasilicate nonahydrate, sodium metavanadate, sodium molybdate, sodium nitrate, sodium nitrite, sodium oxalate, sodium perborate monohydrate, sodium percarbonate, sodium perchlorate, sodium periodate, sodium permanganate, sodium perrhenate, sodium phosphate, sodium pyrophosphate, sodium selenate, sodium selenite, sodium stannate, sodium sulfate, sodium tellurite, sodium tetraborate, sodium tetrachloroaluminate, sodium tetrachloroaurate(III), sodium tetrachloropalladate(II), sodium tetrachloroplatinate(II), sodium thiophosphate tribasic, sodium thiosulfate, sodium thiosulfate pentahydrate, sodium yttrium oxyfluoride, Trisodium trimetaphosphate, or any combination thereof. In some aspects, the sodium salt comprises sodium chloride (NaCl). In some aspects, the sodium salt comprises sodium gluconate. In some aspects, the sodium salt comprises sodium bicarbonate. In some aspects, the sodium salt comprises sodium hydroxycitrate. In some aspects, the sodium salt comprises sodium phosphate. [0259] In some aspects, the concentration of the sodium ion (e.g., NaCl) in a metabolic reprogramming medium of the present disclosure is less than that of the basal medium. In some aspects, the concentration of the sodium ion (e.g., NaCl) is reduced as the concentration of potassium ion is increased. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 25 mM to about 115 mM. In some aspects, the concentration of the sodium (e.g., NaCl) ion is from about 25 mM to about 100 mM, about 30 mM to about 40 mM, about 30 mM to about 50 mM, about 30 mM to about 60 mM, about 30 mM to about 70 mM, about 30 mM to about 80 mM, about 40 mM to about 50 mM, about 40 mM to about 60 mM, about 40 mM to about 70 mM, about 40 mM to about 80 mM, about 50 mM to about 55 mM, about 50 mM to about 60 mM, about 50 mM to about 65 mM, about 50 mM to about 70 mM, about 50 mM to about 75 mM, about 50 mM to about 80 mM, about 55 mM to about 60 mM, about 55 mM to about 65 mM, about 55 mM to about 70 mM, about 55 mM to about 75 mM, about 55 mM to about 80 mM, about 60 mM to about 65 mM, about 60 mM to about 70 mM, about 60 mM to about 75 mM, about 60 mM to about 80 mM, about 70 mM to about 75 mM, about 70 mM to about 80 mM, or about 75 mM to about 80 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 40 mM to about 80 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 50 mM to about 85 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 55 mM to about 80 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 30 mM to about 35 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 35 mM to about 40 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 40 mM to about 45 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 45 mM to about 50 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 50 mM to about 55 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 55 mM to about 60 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 60 mM to about 65 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 65 mM to about 70 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 70 mM to about 75 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 75 mM to about 80 mM. In some aspects, the concentration of the sodium ion (e.g., NaCl) is from about 80 mM to about 85 mM. [0260] In some aspects, the concentration of the sodium ion (e.g., NaCl) is about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, or about 90 mM. In certain aspects, the concentration of sodium ion (e.g., NaCl) is about 40 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 45 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 50 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 55 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 55.6 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 59.3 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 60 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 63.9 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 65 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 67.6 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 70 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 72.2 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 75 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 76 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 80 mM. In some aspects, the concentration of sodium ion (e.g., NaCl) is about 80.5 mM. In some aspects, the metabolic reprogramming medium comprises about 40 mM to about 90 mM potassium ion and about 40 mM to about 80 mM sodium ion (e.g., NaCl). [0261] In some aspects, the metabolic reprogramming medium comprises about 50 mM to about 75 mM potassium ion and about 80 mM to about 90 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 55 mM to about 75 mM potassium ion and about 80 mM to about 90 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 60 mM to about 75 mM potassium ion and about 80 mM to about 90 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 65 mM to about 75 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 65 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 66 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 67 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 68 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 69 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 71 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 72 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 73 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 74 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 75 mM potassium ion and about 80 mM to about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 65 mM potassium ion and about 80 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 65 mM potassium ion and about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 65 mM potassium ion and about 90 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and about 80 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and about 90 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 75 mM potassium ion and about 80 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 75 mM potassium ion and about 85 mM sodium ion (e.g., NaCl). In some aspects, the metabolic reprogramming medium comprises about 75 mM potassium ion and about 90 mM sodium ion (e.g., NaCl). [0262] In some aspects, the metabolic reprogramming medium comprises about 40 mM to about 90 mM potassium ion and about 30 mM to about 109 mM NaCl, wherein the concentration of NaCl (mM) is equal to or lower than (135 – potassium ion concentration, meaning 135 minus the concentration of potassium ion). In some aspects, the metabolic reprogramming medium comprises about 40 mM potassium ion and less than or equal to about 95 mM NaCl (e.g., about 95 mM, about 94 mM, about 93 mM, about 92 mM, about 91 mM, about 90 mM, about 85 mM, about 80 mM, about 75 mM, about 70 mM, about 65 mM, about 60 mM, about 55 mM, or about 50 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 45 mM potassium ion and less than or equal to about 90 mM NaCl (e.g., about 90 mM, about 89 mM, about 88 mM, about 87 mM, about 86 mM, about 85 mM, about 80 mM, about 75 mM, about 70 mM, about 65 mM, about 60 mM, about 55 mM, or about 50 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 50 mM potassium ion and less than or equal to about 85 mM NaCl (e.g., about 85 mM, about 84 mM, about 83 mM, about 82 mM, about 81 mM, about 80 mM, about 75 mM, about 70 mM, about 65 mM, about 60 mM, about 55 mM, or about 50 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 55 mM potassium ion and less than or equal to about 80 mM NaCl (e.g., about 80 mM, about 79 mM, about 78 mM, about 77 mM, about 76 mM, about 75 mM, about 70 mM, about 65 mM, about 60 mM, about 55 mM, or about 50 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 60 mM potassium ion and less than or equal to about 75 mM NaCl (e.g., about 75 mM, about 74 mM, about 73 mM, about 72 mM, about 71 mM, about 70 mM, about 65 mM, about 60 mM, about 55 mM, or about 50 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 65 mM potassium ion and less than or equal to about 70 mM NaCl (e.g., about 70 mM, about 69 mM, about 68 mM, about 67 mM, about 66 mM, about 65 mM, about 60 mM, about 55 mM, or about 50 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and less than or equal to about 70 mM NaCl (e.g., about 65 mM, about 64 mM, about 63 mM, about 62 mM, about 61 mM, about 60 mM, about 55 mM, or about 50 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 75 mM potassium ion and less than or equal to about 60 mM NaCl (e.g., about 60 mM, about 59 mM, about 58 mM, about 57 mM, about 56 mM, about 55 mM, about 50 mM, about 45 mM, or about 40 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 80 mM potassium ion and less than or equal to about 55 mM NaCl (e.g., about 55 mM, about 54 mM, about 53 mM, about 52 mM, about 51 mM, about 50 mM, about 45 mM, about 40 mM, or about 35 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 85 mM potassium ion and less than or equal to about 50 mM NaCl (e.g., about 50 mM, about 49 mM, about 48 mM, about 47 mM, about 46 mM, about 45 mM, about 40 mM, about 35 mM, or about 30 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 90 mM potassium ion and less than or equal to about 45 mM NaCl (e.g., about 45 mM, about 44 mM, about 43 mM, about 42 mM, about 41 mM, about 40 mM, about 35 mM, about 30 mM, or about 25 mM NaCl). In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and about 60 mM NaCl. In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and about 61 mM NaCl. In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and about 62 mM NaCl. [0263] In some aspects, the medium comprises about 50 mM potassium ion and about 75 mM NaCl. In some aspects, the medium is hypotonic. In some aspects, the medium is isotonic. [0264] Some aspects of the present disclosure are directed to methods of culturing immune cells (e.g., T cells and/or NK cells) in a medium comprising (i) potassium ion at a concentration higher than 5 mM and (ii) NaCl at a concentration of less than about 135 mM. Some aspects of the present disclosure are directed to methods of culturing immune cells, e.g., T cells and/or NK cells, in a medium comprising (i) potassium ion at a concentration higher than 40 mM and (ii) NaCl at a concentration of less than about 100 mM. Some aspects of the present disclosure are directed to methods of culturing immune cells, e.g., T cells and/or NK cells, in a medium comprising (i) potassium ion at a concentration higher than 50 mM and (ii) NaCl at a concentration of less than about 90 mM. Some aspects of the present disclosure are directed to methods of culturing immune cells, e.g., T cells and/or NK cells, in a medium comprising (i) potassium ion at a concentration higher than 55 mM and (ii) NaCl at a concentration of less than about 70 mM. Some aspects of the present disclosure are directed to methods of culturing immune cells, e.g., T cells and/or NK cells, in a medium comprising (i) potassium ion at a concentration higher than 60 mM and (ii) NaCl at a concentration of less than about 70 mM. Tonicity [0265] In some aspects of the present disclosure, the tonicity of the metabolic reprogramming medium (e.g., (concentration of potassium ion and concentration of NaCl) X 2) is adjusted based on the concentration of potassium ion and/or NaCl. In some aspects, the tonicity of the metabolic reprogramming medium is lower than that of the basal medium. In some aspects, the tonicity of the metabolic reprogramming medium is higher than that of the basal medium. In some aspect, the tonicity of the medium is the same as that of the basal medium. The tonicity of the metabolic reprogramming medium can be affected by modifying the concentration of potassium ion and/or NaCl in the media. In some aspects, increased potassium ion concentration is paired with an increase or a decrease in the concentration of NaCl. In some aspects, this pairing affects the tonicity of the metabolic reprogramming medium. In some aspects, the concentration of potassium ion is increased while the concentration of NaCl, is decreased. [0266] In some aspects, the medium useful for the present media is prepared based on the function of potassium ion and tonicity. For example, in some aspects, if the medium useful for the present disclosure is hypotonic (e.g., less than 280 mOsm) and comprises at least about 50 mM of potassium ion, a concentration of NaCl that is sufficient to maintain the medium as hypotonic can be determined based on the following formula: NaCl concentration = (desired tonicity (280)/2) – potassium ion concentration. (i.e., the concentration of NaCl (mM) is equal to or lower than (140 – potassium ion concentration)). In some aspects, a hypotonic medium disclosed herein comprises a total concentration of potassium ion and NaCl between 110 mM and 140 mM. Therefore, for hypotonic medium, the concentration of potassium ion can be set at a concentration between 50 mM and 90 mM, and the NaCl concentration can be between 90 mM and 50 mM, or lower, so long as the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. In some aspects, a hypotonic medium disclosed herein comprises a total concentration of potassium ion and NaCl between 115 mM and 140 mM. In some aspects, the hypotonic medium disclosed herein comprises a total concentration of potassium ion and NaCl between 120 mM and 140 mM. [0267] In some aspects, the metabolic reprogramming medium is isotonic (between 280 mOsm and 300 mOsm) and comprises a concentration of potassium ion between about 50 mM and 70 mM. The corresponding concentration of NaCl can be again calculated based on the formula: NaCl concentration = (desired tonicity/2) – potassium ion concentration. For example, if the concentration of potassium is 50 mM and the desired tonicity is 300 mOsm, the NaCl concentration can be 100 mM. [0268] In some aspects, the metabolic reprogramming medium is isotonic. In some aspects, the metabolic reprogramming medium has a tonicity of about 280 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 1 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 2 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 3 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 4 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 5 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 6 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 7 mOsm/L. In some aspects, the MRM has a tonicity of 280 mOsm/L ± 8 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 9 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of 280 mOsm/L ± 10 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 280 mOsm/L to about 285 mOsm/L, about 280 mOsm/L to about 290 mOsm/L, about 280 mOsm/L to about 295 mOsm/L, about 280 mOsm/L to about 300 mOsm/L, about 280 mOsm/L to about 305 mOsm/L, about 280 mOsm/L to about 310 mOsm/L, about 280 mOsm/L to about 315 mOsm/L, or about 280 mOsm/L to less than 320 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 285 mOsm/L, about 290 mOsm/L, about 295 mOsm/L, about 300 mOsm/L, about 305 mOsm/L, about 310 mOsm/L, or about 315 mOsm/L. [0269] In some aspects, the metabolic reprogramming medium is hypotonic. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 280 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 280 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than 280 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than 280 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than 275 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than 275 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than 270 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than 270 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than 265 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than 265 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than 260 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than 260 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than 265 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than 265 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than 260 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than 260 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than 255 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than 255 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 250 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 250 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 245 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 245 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 240 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 240 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 235 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 235 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 230 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 230 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 225 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity lower than about 225 mOsm/L. In some aspects, the tonicity is higher than about 220 mOsm/L; as measured by adding the potassium ion concentration and the NaCl concentration, and multiplying by two. In some aspects, the metabolic reprogramming medium has a tonicity from about 230 mOsm/L to about 280 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 240 mOsm/L to about 280 mOsm/L. [0270] In some aspects, the metabolic reprogramming medium has an osmolality lower than about 220 mOsm/L. In some aspects, the metabolic reprogramming medium has an osmolality lower than about 215 mOsm/L. In some aspects, the metabolic reprogramming medium has an osmolality lower than about 210 mOsm/L. In some aspects, the metabolic reprogramming medium has an osmolality lower than about 205 mOsm/L. In some aspects, the metabolic reprogramming medium has an osmolality lower than about 200 mOsm/L. [0271] In some aspects, the metabolic reprogramming medium has a tonicity from about 100 mOsm/L to about 280 mOsm/L, about 125 mOsm/L to about 280 mOsm/L, about 150 mOsm/L to about 280 mOsm/L, about 175 mOsm/L to about 280 mOsm/L, about 200 mOsm/L to about 280 mOsm/L, about 210 mOsm/L to about 280 mOsm/L, about 220 mOsm/L to about 280 mOsm/L, about 225 mOsm/L to about 280 mOsm/L, about 230 mOsm/L to about 280 mOsm/L, about 235 mOsm/L to about 280 mOsm/L, about 240 mOsm/L to about 280 mOsm/L, about 245 mOsm/L to about 280 mOsm/L, about 250 mOsm/L to about 280 mOsm/L, about 255 mOsm/L to about 280 mOsm/L, about 260 mOsm/L to about 280 mOsm/L, about 265 mOsm/L to about 280 mOsm/L, about 270 mOsm/L to about 280 mOsm/L, or about 275 mOsm/L to about 280 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 250 mOsm/L to about 270 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 250 mOsm/L to about 255 mOsm/L, about 250 mOsm/L to about 260 mOsm/L, about 250 mOsm/L to about 265 mOsm/L, about 255 mOsm/L to about 260 mOsm/L, about 255 mOsm/L to about 265 mOsm/L, about 255 mOsm/L to about 265 mOsm/L, about 260 mOsm/L to about 265 mOsm/L, or about 254 mOsm/L to about 263 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 254 mOsm/L to about 255 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 255 mOsm/L to about 256 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 256 mOsm/L to about 257 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 257 mOsm/L to about 258 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 258 mOsm/L to about 259 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 260 mOsm/L to about 261 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 261 mOsm/L to about 262 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 262 mOsm/L to about 263 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 263 mOsm/L to about 264 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 264 mOsm/L to about 265 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity from about 220 mOsm/L to about 280 mOsm/L. [0272] In some aspects, the metabolic reprogramming medium has a tonicity of about 100 mOsm/L, about 125 mOsm/L, about 150 mOsm/L, about 175 mOsm/L, about 200 mOsm/L, about 210 mOsm/L, about 220 mOsm/L, about 225 mOsm/L, about 230 mOsm/L, about 235 mOsm/L, about 240 mOsm/L, about 245 mOsm/L, about 250 mOsm/L, about 255 mOsm/L, about 260 mOsm/L, about 265 mOsm/L, about 270 mOsm/L, or about 275 mOsm/L. [0273] In some aspects, the metabolic reprogramming medium has a tonicity of about 250 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 262.26 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 260 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 259.7 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 257.5 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 257.2 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 255.2 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 254.7. In some aspects, the metabolic reprogramming medium has a tonicity of about 255 mOsm/L. In some aspects, the metabolic reprogramming medium has a tonicity of about 260 mOsm/L. [0274] In some aspects, the metabolic reprogramming medium comprises about 50 mM potassium ion and (i) about 80.5 mM NaCl; (ii) about 17.7 mM glucose; and (iii) about 1.8 mM calcium ion. [0275] In some aspects, the metabolic reprogramming medium comprises about 55 mM potassium ion and (i) about 76 mM NaCl; (ii) about 17.2 mM glucose; and (iii) about 1.7 mM calcium ion. [0276] In some aspects, the metabolic reprogramming medium comprises about 60 mM potassium ion and (i) about 72.2 mM NaCl; (ii) about 16.8 mM glucose; and (iii) about 1.6 mM calcium ion. [0277] In some aspects, the metabolic reprogramming medium comprises about 65 mM potassium ion and (i) about 67.6 mM NaCl; (ii) about 16.3 mM glucose; and (iii) about 1.5 mM calcium ion. [0278] In some aspects, the metabolic reprogramming medium comprises about 70 mM potassium ion and (i) about 63.9 mM NaCl; (ii) about 15.9 mM glucose; and (iii) about 1.4 mM calcium ion. [0279] In some aspects, the metabolic reprogramming medium comprises about 75 mM potassium ion and (i) about 59.3 mM NaCl; (ii) about 15.4 mM glucose; and (iii) about 1.3 mM calcium ion. [0280] In some aspects, the metabolic reprogramming medium comprises about 80 mM potassium ion and (i) about 55.6 mM NaCl; (ii) about 15 mM glucose; and (iii) about 1.2 mM calcium ion. [0281] The tonicity of the metabolic reprogramming medium can be adjusted, e.g., to an isotonic or hypotonic state disclosed herein, at any point. In some aspects, the tonicity of the metabolic reprogramming medium can be adjusted, e.g., to an isotonic or hypotonic state disclosed herein, before the cells are added to the metabolic reprogramming medium. In some aspects, the cells are cultured in the hypotonic or isotonic medium prior to cell engineering, e.g., prior to transduction with a construct expressing a CAR, TCR or TCR mimic. In some aspects, the cells are cultured in the hypotonic or isotonic medium during cell engineering, e.g., during transduction with a construct expressing a CAR, TCR or TCR mimic. In some aspects the cells are cultured in the hypotonic or isotonic medium after cell engineering, e.g., after transduction with a construct expressing a CAR, TCR or TCR mimic. In some aspects, the cells are cultured in the hypotonic or isotonic medium throughout cell expansion. Saccharides [0282] In some aspects, a medium useful for the present disclosure (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises a saccharide. Accordingly, some aspects of the present disclosure are directed to methods of culturing immune cells (e.g., contacting T cells and/or NK cells with PCS and modifying the cells to exhibit a reduced expression of a member of the NR4A family) in a medium comprising (i) potassium ion at a concentration higher than 5 mM and (ii) a saccharide. In some aspects, the medium is hypotonic or isotonic. In some aspects, a medium that can be used with the present disclosure comprises potassium ion at a concentration higher than 5 mM, a saccharide, and a sodium ion (e.g., NaCl). [0283] In some aspects, the target concentration of the saccharide is reached by starting with a basal medium comprising a higher concentration of the saccharide, and diluting the solution to reach the target concentration of the saccharide. In some aspects, the target concentration of the saccharide is reached by raising the concentration of the saccharide by adding the saccharide until the desired concentration is reached. In some aspects, the saccharide is a monosaccharide, a disaccharide, or a polysaccharide. In some aspects, the saccharide is selected from glucose, fructose, galactose, mannose, maltose, sucrose, lactose, trehalose, or any combination thereof. In certain aspects, the saccharide is glucose. In some aspects, the medium comprises (i) potassium ion at a concentration of at least about 5 mM and (ii) glucose. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 40 mM and (ii) glucose. In some aspects, the medium comprises (i) potassium ion at a concentration of at least about 5 mM and (ii) mannose. In some aspects, the medium comprises (i) potassium ion at a concentration of at least about 50 mM and (ii) mannose. In some aspects, the medium is hypotonic. In some aspects, the medium is isotonic. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 40 mM and (ii) glucose; wherein the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 50 mM and (ii) glucose; wherein the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. In some aspects, the medium comprises (i) potassium ion at a concentration of at least about 40 mM and (ii) mannose; wherein the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. In some aspects, the medium comprises (i) potassium ion at a concentration of at least about 50 mM and (ii) mannose; wherein the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0284] In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) glucose. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration of at least about 30 mM to at least about 100 mM and (ii) glucose. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration higher than 40 mM and (ii) glucose. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) mannose. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration of at least about 30 mM to at least about 100 mM and (ii) mannose. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration of higher than 40 mM and (ii) mannose. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration of at least about 50 mM and (ii) mannose. In some aspects, the metabolic reprogramming medium is hypotonic. In some aspects, the medium is isotonic. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration higher than 40 mM and (ii) glucose; wherein the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration higher than 50 mM and (ii) glucose; wherein the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration of at least about 40 mM and (ii) mannose; wherein the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. In some aspects, the metabolic reprogramming medium comprises (i) potassium ion at a concentration of at least about 50 mM and (ii) mannose; wherein the total concentration of potassium ion and NaCl is between 110 mM and 140 mM. [0285] In some aspects, the concentration of the saccharide, e.g., glucose, is about 10 mM to about 24 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is less than about 4.29 g/L. In some aspects, the concentration of the saccharide, e.g., glucose, is less than about 24 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is more than about 5 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is about 5 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 5 mM to about 20 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 10 mM to about 20 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 10 mM to about 25 mM, about 10 mM to about 20 mM, about 10 mM to about 5 mM, about 15 mM to about 25 mM, about 15 mM to about 20 mM, about 15 mM to about 19 mM, about 15 mM to about 18 mM, about 15 mM to about 17 mM, about 15 mM to about 16 mM, about 16 mM to about 20 mM, about 16 mM to about 19 mM, about 16 mM to about 18 mM, about 16 mM to about 17 mM, about 17 mM to about 20 mM, about 17 mM to about 19 mM, or about 17 mM to about 18 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 5 mM to about 20 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 10 mM to about 20 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 10 mM to about 15 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 14 mM to about 14.5 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 14.5 mM to about 15 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 15 mM to about 15.5 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 15.5 mM to about 16 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 16 mM to about 16.5 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 16.5 mM to about 17 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 17 mM to about 17.5 mM. In some aspects, the concentration of the saccharide, e.g., glucose, is from about 17.5 mM to about 18 mM. [0286] In some aspects, the concentration of the saccharide, e.g., glucose, is about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, is about 10.5 mM, about 11 mM, about 11.5 mM, about 12 mM, about 12.5 mM, about 13 mM, about 13.5 mM, about 14 mM, about 14.5 mM, about 15 mM, about 15.5 mM, about 16 mM, about 16.5 mM, about 17 mM, about 17.5 mM, about 18 mM, about 18.5 mM, about 19 mM, about 19.5 mM, about 20 mM, about 20.5 mM, about 21 mM, about 22 mM, about 23 mM, about 24 mM, or about 25 mM. Calcium [0287] In some aspects, a medium useful for the present disclosure (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises a calcium ion. Accordingly, some aspects of the present disclosure are directed to methods of culturing immune cells, e.g., contacting T cells and/or NK cells with PCS and modifying to exhibit a reduced expression of a NR4A family member, in a medium comprising (i) potassium ion at a concentration higher than 5 mM and (ii) calcium ion. In some aspects, the medium is hypotonic or isotonic. In some aspects, a medium that can be used with the present disclosure comprises (a) potassium ion at a concentration higher than 5 mM, (b) a sodium ion (e.g., NaCl), and (c) a calcium ion. In some aspects, a medium useful for the present disclosure comprises (a) potassium ion at a concentration higher than 5 mM, (b) a saccharide, and (c) a calcium ion. In some aspects, a medium useful for the present disclosure comprises (a) potassium ion at a concentration higher than 5 mM, (b) a sodium ion (e.g., NaCl), (c) a saccharide, and (d) a calcium ion. [0288] In some aspects, the target concentration of calcium is reached by starting with a basal medium comprising a higher concentration of calcium ion, and diluting the solution to reach the target concentration of calcium ion. In some aspects, the target concentration of calcium is reached by raising the concentration of calcium ion by adding one or more calcium salts. Non-limiting examples of calcium salts include calcium bromide, calcium carbonate, calcium chloride, calcium cyanamide, calcium fluoride, calcium hydride, calcium hydroxide, calcium iodate, calcium iodide, calcium nitrate, calcium nitrite, calcium oxalate, calcium perchlorate tetrahydrate, calcium phosphate monobasic, calcium phosphate tribasic, calcium sulfate, calcium thiocyanate tetrahydrate, hydroxyapatite, or any combination thereof. In some aspects, the calcium salt comprises calcium chloride (CaCl2). In some aspects, the calcium salt comprises calcium gluconate. [0289] In some aspects, the concentration of the calcium ion is less than that of the basal medium. In some aspects, the concentration of the calcium ion is greater than that of the basal medium. In some aspects, the concentration of calcium ion is more than about 0.4 mM. In some aspects, the concentration of calcium ion is less than about 2.8 mM. In some aspects, the concentration of calcium ion is less than about 2.5 mM. In some aspects, the concentration of calcium ion is less than about 2.0 mM. In some aspects, the concentration of calcium ion is less than about 1.9 mM. In some aspects, the concentration of calcium ion is less than about 1.8 mM. In some aspects, the concentration of calcium ion is less than about 1.7 mM. In some aspects, the concentration of calcium ion is less than about 1.6 mM. In some aspects, the concentration of calcium ion is less than about 1.5 mM. In some aspects, the concentration of calcium ion is less than about 1.4 mM. In some aspects, the concentration of calcium ion is less than about 1.3 mM. In some aspects, the concentration of calcium ion is less than about 1.2 mM. In some aspects, the concentration of calcium ion is less than about 1.1 mM. In some aspects, the concentration of calcium ion is less than about 1.0 mM. [0290] In some aspects, the concentration of calcium ion is from about 0.4 mM to about 2.8 mM, about 0.4 mM to about 2.7 mM, about 0.4 mM to about 2.5 mM, about 0.5 mM to about 2.0 mM, about 1.0 mM to about 2.0 mM, about 1.1 mM to about 2.0 mM, about 1.2 mM to about 2.0 mM, about 1.3 mM to about 2.0 mM, about 1.4 mM to about 2.0 mM, about 1.5 mM to about 2.0 mM, about 1.6 mM to about 2.0 mM, about 1.7 mM to about 2.0 mM, about 1.8 mM to about 2.0 mM, about 0.8 to about 0.9 mM, about 0.8 to about 1.0 mM, about 0.8 to about 1.1 mM, about 0.8 to about 1.2 mM, about 0.8 to about 1.3 mM, about 0.8 to about 1.4 mM, about 0.8 to about 1.5 mM, about 0.8 to about 1.6 mM, about 0.8 to about 1.7 mM, about 0.8 to about 1.8 mM, about 0.9 to about 1.0 mM, about 0.9 to about 1.1 mM, about 0.9 to about 1.2 mM, about 0.9 to about 1.3 mM, about 0.9 to about 1.4 mM, about 0.9 to about 1.5 mM, about 0.9 to about 1.6 mM, about 0.9 to about 1.7 mM, about 0.9 to about 1.8 mM, about 1.0 to about 1.1 mM, about 1.0 to about 1.2 mM, about 1.0 to about 1.3 mM, about 1.0 to about 1.4 mM, about 1.0 to about 1.5 mM, about 1.0 to about 1.6 mM, about 1.0 to about 1.7 mM, about 1.0 to about 1.8 mM, about 1.1 to about 1.2 mM, about 1.1 to about 1.3 mM, about 1.1 to about 1.4 mM, about 1.1 to about 1.5 mM, about 1.1 to about 1.6 mM, about 1.1 to about 1.7 mM, about 1.1 to about 1.8 mM, about 1.2 to about 1.3 mM, about 1.2 to about 1.4 mM, about 1.2 to about 1.5 mM, about 1.2 to about 1.6 mM, about 1.2 to about 1.7 mM, about 1.2 to about 1.8 mM, about 1.3 to about 1.4 mM, about 1.3 to about 1.5 mM, about 1.3 to about 1.6 mM, about 1.3 to about 1.7 mM, about 1.3 to about 1.8 mM, about 1.4 to about 1.5 mM, about 1.4 to about 1.6 mM, about 1.4 to about 1.7 mM, about 1.4 to about 1.8 mM, about 1.5 to about 1.6 mM, about 1.5 to about 1.7 mM, about 1.5 to about 1.8 mM, about 1.6 to about 1.7 mM, about 1.6 to about 1.8 mM, or about 1.7 to about 1.8 mM. [0291] In some aspects, the concentration of calcium ion is from about 0.8 mM to about 1.8 mM. In some aspects, the concentration of calcium ion is from about 0.9 mM to about 1.8 mM. In some aspects, the concentration of calcium ion is from about 1.0 mM to about 1.8 mM. In some aspects, the concentration of calcium ion is from about 1.1 mM to about 1.8 mM. In some aspects, the concentration of calcium ion is from about 1.2 mM to about 1.8 mM. In some aspects, the concentration of calcium ion is from about 0.8 mM to about 1.8 mM. In some aspects, the concentration of calcium ion is from about 0.8 mM to about 0.9 mM. In some aspects, the concentration of calcium ion is from about 0.9 mM to about 1.0 mM. In some aspects, the concentration of calcium ion is from about 1.0 mM to about 1.1 mM. In some aspects, the concentration of calcium ion is from about 1.1 mM to about 1.2 mM. In some aspects, the concentration of calcium ion is from about 1.2 mM to about 1.3 mM. In some aspects, the concentration of calcium ion is from about 1.3 mM to about 1.4 mM. In some aspects, the concentration of calcium ion is from about 1.4 mM to about 1.5 mM. In some aspects, the concentration of calcium ion is from about 1.5 mM to about 1.6 mM. In some aspects, the concentration of calcium ion is from about 1.7 mM to about 1.8 mM. [0292] In some aspects, the concentration of calcium ion is about 0.6 mM, about 0.7 mM, about 0.8 mM, about 0.9 mM, about 1.0 mM, about 1.1 mM, about 1.2 mM, about 1.3 mM, about 1.4 mM, about 1.5 mM, about 1.6 mM, about 1.7 mM, about 1.8 mM, about 1.9 mM, or about 2.0 mM. In some aspects, the concentration of calcium ion is about 0.6 mM. In some aspects, the concentration of calcium ion is about 0.7 mM. In some aspects, the concentration of calcium ion is about 0.8 mM. In some aspects, the concentration of calcium ion is about 0.9 mM. In some aspects, the concentration of calcium ion is about 1.0 mM. In some aspects, the concentration of calcium ion is about 1.1 mM. In some aspects, the concentration of calcium ion is about 1.2 mM. In some aspects, the concentration of calcium ion is about 1.3 mM. In some aspects, the concentration of calcium ion is about 1.4 mM. In some aspects, the concentration of calcium ion is about 1.5 mM. In some aspects, the concentration of calcium ion is about 1.6 mM. In some aspects, the concentration of calcium ion is about 1.7 mM. In some aspects, the concentration of calcium ion is about 1.8 mM. Cytokines [0293] In some aspects, the medium useful for the present disclosure (e.g., metabolic reprogramming medium) comprises a cytokine. Accordingly, some aspects of the present disclosure are related to methods of culturing immune cells (e.g., contacting T cells and/or NK cells with PCS and modifying the cells to exhibit a reduced expression of a NR4A family member) in a medium comprising (i) potassium ion at a concentration higher than 5 mM and (ii) a cytokine. In some aspects, the medium is hypotonic. In some aspects, the medium is isotonic. In some aspects, the medium is hypertonic. In some aspects, a medium useful for the present disclosure comprises (a) potassium ion at a concentration higher than 5 mM, (b) sodium ion (e.g., NaCl), and (c) a cytokine. In some aspects, a medium that can be used with the present disclosure comprises (a) potassium ion at a concentration higher than 5 mM, (b) a saccharide, and (c) a cytokine. In some aspects, a medium useful for the present disclosure comprises (a) potassium ion at a concentration higher than 5 mM, (b) a calcium ion, and (c) a cytokine. In some aspects, a medium useful for the present disclosure comprises (a) potassium ion at a concentration higher than 5 mM, (b) sodium ion (e.g., NaCl), (c) a saccharide, (d) a calcium ion, and (e) a cytokine. [0294] In some aspects, the cytokine is selected from IL-2, IL-7, IL-15, IL-21, or any combination thereof. In some aspects, the medium provided herein (e.g., metabolic reprogramming medium) does not comprise IL-2. In some aspects, the medium comprises IL-2 and IL-21. In some aspects, the medium comprises IL-2, IL-21, and IL-15. The cytokine can be added to the medium at any point. In some aspects, the cytokine is added to the medium before the immune cells, e.g., T cells and/or NK cells, are added to the medium. [0295] In some aspects, the medium useful for the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-2. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-2. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-2. In some aspects, the medium of the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-7. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-7. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-7. In some aspects, the medium that can be used with the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-15. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-15. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-15. In some aspects, the medium useful for the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-21. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-21. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-21. [0296] In some aspects, the medium provided herein comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-2, wherein the medium does not comprise IL- 7. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-2, wherein the medium does not comprise IL-7. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-2, wherein the medium does not comprise IL-7. In some aspects, the medium useful for the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-2, wherein the medium does not comprise IL-15. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-2, wherein the medium does not comprise IL-15. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-2, wherein the medium does not comprise IL-15. In some aspects, the medium provided herein comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-2, wherein the medium does not comprise IL-7 and IL-15. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-2, wherein the medium does not comprise IL-7 and IL-15. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-2, wherein the medium does not comprise IL-7 and IL- 15. In some aspects, the medium useful for the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-2 and IL-21. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-2 and IL-21. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL- 2 and IL-21. In some aspects, the medium that can be used with the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-7 and IL-21. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-7 and IL-21. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-7 and IL-21. In some aspects, the medium that can be used with the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) IL-15 and IL-21. In some aspects, the medium comprises (i) more than about 40 mM of potassium ion and (ii) IL-15 and IL-21. In some aspects, the medium comprises (i) at least about 50 mM of potassium ion and (ii) IL-15 and IL-21. In some aspects, the medium useful for the present disclosure (e.g., comprising potassium ion at a concentration higher than 5 mM) is hypotonic. In some aspects, the medium is isotonic. In some aspects, the medium provided herein (e.g., comprising potassium at a concentration higher than 5 mM) further comprises a sodium ion (e.g., NaCl), wherein the total concentration of potassium ion and sodium ion (e.g., NaCl) is from 110 mM to 140 mM. [0297] In some aspects, the medium described herein (e.g., comprising potassium ion at a concentration greater than 5 mM) comprises between about 50 IU/mL to about 500 IU/mL of IL-2. In some aspects, the medium comprises about 50 IU/mL, about 60 IU/mL, about 70 IU/mL, about 80 IU/mL, about 90 IU/mL, about 100 IU/mL, about 125 IU/mL, about 150 IU/mL, about 175 IU/mL, about 200 IU/mL, about 225 IU/mL, about 250 IU/mL, about 275 IU/mL, about 300 IU/mL, about 350 IU/mL, about 400 IU/mL, about 450 IU/mL, or about 500 IU/mL of IL-2. [0298] Therefore, in some aspects, the medium that can be used with the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 50 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 60 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 70 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 80 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 90 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 100 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 125 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 150 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 175 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 200 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 225 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 250 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 275 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 300 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 350 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 400 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 450 IU/mL of IL-2. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 500 IU/mL of IL-2. In some aspects, the medium comprising potassium ion and IL-2 further comprises NaCl at a concentration less than about 115 nM. [0299] In some aspects, the medium comprises at least about 0.1 ng/mL IL-2. In some aspects, the medium comprises from about 0.1 ng/mL to about 20 ng/mL, about 1 ng/mL to about 20 ng/mL, about 1 ng/mL to about 15 ng/mL, about 1 ng/mL to about 14 ng/mL, about 1 ng/mL to about 13 ng/mL, about 1 ng/mL to about 12 ng/mL, about 1 ng/mL to about 11 ng/mL, about 1 ng/mL to about 10 ng/mL, about 1 ng/mL to about 9 ng/mL, about 1 ng/mL to about 8 ng/mL, about 1 ng/mL to about 7 ng/mL, about 1 ng/mL to about 6 ng/mL, about 1 ng/mL to about 5 ng/mL, about 1 ng/mL to about 4 ng/mL, about 1 ng/mL to about 3 ng/mL, about 1 ng/mL to about 2 ng/mL, about 5 ng/mL to about 15 ng/mL, about 5 ng/mL to about 10 ng/mL, about 10 ng/mL to about 20 ng/mL, about 10 ng/mL to about 15 ng/mL, or about 15 ng/mL to about 20 ng/mL IL-2. [0300] In some aspects, the medium comprises at least about 0.1 ng/mL, at least about 0.5 ng/mL, at least about 1 ng/mL, at least about 2 ng/mL, at least about 3 ng/mL, at least about 4 ng/mL, at least about 5 ng/mL, at least about 6 ng/mL, at least about 7 ng/mL, at least about 8 ng/mL, at least about 9 ng/mL, at least about 10 ng/mL, at least about 11 ng/mL, at least about 12 ng/mL, at least about 13 ng/mL, at least about 14 ng/mL, at least about 15 ng/mL, at least about 16 ng/mL, at least about 17 ng/mL, at least about 18 ng/mL, at least about 19 ng/mL, or at least about 20 ng/mL IL-2. In some aspects, the medium comprises at least about 1.0 ng/mL IL-2. In some aspects, the medium comprises at least about 2.0 ng/mL IL-2. In some aspects, the medium comprises at least about 3.0 ng/mL IL-2. In some aspects, the medium comprises at least about 4.0 ng/mL IL-2. In some aspects, the medium comprises at least about 5.0 ng/mL IL-2. In some aspects, the medium comprises at least about 6.0 ng/mL IL-2. In some aspects, the medium comprises at least about 7.0 ng/mL IL- 2. In some aspects, the medium comprises at least about 8.0 ng/mL IL-2. In some aspects, the medium comprises at least about 9.0 ng/mL IL-2. In some aspects, the medium comprises at least about 10 ng/mL IL-2. [0301] In some aspects, the medium comprises at least about 0.1 ng/mL IL-2. In some aspects, the medium comprises from about 50 ng/mL to about 600 ng/mL, about 50 ng/mL to about 500 ng/mL, about 50 ng/mL to about 450 ng/mL, about 50 ng/mL to about 400 ng/mL, about 50 ng/mL to about 350 ng/mL, about 50 ng/mL to about 300 ng/mL, about 100 ng/mL to about 600 ng/mL, about 100 ng/mL to about 500 ng/mL, about 100 ng/mL to about 450 ng/mL, about 100 ng/mL to about 400 ng/mL, about 100 ng/mL to about 350 ng/mL, about 100 ng/mL to about 300 ng/mL, about 200 ng/mL to about 500 ng/mL, about 200 ng/mL to about 450 ng/mL, about 200 ng/mL to about 400 ng/mL, about 200 ng/mL to about 350 ng/mL, about 200 ng/mL to about 300 ng/mL, about 250 ng/mL to about 350 ng/mL, about 300 ng/mL to about 600 ng/mL, about 300 ng/mL to about 500 ng/mL, about 300 ng/mL to about 450 ng/mL, about 300 ng/mL to about 400 ng/mL, about 300 ng/mL to about 350 ng/mL, about 250 ng/mL to about 300 ng/mL, or about 275 ng/mL to about 325 ng/mL IL-2. [0302] In some aspects, the medium comprises at least about 50 ng/mL, at least about 60 ng/mL, at least about 70 ng/mL, at least about 80 ng/mL, at least about 90 ng/mL, at least about 100 ng/mL, at least about 110 ng/mL, at least about 120 ng/mL, at least about 130 ng/mL, at least about 140 ng/mL, at least about 150 ng/mL, at least about 160 ng/mL, at least about 170 ng/mL, at least about 180 ng/mL, at least about 190 ng/mL, at least about 200 ng/mL, at least about 210 ng/mL, at least about 220 ng/mL, at least about 230 ng/mL, at least about 240 ng/mL, at least about 250 ng/mL, at least about 260 ng/mL, at least about 270 ng/mL, at least about 280 ng/mL, at least about 290 ng/mL, at least about 300 ng/mL, at least about 310 ng/mL, at least about 320 ng/mL, at least about 330 ng/mL, at least about 340 ng/mL, at least about 350 ng/mL, at least about 360 ng/mL, at least about 370 ng/mL, at least about 380 ng/mL, at least about 390 ng/mL, at least about 400 ng/mL, at least about 410 ng/mL, at least about 420 ng/mL, at least about 430 ng/mL, at least about 440 ng/mL, at least about 450 ng/mL, at least about 460 ng/mL, at least about 470 ng/mL, at least about 480 ng/mL, at least about 490 ng/mL, at least about 500 ng/mL, at least about 510 ng/mL, at least about 520 ng/mL, at least about 530 ng/mL, at least about 540 ng/mL, at least about 550 ng/mL, at least about 560 ng/mL, at least about 570 ng/mL, at least about 580 ng/mL, at least about 590 ng/mL, or at least about 600 ng/mL IL-2. In some aspects, the medium comprises at least about 50 ng/mL IL-2. In some aspects, the medium comprises at least about 60 ng/mL IL-2. In some aspects, the medium comprises at least about 70 ng/mL IL- 2. In some aspects, the medium comprises at least about 73.6 ng/mL IL-2. In some aspects, the medium comprises at least about 75 ng/mL IL-2. In some aspects, the medium comprises at least about 80 ng/mL IL-2. In some aspects, the medium comprises at least about 90 ng/mL IL-2. In some aspects, the medium comprises at least about 100 ng/mL IL- 2. In some aspects, the medium comprises at least about 200 ng/mL IL-2. In some aspects, the medium comprises at least about 300 ng/mL IL-2. In some aspects, the medium comprises at least about 400 ng/mL IL-2. In some aspects, the medium comprises at least about 500 ng/mL IL-2. In some aspects, the medium comprises at least about 600 ng/mL IL-2. [0303] In some aspects, the medium described herein (e.g., comprising potassium ion at a concentration greater than 5 mM) comprises between about 50 IU/mL to about 500 IU/mL of IL-21. In some aspects, the culture medium comprises about 50 IU/mL, about 60 IU/mL, about 70 IU/mL, about 80 IU/mL, about 90 IU/mL, about 100 IU/mL, about 125 IU/mL, about 150 IU/mL, about 175 IU/mL, about 200 IU/mL, about 225 IU/mL, about 250 IU/mL, about 275 IU/mL, about 300 IU/mL, about 350 IU/mL, about 400 IU/mL, about 450 IU/mL, or about 500 IU/mL of IL-21. [0304] In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 50 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 60 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 70 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 80 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 90 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 100 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 125 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 150 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 175 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 200 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 225 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 250 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 275 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 300 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 350 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 400 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 450 IU/mL of IL-21. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 500 IU/mL of IL-21. In some aspects, the medium comprising potassium ion and IL-21 further comprises NaCl at a concentration less than about 115 nM. [0305] In some aspects, the medium comprises at least about 0.1 ng/mL IL-21. In some aspects, the medium comprises from about 0.1 ng/mL to about 20 ng/mL, about 1 ng/mL to about 20 ng/mL, about 1 ng/mL to about 15 ng/mL, about 1 ng/mL to about 14 ng/mL, about 1 ng/mL to about 13 ng/mL, about 1 ng/mL to about 12 ng/mL, about 1 ng/mL to about 11 ng/mL, about 1 ng/mL to about 10 ng/mL, about 1 ng/mL to about 9 ng/mL, about 1 ng/mL to about 8 ng/mL, about 1 ng/mL to about 7 ng/mL, about 1 ng/mL to about 6 ng/mL, about 1 ng/mL to about 5 ng/mL, about 1 ng/mL to about 4 ng/mL, about 1 ng/mL to about 3 ng/mL, about 1 ng/mL to about 2 ng/mL, about 5 ng/mL to about 15 ng/mL, about 5 ng/mL to about 10 ng/mL, about 10 ng/mL to about 20 ng/mL, about 10 ng/mL to about 15 ng/mL, or about 15 ng/mL to about 20 ng/mL IL-21. [0306] In some aspects, the medium comprises at least about 0.1 ng/mL, at least about 0.5 ng/mL, at least about 1 ng/mL, at least about 2 ng/mL, at least about 3 ng/mL, at least about 4 ng/mL, at least about 5 ng/mL, at least about 6 ng/mL, at least about 7 ng/mL, at least about 8 ng/mL, at least about 9 ng/mL, at least about 10 ng/mL, at least about 11 ng/mL, at least about 12 ng/mL, at least about 13 ng/mL, at least about 14 ng/mL, at least about 15 ng/mL, at least about 16 ng/mL, at least about 17 ng/mL, at least about 18 ng/mL, at least about 19 ng/mL, or at least about 20 ng/mL IL-21. In some aspects, the medium comprises at least about 1.0 ng/mL IL-21. In some aspects, the medium comprises at least about 2.0 ng/mL IL-21. In some aspects, the medium comprises at least about 3.0 ng/mL IL-21. In some aspects, the medium comprises at least about 4.0 ng/mL IL-21. In some aspects, the medium comprises at least about 5.0 ng/mL IL-21. In some aspects, the medium comprises at least about 6.0 ng/mL IL-21. In some aspects, the medium comprises at least about 7.0 ng/mL IL-21. In some aspects, the medium comprises at least about 8.0 ng/mL IL-21. In some aspects, the medium comprises at least about 9.0 ng/mL IL-21. In some aspects, the medium comprises at least about 10 ng/mL IL-21. In some aspects, the medium comprises at least about 10 ng/mL IL-21. In some aspects, the medium comprises at least about 15 ng/mL IL-21. In some aspects, the medium comprises at least about 20 ng/mL IL-21. In some aspects, the medium comprises at least about 25 ng/mL IL-21. In some aspects, the medium comprises at least about 30 ng/mL IL-21. In some aspects, the medium comprises at least about 35 ng/mL IL-21. [0307] In some aspects, the medium described herein (e.g., comprising potassium ion at a concentration greater than 5 mM) comprises between about 500 IU/mL to about 1,500 IU/mL of IL-7. In some aspects, the culture medium comprises about 500 IU/mL, about 550 IU/mL, about 600 IU/mL, about 650 IU/mL, about 700 IU/mL, about 750 IU/mL, about 800 IU/mL, about 850 IU/mL, about 900 IU/mL, about 950 IU/mL, about 1,000 IU/mL, about 1,050 IU/mL, about 1,100 IU/mL, about 1,150 IU/mL, about 1,200 IU/mL, about 1,250 IU/mL, about 1,300 IU/mL, about 1,350 IU/mL, about 1,400 IU/mL, about 1,450 IU/mL, or about 1,500 IU/mL of IL-7. [0308] In some aspects, the medium useful for the present disclosure comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 500 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 550 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 600 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 650 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 700 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 750 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 800 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 850 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 900 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 950 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,000 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,050 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,100 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,150 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,200 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,250 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,300 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,350 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,400 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,450 IU/mL of IL-7. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 1,500 IU/mL of IL-7. In some aspects, the medium comprising potassium ion and IL-7 further comprises NaCl at a concentration less than about 115 nM. [0309] In some aspects, the medium comprises at least about 0.1 ng/mL IL-7. In some aspects, the medium comprises from about 0.1 ng/mL to about 20 ng/mL, about 1 ng/mL to about 20 ng/mL, about 1 ng/mL to about 15 ng/mL, about 1 ng/mL to about 14 ng/mL, about 1 ng/mL to about 13 ng/mL, about 1 ng/mL to about 12 ng/mL, about 1 ng/mL to about 11 ng/mL, about 1 ng/mL to about 10 ng/mL, about 1 ng/mL to about 9 ng/mL, about 1 ng/mL to about 8 ng/mL, about 1 ng/mL to about 7 ng/mL, about 1 ng/mL to about 6 ng/mL, about 1 ng/mL to about 5 ng/mL, about 1 ng/mL to about 4 ng/mL, about 1 ng/mL to about 3 ng/mL, about 1 ng/mL to about 2 ng/mL, about 5 ng/mL to about 15 ng/mL, about 5 ng/mL to about 10 ng/mL, about 10 ng/mL to about 20 ng/mL, about 10 ng/mL to about 15 ng/mL, or about 15 ng/mL to about 20 ng/mL IL-7. [0310] In some aspects, the medium comprises at least about 0.1 ng/mL, at least about 0.5 ng/mL, at least about 1 ng/mL, at least about 2 ng/mL, at least about 3 ng/mL, at least about 4 ng/mL, at least about 5 ng/mL, at least about 6 ng/mL, at least about 7 ng/mL, at least about 8 ng/mL, at least about 9 ng/mL, at least about 10 ng/mL, at least about 11 ng/mL, at least about 12 ng/mL, at least about 13 ng/mL, at least about 14 ng/mL, at least about 15 ng/mL, at least about 16 ng/mL, at least about 17 ng/mL, at least about 18 ng/mL, at least about 19 ng/mL, or at least about 20 ng/mL IL-7. In some aspects, the medium comprises at least about 1.0 ng/mL IL-7. In some aspects, the medium comprises at least about 2.0 ng/mL IL-7. In some aspects, the medium comprises at least about 3.0 ng/mL IL-7. In some aspects, the medium comprises at least about 4.0 ng/mL IL-7. In some aspects, the medium comprises at least about 5.0 ng/mL IL-7. In some aspects, the medium comprises at least about 6.0 ng/mL IL-7. In some aspects, the medium comprises at least about 7.0 ng/mL IL- 7. In some aspects, the medium comprises at least about 8.0 ng/mL IL-7. In some aspects, the medium comprises at least about 9.0 ng/mL IL-7. In some aspects, the medium comprises at least about 10 ng/mL IL-7. [0311] In some aspects, the medium described herein (e.g., comprising potassium ion at a concentration greater than 5 mM) comprises between about 50 IU/mL to about 500 IU/mL of IL-15. In some aspects, the culture medium comprises about 50 IU/mL, about 60 IU/mL, about 70 IU/mL, about 80 IU/mL, about 90 IU/mL, about 100 IU/mL, about 125 IU/mL, about 150 IU/mL, about 175 IU/mL, about 200 IU/mL, about 225 IU/mL, about 250 IU/mL, about 275 IU/mL, about 300 IU/mL, about 350 IU/mL, about 400 IU/mL, about 450 IU/mL, or about 500 IU/mL of IL-15. [0312] Therefore, in some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 50 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 60 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 70 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 80 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 90 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 100 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 125 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 150 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 175 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 200 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 225 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 250 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 275 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 300 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 350 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 400 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 450 IU/mL of IL-15. In some aspects, the medium comprises (i) potassium ion at a concentration higher than 5 mM and (ii) about 500 IU/mL of IL-15. In some aspects, the medium comprising potassium ion and IL-15 further comprises NaCl at a concentration less than about 115 nM. [0313] In some aspects, the medium comprises at least about 0.1 ng/mL IL-15. In some aspects, the medium comprises from about 0.1 ng/mL to about 20 ng/mL, about 1 ng/mL to about 20 ng/mL, about 1 ng/mL to about 15 ng/mL, about 1 ng/mL to about 14 ng/mL, about 1 ng/mL to about 13 ng/mL, about 1 ng/mL to about 12 ng/mL, about 1 ng/mL to about 11 ng/mL, about 1 ng/mL to about 10 ng/mL, about 1 ng/mL to about 9 ng/mL, about 1 ng/mL to about 8 ng/mL, about 1 ng/mL to about 7 ng/mL, about 1 ng/mL to about 6 ng/mL, about 1 ng/mL to about 5 ng/mL, about 1 ng/mL to about 4 ng/mL, about 1 ng/mL to about 3 ng/mL, about 1 ng/mL to about 2 ng/mL, about 5 ng/mL to about 15 ng/mL, about 5 ng/mL to about 10 ng/mL, about 10 ng/mL to about 20 ng/mL, about 10 ng/mL to about 15 ng/mL, or about 15 ng/mL to about 20 ng/mL IL-15. [0314] In some aspects, the medium comprises at least about 0.1 ng/mL, at least about 0.2 ng/mL, at least about 0.3 ng/mL, at least about 0.4 ng/mL, at least about 0.5 ng/mL, at least about 0.6 ng/mL, at least about 0.7 ng/mL, at least about 0.8 ng/mL, at least about 0.9 ng/mL, at least about 1 ng/mL, at least about 2 ng/mL, at least about 3 ng/mL, at least about 4 ng/mL, at least about 5 ng/mL, at least about 6 ng/mL, at least about 7 ng/mL, at least about 8 ng/mL, at least about 9 ng/mL, at least about 10 ng/mL, at least about 11 ng/mL, at least about 12 ng/mL, at least about 13 ng/mL, at least about 14 ng/mL, at least about 15 ng/mL, at least about 16 ng/mL, at least about 17 ng/mL, at least about 18 ng/mL, at least about 19 ng/mL, or at least about 20 ng/mL IL-15. In some aspects, the medium comprises at least about 1.0 ng/mL IL-15. In some aspects, the medium comprises at least about 2.0 ng/mL IL-15. In some aspects, the medium comprises at least about 3.0 ng/mL IL-15. In some aspects, the medium comprises at least about 4.0 ng/mL IL-15. In some aspects, the medium comprises at least about 5.0 ng/mL IL-15. In some aspects, the medium comprises at least about 6.0 ng/mL IL-15. In some aspects, the medium comprises at least about 7.0 ng/mL IL-15. In some aspects, the medium comprises at least about 8.0 ng/mL IL-15. In some aspects, the medium comprises at least about 9.0 ng/mL IL-15. In some aspects, the medium comprises at least about 10 ng/mL IL-15. In some aspects, the medium further comprises NaCl, wherein the total concentration of potassium ion and NaCl is from 110 mM to 140 mM. [0315] In some aspects, the medium comprises at least about 30 mM to at least about 100 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises more than 40 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 45 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 50 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 55 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 60 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 65 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 70 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 75 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 80 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 85 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises at least about 90 mM potassium ion, about 300 ng/mL IL-2, and about 0.4 ng/mL IL-15. In some aspects, the medium comprises (i) at least about 70 mM potassium ion, (ii) about 60 mM NaCl, (iii) about 1.4 mM calcium, (iv) about 16 mM glucose, (v) about 300 ng/mL IL-2, and (vi) about 0.4 ng/mL IL-15. [0316] In some aspects, the medium does not comprise a cytokine (e.g., IL-2, IL-7, and/or IL-15). As further described elsewhere in the present disclosure, in some aspects, the medium does not comprise a cytokine (e.g., IL-2, IL-7, and/or IL-15), where the medium is used to activate immune cells with PCS. As is apparent from the present disclosure, in some aspects, the editing with a NR4A family member targeting gene editing tool occurs in MRM that comprises one or more cytokines. In some aspects, the transducing with a ligand-binding protein can occur in MRM that comprises one or more cytokines. In some aspects, both the editing and the transducing occur in MRM that comprises one or more cytokines. Accordingly, in some aspects, activating the immune cells with PCS occurs in MRM that does not comprise a cytokine, whereas the transducing and/or editing occurs in MRM that comprises one or more cytokines (e.g., IL-2, IL-7, and/or IL-15). Basal Media [0317] In some aspects, the basal medium (from which the media useful for the present disclosure can be derived from) comprises a balanced salt solution (e.g., PBS, DPBS, HBSS, EBSS), Dulbecco's Modified Eagle's Medium (DMEM), Minimal Essential Medium (MEM), Basal Medium Eagle (BME), F-10, F-12, RPMI 1640, Glasgow Minimal Essential Medium (GMEM), alpha Minimal Essential Medium (alpha MEM), Iscove's Modified Dulbecco's Medium (IMDM), M199, OPTMIZER™ CTS™ T-Cell Expansion Basal Medium (ThermoFisher), OPTMIZER™ Complete, IMMUNOCULT™ XF (STEMCELL™ Technologies), IMMUNOCULT™, AIM V, TEXMACS™ medium, PRIME-XV ^® T cell CDM, X-VIVO ^TM 15 (Lonza), TRANSACT™ TIL expansion medium, or any combination thereof. In some aspects, the basal medium comprises PRIME-XV T cell CDM. In some aspects, the basal medium comprises OPTMIZER ^TM . In some aspects, the basal medium comprises OPTMIZER ^TM Pro. In some aspects, the basal medium is serum free. In some aspects, the basal medium further comprises immune cell serum replacement (ICSR). For example, in some aspects, the basal medium comprises OPTMIZER™ Complete supplemented with ICSR, AIM V supplemented with ICSR, IMMUNOCULT™ XF supplemented with ICSR, RPMI supplemented with ICSR, TEXMACS™ supplemented with ICSR, or any combination thereof. In some aspects, the basal medium comprises OPTMIZER™ complete. [0318] In some aspects, the medium useful for the present disclosure (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises about 2.5% serum supplement (CTS™ Immune Cell SR, Thermo Fisher), 2 mM L-glutamine, 2 mM L- glutamax, MEM Non-Essential Amino Acids Solution, Pen-strep, 20 µg/ml fungin™, sodium pyruvate, or any combination thereof. In some aspects, the medium further comprises O-Acetyl-L-carnitine hydrochloride. In some aspects, the medium further comprises a kinase inhibitor. [0319] In some aspects, the medium provided herein (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises a CD3 agonist. In some aspects, the CD3 agonist is an anti-CD3 antibody. In some aspects, the anti-CD3 antibody comprises OKT-3. [0320] In some aspects, the medium useful for the present disclosure (e.g., comprising potassium ion at a concentration higher than 5 mM) further comprises a CD28 agonist. In some aspects, the CD28 agonist is an anti-CD28 antibody. In some aspects, the medium further comprises a CD27 ligand (CD27L). In some aspects, the medium further comprises a 4-1BB ligand (4-1BBL). [0321] In some aspects, the present disclosure includes a cell culture comprising the medium disclosed herein (e.g., comprising potassium ion at a concentration higher than 5 mM), a cell bag comprising the medium disclosed herein, or a bioreactor comprising the medium disclosed herein. Programmable Cell-Signaling Scaffolds (PCS) [0322] In some aspects, the methods described herein comprise contacting human immune cells with programmable cell-signaling scaffolds (PCS) in a metabolic reprogramming medium (MRM) as described herein. Unless indicated otherwise, the term "scaffold" (or equivalent thereof) are used interchangeably with "PCS" (or equivalent thereof). Non- limiting examples of programmable cell-signaling scaffolds (PCS) are described in WO2018/013797 and Cheung et al. (Nature Biotechnology 36(2): 160-169 (2018), the contents of which are incorporated by reference. As further described herein, in some aspects, contacting human immune cells with PCS in MRM comprises a single step in which the human immune cells, PCS, and MRM are all cultured together. Where the immune cells are contacted with PCS in MRM as a single step, in some aspects, the MRM does not comprise a cytokine. Accordingly, in some aspects, the methods described herein comprises contacting immune cells with a PCS in a medium comprising potassium ion at a concentration higher than 5 mM (i.e., MRM), wherein the medium does not comprise a cytokine. In some aspects, the immune cells are contacted with a PCS in MRM, where the MRM does not comprise IL-2. In some aspects, the immune cells are contacted with a PCS in MRM, where the MRM does not comprise IL-7. In some aspects, the immune cells are contacted with a PCS in MRM, where the MRM does not comprise IL-15. In some aspects, the immune cells are contacted with a PCS in MRM, wherein the MRM does not comprise one or more of IL-2, IL-7, and IL-15. In some aspects, the immune cells are contacted with a PCS in MRM, where the MRM does not comprise each of IL-2, IL-7, and IL-15. [0323] In some aspects, contacting the human immune cells with PCS in MRM comprises multiple steps. For example, in some aspects, the methods provided herein comprises at least two steps, wherein the first step comprises contacting the immune cells with PCS and the second step comprises culturing the immune cells in MRM. Unless indicated otherwise, in some aspects, the first step (i.e., contacting the immune cells with PCS) occurs prior to the second step (i.e., culturing the immune cells in MRM). In some aspects, the first step (i.e., contacting the immune cells with PCS) occurs after the second step (i.e., culturing the immune cells in MRM). Where the methods comprise at least a first step and second step, in some aspects, the first and second steps are independent of each other. For example, in some aspects, the first step (i.e., contacting the immune cells with PCS) does not occur in the same MRM used for the second step (i.e., culturing the immune cells in MRM). [0324] To help further illustrate, in some aspects, the methods provided herein comprise a first step and a second step, wherein the first step comprises contacting the immune cells with PCS in a first MRM, wherein the second step comprises culturing the immune cells in a second MRM, and wherein the first MRM and the second MRM are not the same. For example, in some aspects, the first MRM differs from the second MRM in that the first MRM does not comprise a cytokine. In some aspects, the first MRM differs from the second MRM in that the first MRM does not comprise IL-2. In some aspects, the first MRM differs from the second MRM in that the first MRM does not comprise IL-7. In some aspects, the first MRM differs from the second MRM in that the first MRM does not comprise IL-15. In some aspects, the first MRM differs from the second MRM in that the first MRM does not comprise one or more of IL-2, IL-7, and IL-15. In some aspects, the first MRM differs from the second MRM in that the first MRM does not comprise each of IL-2, IL-7, and IL- 15. [0325] In some aspects, the methods provided herein comprise a first step and a second step, wherein the first step comprises contacting the immune cells with PCS in a non-MRM (i.e., medium that does not comprise potassium ion at a concentration higher than 5 mM), and wherein the second step comprises culturing the immune cells in MRM. As is evident from at least the above disclosure, in some aspects, the non-MRM does not comprise a cytokine. In some aspects, the non-MRM does not comprise IL-2. In some aspects, the non- MRM does not comprise IL-7. In some aspects, the non-MRM does not comprise IL-15. In some aspects, the non-MRM does not comprise one or more of IL-2, IL-7, and IL-15. In some aspects, the non-MRM does not comprise each of IL-2, IL-7, and IL-15. [0326] In some aspects, the programmable cell-signaling scaffolds (PCS) of the disclosure comprise a first layer comprising high surface area mesoporous silica micro rods (MSRs); a second layer comprising lipids coating the first layer; and a plurality of functional molecules loaded onto the scaffold. In some aspects, the second layer comprises a continugous, fluid-supported lipid bilayer (SLB). In some aspects, the scaffolds are biodegradable. [0327] The scaffolds described herein are capable of mimicking functions commonly associated with antigen-presenting cells (APCs), which allows the scaffolds to elicit various functions on target cells, e.g., eliciting effector functions of T-cells. As contemplated herein, the scaffolds mediate these effects via either direct or indirect interactions between the cell surface molecules residing in target cells (e.g., T cells) and the various functional molecules presented by the scaffolds. In some aspects, the scaffold modulates survival of target cells (e.g., T cells), growth of targeted cells (e.g., T cells), and/or function of target cells (e.g., T cells) through the physical or chemical characteristics of a scaffold itself. [0328] In some aspects, the scaffold composition is modified to comprise one or more surface cues and/or soluble cues (e.g., cell signaling molecules). Accordingly, in some aspects, a PCS provided herein comprises (i) a MSR, (ii) a SLB layered on the MSR, and (iii) a plurality of surface cues. In some aspects, a PCS can further comprise a plurality of soluble cues. Non-limiting examples of surface cues and soluble cues are provided elsewhere in the present disclosure. [0329] In some aspects, the surface cues and/or soluble cues act to mediate various effector functions. Non-limiting examples of effector functions that can be affected by the surface cues and/or soluble cues include activation, division, promoting differentiation, growth, expansion, survival, increase yield, reprogramming, anergy, quiescence, senescence, apoptosis, death of target cells, or any combination thereof. In some aspects, the one or more surface cues and/or soluble cues act to increase “stemness.” In some aspects, cells, e.g., immune cells, contacted with the PCS described herein in the media described herein exhibit superior growth and function compared to cells, e.g., immune cells, contacted with other substrate platforms, such as magnetic beads, e.g., DYNABEADS™, or commercial particles, e.g., TRANSACT™ (Miltenyi Biotech). [0330] In some aspects, the methods described herein comprise contacting human immune cells with PCS in a metabolic reprogramming medium, and further contacting the immune cells with one or more stimulatory molecules, cytokines, and/or other co-factors. In some aspects, the one or more stimulatory molecules, cytokines, and/or other co-factors are present in the medium. In some aspects, the one or more stimulatory molecules, cytokines, and/or other co-factors are present in the scaffold. In some aspects, non-targeted cells (e.g., cells other than T cells), which have otherwise infiltrated a scaffold, are rejected or removed using negative selection agents, cues, or through passive non-stimulation. Components of PCS [0331] In some aspects, the specific components of a scaffold (i.e., PCS) are modulated. The permeability of a scaffold composition can be regulated, for example, by selecting or engineering a material for greater or smaller pore size, density, polymer cross-linking, stiffness, toughness, ductility, or elasticity. A scaffold composition can contain physical channels or paths through which targeted cells interact with a scaffold and/or move into a specific compartment or region of a scaffold. As needed, to facilitate compartmentalization, a scaffold composition can be optionally organized into compartments or layers, each with a different permeability, so that cells can be sorted or filtered to allow access to only a certain sub-population of cells. Sequestration of target cell populations in the scaffold can also be regulated by the degradation, dehydration, re-hydration, oxygenation, chemical alteration, pH alteration, ongoing self-assembly of the scaffold composition, or any combination thereof. Further, the functional molecules of a scaffold can vary in type and relative abundance to elicit specific interactions with desired cells. [0332] In some aspects, the PCS comprises (i) a base layer comprising high surface area mesoporous silica micro-rods (MSR); (ii) a continuous, fluid-supported lipid bilayer (SLB) layered on the MSR base layer; (iii) a plurality of surface cues loaded onto the scaffold; and/or (iv) a plurality of soluble cues loaded onto the scaffold. In some aspects, a PCS useful for the present disclosure comprises (i) a base layer comprising high surface area mesoporous silica micro-rods (MSR); (ii) a continuous, fluid-supported lipid bilayer (SLB) layered on the MSR base layer; and (iii) a plurality of surface cues. In some aspects, the PCS further comprises a plurality of soluble cues. Mesoporous silica [0333] In some aspects, the scaffold comprises mesoporous silica. Mesoporous silica is a porous body with hexagonal close-packed, cylinder-shaped, uniform pores. In some aspects, the mesoporous silica is synthesized by using a rod-like micelle of a surfactant as a template, which is formed in water by dissolving and hydrolyzing a silica source such as alkoxysilane, sodium silicate solution, kanemite, silica fine particle in water or alcohol in the presence of acid or basic catalyst. See, US Pub. No. 2015-0072009 and Hoffmann et al., Angewandte Chemie International Edition, 45, 3216-3251, 2006, each of which is incorporated by reference herein in its entirety. Many kinds of surfactants can be used in the synthesis of the mesoporous silica, including, but not limited to, cationic, anionic, and nonionic surfactants. In some aspects, the surfactant is an alkyl trimethylammonium salt of cationic surfactant. An alkyl trimethylammonium salt of cationic surfactant can yield a mesoporous silica having the increased specific surface area and pore volume. See U.S. Publication No.2013/0052117 and Katiyar et al. (Journal of Chromatography 1122 (1-2): 13-20), each of which is incorporated by reference herein in its entirety. The terms "mesoscale," "mesopore," "mesoporous" and the like, as used herein, refer to structures having feature sizes in the range of about 1 nm to about 60 nm. In some aspects, the mesoporous material includes pores having a diameter in the range of about 1 nm to about 50 nm. In some aspects, the mesoporous material includes pores having a diameter in the range of about 5 nm to about 60 nm. In some aspects, the mesoporous material includes pores having a diameter in the range of about 2 nm to about 50 nm. In some aspects, the pores are orderly distributed. In some aspects, the pores are randomly distributed. [0334] The mesoporous silica used in scaffolds of the disclosure can be provided in various forms. In some aspects, the scaffolds are provided in a form selected from microspheres, irregular particles, rectangular rods, round nanorods, and any combination thereof. In some aspects, the scaffolds are provided as structured rod-shaped forms (MSR). The particles can have any pre-determined shape. In some aspects, the particles have a spheroid shape. In some aspects, the particles have an ellipsoid shape. In some aspects, the particles have a rod-like shape. In some aspects, the particles have a curved cylindrical shape. Non-limiting examples of methods of assembling mesoporous silica to generate microrods can be found, e.g., in Wang et al, Journal of Nanoparticle Research, 15:1501, 2013, which is incorporated by reference herein in its entirety. In some aspects, mesoporous silica nanoparticles are synthesized by reacting tetraethyl orthosilicate with a template made of micellar rods. The template can then be removed by washing with a solvent adjusted to the proper pH. In this example, after removal of surfactant templates, hydrophilic silica nanoparticles characterized by a uniform, ordered, and connected mesoporosity are prepared with a specific surface area of, for example, about 600 m ² /g to about 1200 m ² /g, particularly about 800 m ² /g to about 1000 m ² /g and especially about 850 m ² /g to about 950 m ² /g. In some aspects, the mesoporous particle is synthesized using a simple sol-gel method or a spray drying method. Tetraethyl orthosilicate can also be used with an additional polymer monomer (e.g., as a template). In some aspects, one or more tetraalkoxy-silanes and one or more (3-cyanopropyl)trialkoxy-silanes are co-condensed to provide the mesoporous silicate particles as rods. See US Publication Nos.2013-0145488, 2012-0264599 and 2012-0256336, each of which is hereby incorporated by reference in its entirety. [0335] The MSR can comprise pores of between about 1-60 nm in diameter, e.g., pores of between about 2-5 nm, about 10-20 nm, about 10-30 nm, about 10-40 nm, about 20-30 nm, about 30-50 nm, about 30-40 nm, about 40-50 nm, about 50-60 nm. In some aspects, the microrods comprise pores of about 1 nm, about 2 nm, about 3 nm, about 4 nm, about 5 nm, about 6 nm, about 7 nm, about 8 nm, about 9 nm, about 10 nm, about 11 nm, about 12 nm, about 13 nm, about 14 nm, about 15 nm, or more in diameter. The pore size can be altered depending on the type of application. [0336] In some aspects, the length of the MSR is in the micrometer range, ranging from about 5 µm to about 500 µm. In some aspects, the microrods comprise a length of about 5- 50 µm, e.g., about 10-20 µm, about 10-30 µm, about 10-40 µm, about 20-30 µm, about 30- 50 µm, about 30-40 µm, or about 40-50 µm. In some aspects, the MSR comprise a length of about 50 µm to about 250 µm, e.g., about 60 µm, about 70 µm, about 80 µm, about 90 µm, about 100 µm, about 120 µm, about 150 µm, about 180 µm, about 200 µm, about 225 µm, or more. For recruitment of cells, MSR compositions having a higher aspect ratio can be employed, e.g., with rods comprising a length of 50 µm to 200 µm, particularly a length of 80 µm to 120 µm, especially a length of about 100 µm or more. [0337] In some aspects, the width of the MSR is in the micrometer range, ranging from about 0.1 µm to about 100 µm. In some aspects, the microrods comprise a width of about 0.1-75 µm, e.g., about 1-55 µm, about 1-50 µm, about 2-50 µm, about 1-40 µm. In some aspects, the MSR comprise a width of about 1.0 µm, about 2 µm, about 5 µm, about 10 µm, about 15 µm, about 20 µm, about 25 µm, about 30 µm, about 35 µm, about 40 µm, about 45 µm, about 50 µm, about 55 µm or more. [0338] In some aspects, the MSR provides a high surface area for attachment and/or binding to target cells, e.g., T-cells. Non-limiting methods of obtaining high surface area mesoporous silicates can be found, for example, in US patent No. 8,883,308 and US Publication No. 2011-0253643, each of which is incorporated by reference herein in its entirety. In some aspects, the high surface area is due to the fibrous morphology of the nanoparticles, which makes it possible to obtain a high concentration of highly dispersed and easily accessible moieties on the surface. In some aspects, the MSR has a surface area of at least about 100 m ² /g, at least 150 m ² /g, at least about 200 m ² /g, at least about 250 m ² /g or at least 300 m ² /g. In some aspects, the MSR has a surface area from about 100 m ² /g to about 1500 m ² /g, including all values or sub-ranges in between, e.g., 50 m ² /g, 100 m ² /g, 200 m ² /g, 300 m ² /g, 400 m ² /g, 500 m ² /g, 600 m ² /g, 700 m ² /g, 800 m ² /g, 100-500 m ² /g, 100- 300 m ² /g, 500-800 m ² /g, 100-700 m ² /g, 200-600 m ² /g, 500-1000 m ² /g or 500-1500 m ² /g. [0339] In some aspects, the MSR is sufficiently porous such that scaffolds sustain antigen presentation and attract and manipulate immune cells. In some aspects, scaffolds contain porous matrices, wherein the pores have a diameter of at least 10 nm. In some aspects, the pores have a diameter of at least 500 µm. In some aspects, the pores have a diameter from 10 nm to 500 µm. In some aspects, the pores have a diameter from 100 nm to 100 µm. In these aspects, the scaffolds comprise mesoporous scaffolds. In some aspects, scaffolds contain porous matrices, wherein the pores are as large or larger than the cell population infiltrating the scaffold. Non-limiting examples of methods of making polymer matrices having desired pore sizes and pore alignments are described, e.g., in US pub. No. 2011/0020216 and US patent No. 6,511,650, each of which is incorporated herein by reference in its entirety. Lipids [0340] The scaffolds of the disclosure (i.e., PCS) comprise a second layer comprising lipids coating the first layer. The term "lipid" generally denotes a heterogeneous group of substances associated with living systems which have the common property of being insoluble in water, can be extracted from cells by organic solvents of low polarity such as chloroform and ether. In some aspects, "lipid" refers to any substance that comprises long, fatty-acid chains, e.g., containing about 10-30 carbon units, e.g., containing 14-23 carbon units, e.g., containing 16-18 carbon units. [0341] In some aspects, the layer comprising lipids is provided as a monolayer. In some aspects, the layer comprising lipids is provided as a bilayer. In some aspects, the lipid bilayer is fluid, wherein individual lipid molecules are able to diffuse within the bilayer. The membrane lipid molecules can be amphipathic. [0342] In some aspects, the layer comprising lipids comprises one or more continuous bilayers, e.g., resembling those found in natural biological membranes such as cellular plasma membranes. In some aspects, the layer comprising lipids is provided in the form of a supported bilayer. In some aspects, the layer comprising lipids is a continuous, fluid- supported liposome. In some aspects, the layer comprising lipids is a continuous, fluid- supported lipid bilayer. As used herein, a supported bilayer is a planar structure sitting on a solid support. In such an arrangement, the upper face of the supported bilayer is exposed, while the inner face of the supported bilayer is in contact with the support. The scaffolds of the disclosure (i.e., PCS) generally are stable and remain largely intact even when subject to high flow rates or vibration. The layer comprising lipids of scaffolds of the disclosure are also amenable to modification, derivatization, and/or chemical conjugation with any chemical and/or biological moiety. [0343] In some aspects, the layer comprising lipids of scaffolds of the disclosure (i.e., PCS) is immobilized on the MSR layer. The lipid layer can be immobilized on the MSR using any method, including, but not limited to, covalent and non-covalent interactions. In some aspects, the layer comprising lipids is adsorbed on the MSR layer. In some aspects, the layer comprising lipids is attached or tethered to the MSR via one or more covalent interactions. Non-limiting examples of methods for attaching lipids to silicates include surface absorption and physical immobilization, e.g., using a phase change to entrap the substance in the scaffold material. In some aspects, the layer comprising lipids is layered onto the MSR layer. For example, a lipid film (containing for example, a solution of DPPC/cholesterol/DSPE-PEG at a molar ratio of 77.5:20:2.5 in chloroform) can be spotted onto the MSR layer and the solvent is evaporated using a rotary evaporator. See Meng et al, ACS Nano, 9 (4), 3540-3557, 2015. In some aspects, the lipid bilayer is prepared by extrusion of hydrated lipid films through a filter with pore size of, e.g., about 100 nm. The filtered lipid films can then be fused with the porous particle cores, for example, by a pipette mixing. [0344] In some aspects, covalent coupling via alkylating or acylating agents are used to provide a stable, structured, and long-term retention of the layer comprising lipids on the MSR layer. In some aspects, the lipid bilayers are reversibly or irreversibly immobilized onto the MSR layer. For example, the MSR layer can be hydrophilic and can be further treated to provide a more hydrophilic surface, e.g., with ammonium hydroxide and hydrogen peroxide. The lipid bilayer can be fused, e.g., using any coupling technique, onto the porous MSR layer to form scaffolds of the disclosure (i.e., PCS). [0345] In some aspects, the layer comprising lipids comprises a phospholipid. Representative examples of such lipids include, but are not limited to, amphoteric liposomes described in U.S. Patent Nos. 9,066,867 and 8,3676,28, each of which is incorporated by reference herein in its entirety. In some aspects, the layer comprising lipids comprises a lipid selected from dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), palmitoyl-oleoylphosphatidylcholine (POPC), dioleoylphosphatidylcholine (DOPC), dioleoyl-phosphatidylethanolamine (DOPE), dimyristoyl- phosphatidylethanolamine (DMPE), dipalmitoyl-phosphatidylethanolamine (DPPE), 1-stearoyl-2-myristoyl-sn- glycero-3-phosphocholine (8:0-14:0 PC) and any combination thereof. In some aspects, the layer comprising lipids comprises palmitoyl-oleoylphosphatidylcholine (POPC). In some aspects, the layer comprising lipids comprises a lipid composition that mimics the lipid composition of a mammalian cell membrane (e.g., a human cell plasma membrane). The lipid compositions of many mammalian cell membranes have been characterized and are readily ascertainable by one of skill in the art (see, e.g., Essaid et al. Biochim. Biophys. Acta 1858(11): 2725- 36 (2016), the entire contents of which are incorporated herein by reference). The composition of the layer comprising lipids can be altered to modify the charge or fluidity of the lipid bilayer. In some aspects, the layer comprising lipids comprises cholesterol. In some aspects, the layer comprising lipids comprises a sphingolipid. In some aspects, the layer comprising lipids comprises a phospholipid. In some aspects, the lipid is a phosphatidylethanolamine, a phosphatidylcholine, a phosphatidylserine, a phosphoinositide a phosphosphingolipid with saturated or unsaturated tails comprising 6- 20 carbons, or a combination thereof. In some aspects, the lipid is a DIYNE PC lipid. In some aspects, the layer comprising lipids comprises a lipid composition that favors the spontaneous partitioning of lipid species into liquid-ordered domains (see, e.g., Wang T-Y et al. Biochemistry 40(43): 13031-40 (2001), which is incorporated by reference herein in its entirety). [0346] In some aspects, the layer comprising lipids is stabilized by compounds such as ionic or non-ionic surfactants. Non-limiting examples of surfactants useful in the compositions disclosed herein include: synthetic phospholipids, their hydrogenated derivatives and mixtures thereof; sphingolipids and glycosphingolipids; saturated or unsaturated fatty acids; fatty alcohols; polyoxyethylene-polyoxypropylene copolymers; ethoxylated fatty acids as well as esters or ethers thereof; dimyristoyl phosphatidyl choline; dimyristoyl phosphatidyl glycerol; or a combination thereof. In some aspects, the surfactant comprises dimyristoyl phosphatidyl glycerol. [0347] In some aspects, once in contact with a cell, a scaffold of the disclosure (i.e., PCS) retains a continuous, fluid architecture for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days, at least 21 days, at least 25 days, at least 30 days, at least 35 days, at least 40 days, at least 50 days, or more. Biodegradable scaffolds [0348] In some aspects, the scaffolds of the disclosure (i.e., PCS) are biodegradable. In some aspects, the scaffold structure substantially degrades when exposed to a biological milieu. In some aspects, the biological milieu comprises a tissue culture condition, e.g., tissue culture media that has been optionally adapted to culture lymphocytes such as T cells. In some aspects, the biological milieu comprises a biological fluid, e.g., blood, lymph, CSF, peritoneal fluid, or the like. In some aspects, the biological milieu is the tissue environment at the site of implant, e.g., blood vessels, lymphatic system, adipose tissue, or the like. [0349] In some aspects, the biodegradable scaffolds are substantially degraded following contact with a biological milieu in vivo over 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 20 days, 30 days, 45 days, 60 days, 90 days, or more. In some aspects, the biodegradable scaffolds are substantially degraded following contact with a biological milieu in vivo in less than 1 week. In some aspects, the biodegradable scaffolds are substantially degraded following contact with a biological milieu in vitro over 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7, days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 20 days, 30 days, 45 days, 60 days, 90 days, or more. In some aspects, the biodegradable scaffolds are substantially degraded following contact with a biological milieu in vitro in less than 1 week. As used herein, "substantial degradation" means that at least 30%, at least 50%, at least 60%, at least 70%, at least 90%, at least 95%, or more of a scaffold composition is degraded when a scaffold composition is contacted with the biological milieu. [0350] Accordingly, in some aspects, it is advantageous to tailor the degradation kinetics of a scaffold composition by modifying the properties of mesoporous silica rods, such as size, geometry, and/or porosity. Alternately, the degradation kinetics of a scaffold compositions can be modified by changing the culture conditions (e.g., by adjusting the pH of the media). [0351] In accordance with the aforementioned aspects, a scaffold of the disclosure can comprise a plurality of functional molecules which are optionally biodegradable. In some aspects, the scaffolds of the instant disclosure (i.e., PCS) are encapsulated into other biodegradable scaffolds. Non-limiting examples of reagents and techniques useful in making such composite biodegradable scaffold compositions are described in Liao et al, J. Biomed. Mater. Res. B. Appl. Biomater., 102(2):293-302, 2014, which is incorporated by reference herein its entirety. In some aspects, the scaffolds are made up of physiologically- compatible and optionally biodegradable polymers. Non-limiting examples of polymers that are employable in the scaffolds are described in U.S. Patent No. 6,642,363, U.S. Publication No. 2011/0020216, Martinsen et al., Biotech. & Bioeng., 33 (1989) 79-89), (Matthew et al. Biomateriah, 16 (1995) 265-274), Atala et al., J Urology, 152 (1994) 641- 643), and Smidsrod, TIBTECH 8 (1990) 71-78), the entire contents of which are incorporated herein by reference. [0352] Aspects described herein further relate to programmable cell signaling scaffolds with one or more functional molecules, e.g., surface cues and soluble cues, optionally together with one or more additional agents. In some aspects, the disclosure provides compositions comprising a scaffold and T cells clustered therein. In some aspects, the compositions and/or scaffolds are provided with one or more reagents for selecting, culturing, expanding, sustaining, and/or transplanting the cells of interest. Functional molecules [0353] In some aspects, the scaffolds (i.e., PCS) comprise one or more functional molecules. In some aspects, the functional molecule interacts with cells, e.g., T cells, to elicit interaction and/or provoke or inhibit a response. In some aspects, the functional molecule is a surface cue. In some aspects, the functional molecule is a soluble cue. In some aspects, a scaffold comprises at least one surface cue. In some aspects, a scaffold comprises at least one soluble cue. In some aspects, a scaffold comprises at least one surface cue and at least one soluble cue. [0354] Non-limiting examples of such functional molecules include polypeptides, antigens, antibodies, DNA, RNA, carbohydrates, haptens, other small molecules, and any combination thereof. In some aspects, the functional molecules of the disclosure comprise a polypeptide (used interchangeably herein with protein and peptide). Surface cues [0355] In some aspects, the scaffolds (i.e., PCS) comprise one or more surface cues. As used herein “surface cue” refers to molecules capable of binding to a cell surface receptor. In some aspects, the surface cue is in contact with, or coupled to, the layer comprising lipids of the scaffold structure. In some aspects, the surface cue mediates direct, indirect, or semi- direct modulation of one or more biological activities of a target population of cells, e.g., T cells. In some aspects, the surface cue mediates direct activation of T cells. In some aspects, the surface cue directly activates T-cells, e.g., via binding to cell surface receptors on target T- cells. In some aspects, the surface cue comprises a stimulatory molecule that is an activation signal to T cells. As used herein, a T cell "stimulatory molecule" refers to any agent that increases one or more T cell activity, increases the expression of one or more cytokine by the T cell, increases the cytotoxicity of the T cell, increases T cell proliferation, reduces T cell death, or any combination thereof. In some aspects, the surface cue comprises a co-stimulatory molecule. [0356] In some aspects, the surface cue of a scaffold of the disclosure (i.e., PCS) is an antibody or an antigen-binding portion thereof. The term "antibody," as used herein, broadly refers to any immunoglobulin (Ig) molecule comprising one or more polypeptide chains. In some aspects, the antibody comprises two heavy (H) chains and two light (L) chains, or any functional fragment, mutant, variant, or derivation thereof, which retains the essential epitope binding features of an Ig molecule. As used herein, "antibody fragments" refer to a portion of an antibody, which is capable of binding an epitope on an antigen. The term “antigen-binding portion” of an antibody, as used herein, refers one or more part of an antibody that facilitates recognition of and/or binding to an antigen. [0357] Non-limiting examples of antigen-binding portions within the scope of the present disclosure include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab') 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment; and (vi) an isolated complementarity determining region (CDR). In some aspects, the antibody comprises a VHH antibody, a vNAR antibody, an IgNAR antibody, a camelid antibody, a diabody, a monobody, or any combination thereof. [0358] In some aspects of the surface cues of the disclosure, the antibody is monospecific, bispecific, dual specific, or multi-specific formats; specifically binding to one, or two or more different, antigens. [0359] In some aspects, the surface cues include, but are not limited to, a stimulatory molecule that activates T cells (T cell activating molecules). In some aspects, a stimulatory molecule activates T cells by engaging and/or clustering components of the T cell receptor complex. In some aspects, the stimulatory molecule comprises an anti-CD3 antibody or antigen-binding portion thereof. In some aspects, the stimulatory molecule comprises an anti-CD2 antibody or an antigen-binding portion thereof. In some aspects, the stimulatory molecule comprises an anti-CD47 antibody or an antigen-binding portion thereof. In some aspects, the stimulatory molecule comprises an anti-CD81 antibody or antigen-binding portion thereof. In some aspects, the stimulatory molecule comprises an anti-macrophage scavenger receptor (MSR1) antibody or an antigen-binding portion thereof. In some aspects, the stimulatory molecule comprises an anti-T-cell receptor (TCR) antibody or an antigen-binding portion thereof. In some aspects, the surface cue comprises a major histocompatibility complex (MHC) molecule or a multimer thereof. In some aspects, the major histocompatibility complex (MHC) molecule or a multimer thereof is loaded with an MHC peptide. In some aspects, the surface cue comprises a conjugate containing MHC and immunoglobulin (Ig) or a multimer thereof. [0360] T cells can be activated in a CD3-dependent or independent manner, for example, via binding and/or ligation of CD3 or one or more cell-surface receptors other than CD3. Representative examples of such CD3-independent cell-surface molecules include, e.g., CD2, CD47, CD81, MSR1, etc. The process of T cell activation is characterized, for example, in Ryan et al, Nature Reviews Immunology 10, 7, 2010, which is incorporated by reference in its entirety. [0361] In some aspects, the surface cue used in a scaffold of the disclosure is an anti-CD3 antibody or antigen-binding portion thereof. Representative examples of anti-CD3 antibodies include, but are not limited to, muromonab (OKT3), otelixizumab (TRX4), teplizumab (hOKT3yl(Ala- Ala)), visilizumab, an antibody recognizing 17-19 kD C-chain of CD3 within the CD3 antigen/T cell antigen receptor (TCR) complex (HIT3a), and an antibody recognizing a 20 kDa subunit of the TCR complex within CD3e (UCHT1), or an antigen-binding portion thereof. Additional non-limiting examples of anti-CD3 antibodies and antigen-binding portions thereof are described in US patent pub. No. 2014-0088295, which is incorporated herein by reference herein in its entirety. [0362] In some aspects, the surface cue used in a scaffold of the disclosure comprises an anti-CD2 antibody or antigen-binding portion thereof. Representative examples of anti- CD2 antibodies include, but are not limited to, siplizumab (MEDI-507) and LO-CD2b, or an antigen-binding portion thereof. See, e.g., ATCC accession No. PTA-802; deposited June 22, 1999. [0363] In some aspects, the surface cue used in a scaffold of the disclosure comprises an anti-CD47 antibody or antigen-binding portion thereof. Representative examples of anti- CD47 antibodies include, but are not limited to, monoclonal antibody Hu5F9-G4, monoclonal antibody MABL-1, and monoclonal antibody MABL-2 (FERM Deposit Nos. BP-6100 and BP-6101), or an antigen-binding portion thereof. See, e.g., WO1999/12973, the disclosure in which is incorporated by reference herein. [0364] In some aspects, the surface cue used in a scaffold of the disclosure comprises an anti-CD81 antibody or antigen-binding portion thereof. Representative examples of anti- CD81 antibodies include, but are not limited to, monoclonal antibody 5A6, or an antigen- binding portion thereof. See, e.g., Maecker et al., BMC Immunol., 4:1, 2003, the disclosure in which is incorporated by reference herein. [0365] In some aspects, the surface cue used in a scaffold of the disclosure comprises an anti-MSRI antibody or antigen-binding portion thereof. Representative examples of anti- MSRI antibodies include, but are not limited to, rat anti-human CD204 antibody (Thermo Catalog No. MA5-16494) and goat anti-human CD204/MSR1 antibody (Biorad Catalog No. AHP563), or an antigen-binding portion thereof. [0366] In some aspects, the surface cue used in a scaffold of the disclosure comprises an anti-TCR antibody or antigen-binding portion thereof. Representative examples of anti- TCR antibodies include, but are not limited to, mouse anti-human TCR monoclonal antibody IMMU510 (Immunotech, Beckman Coulter, Fullerton, CA) (described in Zhou et al., Cell Mol Immunol., 9(1): 34-44, 2012) and monoclonal antibody defining alpha/beta TCR WT31 (described in Gupta et al, Cell Immunol, 132(l):26-44, 1991), or an antigen- binding portion thereof. [0367] In some aspects, the surface cue comprises a bispecific antibody. In some aspects, a bispecific antibody is used to bring a cell of interest, e.g., a cancer cell or a pathogen, in close proximity with a target effector cell of the disclosure, e.g., a cytotoxic T-cell, such that the effector function of the target effector cell is mediated specifically upon the cell of interest. In some aspects, the surface cue comprises a bispecific antibody, wherein one arm of the antibody is specific to a T cell antigen and the other arm of the antibody is specific to a tumor-associated antigen or a pathogen-specific antigen or mutants thereof. [0368] In some aspects, a bispecific antibody functions in an activation and co-stimulatory capacity. In some aspects, the bispecific antibody specifically binds CD3 and CD28. Such surface cues can be referred to herein as, e.g., “anti-CD3/anti-CD28,” or “anti-CD3×CD28” or “CD3×CD28” bispecific molecules, or other similar terminology. The human CD28 protein has the amino acid sequence shown in GENBANK accession Nos. NP_001230006.1, NP_001230007.1, or NP_006130.1. The mouse CD28 protein has the amino acid sequence shown in GENBANK accession No. NP_031668.3. The various polypeptide sequences encompassed by the aforementioned accession numbers, include, the corresponding mRNA and gene sequences, and are incorporated by reference herein in their entirety. Additional examples of bispecific antibodies envisaged within the scope of the instant disclosure include, but are not limited to, solitomab (CD3xEpCAM), blinatumomab (CD3xCD19), MAB MT-111 (CD3xCEA), and BAY- 2010112 (CD3xPSMA). [0369] In some aspects, the surface cue used in a scaffold of the disclosure comprises a major histocompatibility complex (MHC) molecule which binds to CD3. Representative examples include, but are not limited to, MHC type I, which binds to TCR and CD8, and MHC type II, which binds to TCR and CD4. In some aspects, MHC molecules include HLA-A, HLA-B, HLA-C, DP, DQ, and DR, or a combination thereof. In some aspects, the surface cues comprise two or more MHC molecules attached to a linker. In some aspects, the MHC molecule is monovalent. In some aspects, the MHC molecule is bivalent. [0370] In some aspects, the MHC molecules are loaded with a specific peptide (e.g., a peptide derived from a viral antigen, a bacterial antigen, allergen antigen, or tumor- associated antigen). [0371] In some aspects, the surface cue comprises a fusion protein. In some aspects, the fusion protein has T cell stimulatory properties. T cell stimulatory properties can be constructed by using a linker which allows for delivery of a second signal to the T cell in addition to the signal delivered via the TCR. This can be accomplished by using a linker that has binding affinity for a cell surface structure on another cell, that cell being capable of delivering a second signal to the T cell. Thus, the linker serves to bridge the T cell and the other cell. By bringing the other cell into close proximity to the T cell, the other cell can deliver a second signal to the T cell. [0372] In some aspects, the surface cue of the disclosure comprises one or more co- stimulatory molecules. As used herein “co-stimulatory molecule” refers to a polypeptide that binds to and provides a secondary or co-stimulatory signal to a cell, such as an immune cell (e.g., a T cell). Some co-stimulatory molecules include immune cell surface receptor/ligands, which engage between T cells and antigen presenting cells and generate a stimulatory signal in T cells, which combines with the stimulatory signal (i.e., "co- stimulation") in T cells that results from T cell receptor ("TCR") recognition of antigen on antigen presenting cells. As used herein, a soluble form of a co-stimulatory molecule "derived from an APC" refers to a co-stimulatory molecule normally expressed by B cells, macrophages, monocytes, dendritic cells and other APCs. See, Huppa et al., Nature Reviews Immunology.3, 973- 983 (2003). A "co-stimulator of T cell activation" refers to the ability of a co-stimulatory ligand to bind and to activate T cells which have been activated via any of the aforementioned mechanisms or pathways, e.g., via CD3-dependent or CD3-independent T-cell activation. Co-stimulatory activation can be measured for T cells by the production of cytokines and by proliferation assays that are well known (e.g., CFSE staining). [0373] Such co-stimulatory molecules can mediate direct, indirect, or semi-direct stimulation of a target population of cells. In some aspects, the co-stimulatory molecules mediate activation of T-cells in the presence of one or more surface cues. [0374] In some aspects, the co-stimulatory molecule comprises molecules that specifically bind to a co-stimulatory receptor (e.g., recombinant ligands, purified natural ligands, or derivatives thereof). In some aspects, the co-stimulatory molecule comprises an antibody or antigen-binding portion thereof, which binds specifically to one or more co-stimulatory antigens. Representative examples of co-stimulatory molecules include, but are not limited to, molecules that specifically bind to CD28, 4-1BB (CD137), OX40 (CD134), CD27 (TNFRSF7), GITR (CD357), CD30 (TNFRSF8), HVEM (CD270), LTβR (TNFRSF3), DR3 (TNFRSF25), ICOS (CD278), CD226 (DNAM1), CRTAM (CD355), TIM1 (HAVCR1, KIM1), CD2 (LFA2, 0X34), SLAM (CD150, SLAMF1), 2B4 (CD244, SLAMF4), Lyl08 (NTBA, CD352, SLAMF6), CD84 (SLAMF5), Ly9 (CD229, SLAMF3), CD279 (PD-1), and/or CRACC (CD319, BLAME). [0375] In some aspects, CD28 is the prototypic T cell co-stimulatory receptor and binds to molecules of the B7 family expressed on APCs such as dendritic cells and activated B cells. The ligands for CD28 include CD80 (B7-1) and CD86 (B7-2), which are immunoglobulin superfamily monomeric transmembrane glycoproteins. [0376] In some aspects, the co-stimulatory molecule comprises an anti-CD28 antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-ICOS (CD278) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-CD152 (CTLA4) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-CD81 antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-CD137 antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-OX40 (CD134) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-CD27 (TNFRSF7) antibody or antigen-binding portion thereof. In some aspects, the co- stimulatory molecule comprises an anti-GITR (CD357) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-CD30 (TNFRSF8) antibody or antigen-binding portion thereof. In some aspects, the co- stimulatory molecule comprises an anti-HVEM (CD270) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-LTβR (TNFRSF3) antibody or antigen-binding portion thereof. In some aspects, the co- stimulatory molecule comprises an anti-DR3 (TNFRSF25) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-CD226 (DNAM1) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-CRTAM (CD355) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-TIM1 (HAVCR1, KIM1) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-SLAM (CD 150, SLAMF1) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-2B4 (CD244, SLAMF4) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-Lyl08 (NTBA, CD352, SLAMF6). In some aspects, the co-stimulatory molecule comprises an anti-CD84 (SLAMF5) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-CD229 (Ly9, SLAMF3) antibody or antigen-binding portion thereof. In some aspects, the co-stimulatory molecule comprises an anti-PD-1 (CD279). In some aspects, the co-stimulatory molecule comprises an anti-CRACC (CD319, BLAME) antibody or antigen-binding portion thereof. Representative examples of co-stimulatory molecules include, but are not limited to, those referenced in e.g., U.S. Patent No. 8.785,604; Int’l Publication No. WO 2010/078526; Maecker et al., BMC Immunol., 4:1, (2003); Ramakrishna et al., Journal for ImmunoTherapy of Cancer, 3:37, (2015); Cheung et al, J. Immunol, 185:1949, (2010); Hobo et al, J. Immunol. 189:39, (2012); Reddy et al , J. Virol , 86 (19) 10606- 10620, (2012); Wolf et al., Transplantation, 27;94(6):569-74, (2012); Flaig et al., J. Immunol.172:6524-6527, (2004); and Stark et al., J. Immunol. Methods 296: 149-158, (2005), each of which is incorporated by reference herein in its entirety. In some aspects, the co-stimulatory molecule comprises a recombinant or purified natural ligand or derivative thereof. [0377] In some aspects, the scaffolds (i.e., PCS) comprise a pair of surface cues. In some aspects, a pair of surface cues provide a primary stimulatory signal and co-stimulatory signal to a target cell, such as a T cell. Representative examples of such pairs include, but are not limited to, antibodies capable of binding to CD3/CD28, CD3/ICOS, CD3/CD27, and CD3/CD137, or a combination thereof. [0378] In some aspects, the scaffolds comprise a binding pair comprising an antibody binding to CD3 and at least one co-stimulatory molecule. In some aspects, the at least one co-stimulatory molecule comprises an anti-CD28 antibody. In some aspects, the at least one co-stimulatory molecule comprises an anti-CD28 antibody and a second co-stimulatory molecule. In some aspects, the second costimulatory molecule comprises an antibody that specifically binds ICOS, CD27, or CD137. In some aspects, the scaffold comprises a combination of functional molecules selected from the following combinations: (a) antibodies that specifically bind CD3, CD28, and ICOS, (b) antibodies that specifically bind to CD3, CD28, and CD27, (c) antibodies that specifically bind to CD3, CD28, and CD137, (d) antibodies that specifically bind to CD3, CD28, ICOS and CD27. [0379] In some aspects, the scaffolds (i.e., PCS) comprise a binding pair comprising at least two monospecific antibodies, wherein a first antibody binds to a first member of the pair, e.g., CD3, and a second antibody binds to a second member of the pair, e.g., CD28. In some aspects, the binding pair comprises a bispecific antibody comprising an antigen- binding domain that specifically binds CD3 and an antigen-binding domain that specifically binds CD28. [0380] Alternately, in some aspects, the binding pair comprises at least two monospecific antibodies, wherein a first antibody binds to CD3 and a second antibody binds to ICOS. In some aspects, the binding pair comprises an antibody or antigen-binding portion thereof the specifically binds to ICOS. In some aspects, the antibody is an antagonistic antibody or antigen-binding portion that neutralizes ICOS. [0381] In some aspects, the binding pair comprises at least two monospecific antibodies, wherein a first antibody binds to CD3 and a second antibody binds to CD27. In some aspects, both antibodies are stimulatory antibodies. In some aspects, both antibodies are agonist antibodies. In some aspects, the binding scaffold comprises a bispecific antibody comprising an agonist anti-CD3 binding domain and an agonist CD27 binding domain. [0382] In some aspects, the binding pair comprises at least two monospecific antibodies, wherein a first antibody binds to CD3 and a second antibody binds to CD137. In some aspects, both antibodies are stimulatory antibodies. In some aspects, both antibodies are agonist antibodies. In some aspects, the binding scaffold comprises a bispecific antibody comprising an agonist anti-CD3 binding domain and an agonist anti-CD137 binding domain. [0383] In some aspects, the scaffold comprises a plurality of surface cues. In some aspects, the scaffold comprises multiple antibodies where each antibody preferentially binds to a different receptor on the surface of a target cell. [0384] The amount of different surface cue molecules present on the scaffolds, such as surface cue 1/surface cue 2, for example, can be understood as functional molecule density, calculated as either the theoretical number of molecules per surface area or scaffold or calculated based on the mol percent of coating lipid used for functional molecule presentation or stoichiometry of the functional molecules. The surface cue density can be determined by the percentage of the lipids in the layer comprising lipids being used for function molecule affinity pairing, wherein the surface cues are affixed to the layer comprising lipids. The ratio or stoichiometry of the functional molecules can be expressed as the relative proportion of the various functional molecules being affixed. The density of functional molecule presentation can also be determined by the dry weight ratio of the MSR to the dry weight of the combined surface cues. [0385] The term "affinity pair" as used herein includes antigen-antibody, receptor- hormone, receptor-ligand, agonist-antagonist, lectin-carbohydrate, nucleic acid (RNA or DNA) hybridizing sequences, Fc receptor or mouse IgG-protein A, avidin-biotin, streptavidin-biotin, biotin/biotin binding agent, Ni2 ⁺ or Cu2 ⁺ chelator (e.g., NTA or other chelator/metal pair)/HisTag (6x histidine or other polyhistidine tag) and virus-receptor interactions. Various other specific binding pairs are contemplated for use in practicing the methods of this disclosure. [0386] As used herein, "biotin-binding agent" encompasses avidin, streptavidin and other avidin analogs such as streptavidin or avidin conjugates, highly purified and fractionated species of avidin or streptavidin, and non or partial amino acid variants, recombinant or chemically synthesized avidin analogs with amino acid or chemical substitutions, which still accommodate biotin binding. [0387] In some aspects, each biotin-binding agent molecule binds at least two biotin moieties. In some aspects, each biotin-binding agent molecule binds at least four biotin moieties. As used herein, "biotin" encompasses biotin in addition to biocytin and other biotin analogs such as biotin amido caproate N-hydroxysuccinimide ester, biotin 4- amidobenzoic acid, biotinamide caproyl hydrazide and other biotin derivatives and conjugates. Other derivatives include biotin-dextran, biotin-disulfide-N- hydroxysuccinimide ester, biotin-6 amido quinoline, biotin hydrazide, d-biotin-N hydroxysuccinimide ester, biotin maleimide, d-biotin p- nitrophenyl ester, biotinylated nucleotides and biotinylated amino acids such as N ^ε -biotinyl-L-lysine. [0388] The ligands that can be functionalized via affinity pairing include, but are not limited to, receptors, monoclonal or polyclonal antibodies, viruses, chemotherapeutic agents, receptor agonists and antagonists, antibody fragments, lectin, albumin, peptides, proteins, hormones, amino sugars, lipids, fatty acids, nucleic acids, and cells prepared or isolated from natural or synthetic sources. Any site-specific ligand for any molecular epitope or receptor to be detected through the practice of the disclosure can be utilized. In some aspects, the ligand is a membrane-anchored protein. [0389] The functional molecules, as noted hereinabove, can be any protein or peptide. In some aspects, the proteins are involved in ligand-receptor interactions. For example, an important event of T cell activation is a result of membrane-membrane contact between T cells and APCs, wherein a variety of ligand-receptor interactions take place between the two opposing membranes, including, MHC- peptide and TCR, LFA-1 and ICAM-1, CD2 and CD48, as well as B7 or CTLA-4 and CD28. [0390] Incorporation of predefined amounts of a biotinylated phospholipid into liposome formulations enables the precise surface attachment of biotinylated surface cues via streptavidin-biotin interactions, mimicking the cell surface presentation of cues by natural APCs to T cells. [0391] In some aspects, the density of surface cues or the combinations of surface cues is determined by percentage of affinity paired (e.g., biotinylated) lipid used in the scaffold. In some aspects, the percentage of biotinylated lipid is between about 0.01% to about 1.1%. In some aspects, the percentage of biotinylated lipid is between about 0.1% to about 0.9%. In some aspects, the percentage of biotinylated lipid is between about 0.1% to about 2.5%. In some aspects, the percentage of biotinylated lipid is about 0.01%. In some aspects, the percentage of biotinylated lipid is about 0.05%. In some aspects, the percentage of biotinylated lipid is about 0.1%. In some aspects, the percentage of biotinylated lipid is about 0.2%. In some aspects, the percentage of biotinylated lipid is about 0.25%. In some aspects, the percentage of biotinylated lipid is about 0.3%. In some aspects, the percentage of biotinylated lipid is about 0.4%. In some aspects, the percentage of biotinylated lipid is about 0.5%. In some aspects, the percentage of biotinylated lipid is about 0.6%. In some aspects, the percentage of biotinylated lipid is about 0.7%. In some aspects, the percentage of biotinylated lipid is about 0.8%. In some aspects, the percentage of biotinylated lipid is about 0.9%. In some aspects, the percentage of biotinylated lipid is about 1.0%. In some aspects, the percentage of biotinylated lipid is about 1.1%. In some aspects, the percentage of biotinylated lipid is about 1.5%. In some aspects, the percentage of biotinylated lipid is about 2.0%. In some aspects, the percentage of biotinylated lipid is about 2.5%. [0392] In some aspects, the density of surface cues or the combination of surface cues is determined by the mass of each affinity paired surface cue added during scaffold loading, provided there is an excess of affinity paired lipid in the scaffold, e.g., when using a metal- chelating lipid and his-tagged surface cue. [0393] In some aspects, the dry weight ratio of the MSR to the surface cues (stoichiometry) is from about 1:1 to about 100:1. In some aspects, the dry weight ratio of the MSR to the surface cues (stoichiometry) is from about 10:1 to about 50:1. In some aspects, the dry weight ratio of the MSR to the surface cues (stoichiometry) is from about 20:1 to about 50:1. In some aspects, the dry weight ratio of the MSR to the surface cue of the scaffolds is from about 10,000:1 to about 1:1. In some aspects, the dry weight ratio of the MSR to the surface cues of the scaffolds is from about 5,000:1 to about 1:1, from about 1,000:1 to about 1:1, from about 500:1 to about 1:1, or from about 100:1 to about 1:1. In some aspects, the dry weight ratio of the MSR to the surface cues of the scaffolds is about 10,000:1, about 5,000:1, about 2,500:1, about 1,000:1, about 750:1, about 500:1, about 250:1, about 100:1, about 75:1, about 50:1, about 40:1, about 30:1, about 25:1, about 20:1, about 10:1, or about 1:1. Soluble cues [0394] In some aspects, the scaffolds (i.e., PCS) comprise a plurality of soluble cues associated therewith. As used herein “soluble cues” refers to cell-signaling molecules in contact with the scaffold structure. In some aspects, the soluble cues are in contact with, or coupled to, the layer comprising MSR of the scaffold structure. In some aspects, the scaffolds of the instant disclosure contain a plurality of soluble cues selected from the group consisting of IL-1, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12, IL-15, IL-17, IL-21, Wnt proteins, and transforming growth factor beta (TGF- β), or an agonist thereof, a mimetic thereof, a variant thereof, a functional fragment thereof, or a combination thereof. In some aspects, the scaffolds described herein (i.e., PCS) comprises a plurality of soluble cues, wherein the plurality of soluble cues do not comprise a cytokine. Accordingly, in some aspects, the plurality of soluble cues do not comprise IL-2. In some aspects, the plurality of soluble cues do not comprise IL-7. In some aspects, the plurality of soluble cues do not comprise IL-15. In some aspects, the plurality of soluble cues do not comprise one or more of IL-2, IL-7, and IL-15. In some aspects, the plurality of soluble cues do not comprise each of IL-2, IL- 7, and IL-15. [0395] Representative soluble cues, include, but are not limited to, the following NCBI accession numbers of human and/or mouse homologs thereof: IL-1, NP_000566.3 (human); IL-1α, NP_034684.2 (mouse); IL-1, NP_000567.1 (human); IL-1β, NP_032387.1 (mouse); IL-2, NP_000577.2 (human) and NP_032392.1 (mouse); IL-4, NP_000580.1, NP_758858.1 (human) and NP_067258.1 (mouse); IL-5, NP_000870.1 (human) and NP_034688.1 (mouse); IL-7, NP_000871.1, NP_001186815.1, NP_001186816.1, NP_001186817.1 (human) and NP_032397.1 (mouse); IL-10, NP_000563 (human) and NP_034678.1 (mouse); IL-12A, NP_000873.2 (human) and NP_001152896.1, NP_032377.1 (mouse); IL-12B, NP_002178.2 (human) and NP_001290173.1 (mouse); IL- 15, NP_000576.1, NP_751915.1 (human) and NP_001241676.1, NP_032383.1 (mouse); IL-17(a), NP_002181.1, NP_034682.1 (human); NP_002181.1; NP_034682.1 (mouse); TGF-beta 1, NP_000651.3 (human) and NP_035707.1 (mouse); TGF-beta 2, NP_001129071.1, NP_003229.1 (human) and NP_033393.2 (mouse); and TGF-beta, NP_003230.1 (human). Non-limiting examples of fragments and variants of the aforementioned soluble cues are presented, for example, in the database UNIPROT. [0396] In some aspects, the soluble cue comprises interleukin-2 (IL-2) or an agonist thereof, a mimetic thereof, a variant thereof, a functional fragment thereof, or a combination thereof with one or more additional soluble cues listed above. Non-limiting examples of IL-2 agonists, mimetics thereof, variants thereof, and functional fragments thereof include those provided in U.S. Patent No. 5,496,924; U.S. Patent No. 6,955,807; Margolin et al, Clin Cancer Res. 1;13(11):33 12-9 (2007); Eckenberg et al, J Immunol 165:4312-4318 (2000); Levin et al, Nature 484, 529-533, (2012); and Zurawski et al., EMBO Journal, 9(12): 3899-3905 (1990), each of which is incorporated herein by reference in its entirety. [0397] In some aspects, the scaffolds (i.e., PCS) comprise a plurality of soluble cues. In some aspects, the scaffold comprises a first soluble cue comprising IL-2 and a second soluble cue comprising IL-7, IL-21, IL-15, or IL-15 superagonist. IL-15 superagonist (IL- 15 SA) is a combination of IL-15 with soluble IL-15 receptor-a, which possesses greater biological activity than IL-15 alone. In some aspects, the scaffold comprises a first soluble cue comprising IL-2, a second soluble cue comprising IL-7, and a third soluble cue comprising IL-15. In some aspects, the scaffold comprises a first soluble cue comprising IL-2 and a second and third soluble cue comprising IL-7, IL-21, IL-15, or IL-15 superagonist. [0398] In some aspects, the total soluble cue input to MSR mass ratio (µg total soluble cue input to µg MSR) is about 0.001 to about 0.005. In some aspects, the total soluble cue input to MSR mass ratio is about 0.001. In some aspects, the total soluble cue input to mass ratio is about 0.002. In some aspects, the total soluble cue input to MSR mass ratio is about 0.003. In some aspects, the total soluble cue input to MSR mass ratio is about 0.004. In some aspects, the total soluble cue input to MSR mass ratio is about 0.005. In some aspects, wherein a scaffold comprises more than one soluble cue, the cues are present in equal amounts. In some aspects, the scaffold comprises more than one soluble cue, wherein the cues are present in unequal amounts. Further aspects of scaffolds [0399] In some aspects, the scaffolds (i.e., PCS) comprise a plurality of surface cues and soluble cues. For instance, in some aspects, the scaffold comprise at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, or more of each of the aforementioned functional molecules. [0400] In some aspects, the functional molecules are recombinant. In some aspects, the functional molecules are humanized derivatives of mammalian counterparts. Exemplary mammalian species from which the functional molecules are derived include, but are not limited to, mouse, rat, hamster, guinea pig, ferret, cat, dog, monkey, or primate. In some aspects, the functional molecules are human or humanized version of the aforementioned functional molecules. [0401] The functional molecules can be modified to increase protein stability in vivo. Alternatively, the functional molecules can be engineered to be more or less immunogenic. For instance, insofar as the structures of the various functional molecules are known, the sequences can be modified at one or more of amino acid residues, e.g., glycosylation sites, to generate immunogenic variants. [0402] Any functional molecule (e.g., any antigen, antibody, protein, enzyme, fragment thereof, recombinant or purified natural ligands or derivatives thereof, or any combination thereof) can be directly or indirectly immobilized onto the layer comprising MSR and/or the layer comprising lipids using routine techniques. In some aspects, the functional molecules are provided in an organelle (e.g., golgi membrane or plasma membrane), a cell, a cell cluster, a tissue, a microorganism, an animal, a plant, or an extract thereof, which in turn is immobilized onto the layer comprising MSR or the layer comprising lipids. In some aspects, the functional molecule is synthesized by genetic engineering or chemical reactions at the desired situs, e.g., outer face of the layer comprising lipids. [0403] Each of the aforementioned functional molecules, e.g., surface cues and soluble cues can, independently from one another, be loaded, adsorbed or integrated into/onto the layer comprising MSR or the layer comprising lipids. Therefore, in some aspects, the surface cues are loaded, adsorbed or integrated into/onto the layer of the scaffold comprising MSR. In some aspects, the surface cues are loaded, adsorbed or integrated into/onto the layer comprising lipids. In some aspects, the surface cues are loaded, adsorbed or integrated into/onto both the layer comprising MSR as well as the layer comprising lipids. In some aspects, the surface cue comprises a co-stimulatory molecule loaded, adsorbed or integrated into/onto the layer comprising MSR. In some aspects, the co- stimulatory molecule is loaded, adsorbed or integrated into/onto the layer comprising lipids. In some aspects, the surface cue comprises a co-stimulatory molecule, which is loaded, adsorbed or integrated into/onto both the layer comprising MSR as well as the layer comprising lipids. In some aspects, the soluble cues are loaded, adsorbed or integrated into/onto the layer comprising MSR. In some aspects, the soluble cues are loaded, adsorbed or integrated into/onto the layer comprising lipids. In some aspects, the soluble cues are loaded, adsorbed or integrated into/onto both the layer comprising MSR as well as the layer comprising lipids. [0404] In general, the functional molecules and the layer comprising MSR and/or the layer comprising lipids, can be linked together through the use of reactive groups, which are typically transformed by the linking process into a new organic functional group or unreactive species. The reactive functional group(s) can be located in any of the aforementioned components. Reactive groups and classes of reactions useful in practicing the present disclosure are generally those that are well known in the art of bioconjugate chemistry. Currently favored classes of reactions available with reactive chelates are those that proceed under relatively mild conditions. These include, but are not limited to, nucleophilic substitutions (e.g., reactions of amines and alcohols with acyl halides, active esters), electrophilic substitutions (e.g., enamine reactions) and additions to carbon-carbon and carbon-heteroatom multiple bonds (e.g., Michael reaction, Diels-Alder addition). In some aspects, chemical coupling comprises click chemistry, discussed in, for example, clickchemistrytools.com. In some aspects, chemical coupling comprises a click chemistry reagent (e.g., DBCO or azide). These and other useful reactions are discussed in, for example, March, Advanced Organic Chemistry, 3rd Ed., John Wiley & Sons, New York, 1985; Hermanson, Bioconjugate Techniques, Academic Press, San Diego, 1996; and Feeney et al, Modification of Proteins; vol.198, American Chemical Society, Washington, D.C., 1982. [0405] In some aspects, the scaffolds (i.e., PCS) comprise one or more additional molecules. In some aspects, the one or more additional molecules are naturally-occurring, synthetically produced, or recombinant compounds. In some aspects, the one or more additional molecules comprise peptides, polypeptides, nucleic acids, small molecules, haptens, carbohydrates, or agents, including fragments thereof or combinations thereof. [0406] In some aspects, an anchor is used to connect a functional molecule to a pore wall. However, the anchor is not an essential component. In some aspects, each pore of the mesoporous silica accommodates at least one functional molecule. The pore size depends on the size of the functional molecule to be immobilized. In some aspects, the functional molecule is immobilized in a pore. In some aspects, the functional molecule is loaded or adsorbed on an inner surface of the pore by electrostatic bonding. In some aspects, the functional molecule is loaded or adsorbed on an inner surface of the pore by a noncovalent bond. [0407] In some aspects, the anchor reduces a large structural change of the functional molecule to hold it stably. In some aspects, the anchor comprises substantially the same component as the mesoporous material. In some aspects, the anchor comprises one or more functional groups to permit binding to a desired functional molecule: a hydroxyl group, an amide group, an amino group, a pyridine group, a urea group, a urethane group, a carboxyl group, a phenol group, an azo group, a hydroxyl group, a maleimide group, a silane derivative, an aminoalkylene group, or a combination thereof. [0408] In some aspects, a scaffold comprises an antigen. In some aspects, the antigen comprises a polypeptide. In some aspects, the antigen is purified. In some aspects, the antigen is a self-antigen. In some aspects, the antigen is a non-self antigen. Self-antigens are specifically associated with a human disease or a disorder including, but not limited to, autoimmune disorders and cancer. Non-self antigens are specifically associated with pathogens including, but not limited to, a virus, a bacteria, a protozoan, a parasite, or a fungus. In some aspects, the antigens are loaded onto MHC molecules, e.g., HLA-A, HLA- B, HLA-C, DP, DQ, and DR, which are then incorporated into/onto the scaffolds. [0409] In some aspects, the antigen is formulated to interact with the immune cell via direct binding or indirect binding. Types of direct binding include, for example, engagement or coupling of the antigen with the cognate receptor, e.g., T-cell receptor. Indirect binding can occur through the intermediacy of one or more secondary agents or cell-types. For example, the antigen can first bind to a B-cell or an antigen-presenting cell (APC), get processed (e.g., degraded) and presented on cell-surface major-histocompatibility complexes (MHC), to which the target cell population, e.g., T-cell, binds. Alternately, the antigen can recruit other intermediary cells that secrete various cytokines, growth factors, chemokines, etc., which in turn attract the target immune cell population. In some aspects, the antigen is CD19, CD22, or a fragment thereof. [0410] In some aspects, the scaffold (i.e., PCS) comprises a membrane-associated protein, which is anchored directly or indirectly to the layer comprising lipids. In some aspects, the membrane-associated protein comprises a selective or non-selective membrane transport protein, ion channel, pore forming protein, membrane-resident receptors, or any combination thereof. [0411] In some aspects, the scaffold comprises a growth factor, a cytokine (e.g., IL-2, IL- 7, IL-15, and/or IL-21), a chemokine, an interleukin, an adhesion signaling molecule, an integrin signaling molecule, a fragment thereof, or any combination thereof. In some aspects, these molecules can be used as soluble cues and/or surface cues and can be loaded to either the layer comprising the MSR or the layer comprising the lipids. In some aspects, the scaffold does not comprise a cytokine. More particularly, in some aspects, the scaffold does not comprise an IL-2, IL-7, IL-15, or combinations thereof. In some aspects, the scaffold does not comprise IL-2. In some aspects, the scaffold does not comprise IL-7. In some aspects, the scaffold does not comprise IL-15. In some aspects, the scaffold does not comprise IL-2, IL-7, and IL-15. [0412] In some aspects, the scaffold comprises adhesion molecules. In some aspects, the adhesion molecules further serve as signaling agents. Representative examples of adhesion signaling molecules include, but are not limited to, fibronectin, laminin, collagen, thrombospondin 1, vitronectin, elastin, tenascin, aggrecan, agrin, bone sialoprotein, cartilage matrix protein, fibronogen, fibrin, fibulin, mucins, entactin, osteopontin, plasminogen, restrictin, serglycin, SPARC/osteonectin, versican, von Willebrand Factor, polysaccharide heparin sulfate, connexins, collagen, RGD (Arg-Gly-Asp) and YIGSR (Tyr-Ile-Gly- Ser-Arg) peptides and cyclic peptides, glycosaminoglycans (GAGs), hyaluronic acid (HA), condroitin-6-sulfate, integrin ligands, selectins, cadherins, and members of the immunoglobulin superfamily. [0413] In some aspects, the functional molecules are conjugated to membrane- associated proteins, which associate with and/or insert into the layer comprising lipids, e.g., gramicidin; a-helix bundles, e.g. bacteriorhodopsin or K ⁺ channels; β-barrels, e.g., a- hemolysin, leukocidin or E. coli porins; or combinations thereof. [0414] In some aspects, the scaffold further comprises one or more recruiting agents. In some aspects, the recruiting agent comprises an agent selected from the group consisting of a T-cell recruiting agent, a B-cell recruiting agent, a dendritic cell recruiting agent, and a macrophage recruiting agent. Examples of such recruiting agents include, but are not limited to chemokines, chemokine ligands, or fragments, variants, homologs, and combinations thereof. Preferential recruitment is characterized by an accumulation of at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 2- fold, at least 5-fold, at least 8-fold, at least 10-fold, or greater increase in one or more of a particular type of immune cells compared to other types of immune cells. [0415] Depending on need, the scaffolds can be specifically formulated to comprise a subset of recruitment agents and adhesion molecules so as to manipulate a particular subset of immune cells, e.g., pan-T cells or a particular sub-population of T-cells. In some aspects, the scaffolds are formulated/fabricated using agents that specifically bind to cell-surface markers that are expressed in the target cells. For example, in the context of T-cells, the scaffolds can be adapted for the preferential recruitment of helper T-cells (CD4 ⁺ T cells), cytotoxic T-cells (CD8 ⁺ T cells), memory T-cells (CD45RO ⁺ T cells), suppressor T-cells (Ts which cells), regulatory T-cells (Tregs; further characterized as FOXP3 ⁺ Treg cells and FOXP3- Treg), natural killer T-cells (NK cells; differentially express CDld ⁺ ), mucosal associated invariant (MAITs; differentially express MR1), gamma delta T cells, (γδ T cells; comprise TCRs containing one γ -chain and one δ-chain). Such agents which bind to cell- surface markers can include, for example, haptens, peptides, ligands, antibodies, or the like, or any combination thereof. Other routine techniques for enriching the isolates with one or more cell subtype can be used in situ or ex situ. [0416] As further described herein (see, e.g., Example 1), in some aspects, an exemplary PCS that can be used with the present disclosure comprises a base layer of mesoporous silica microrods (MSR) and a fluid-supported lipid bilayer (SLB) layered on the MSR base layer. In some aspects, a PCS described herein comprises a MSR, SLB, and a surface cue. In some aspects, the surface cue comprises a functional molecule such as anti-CD3 and/or anti-CD28 antibodies. Accordingly, in some aspects, a PCS useful for the present disclosure comprises a MSR, SLB, and a surface cue, wherein the surface cue comprises an anti-CD3 antibody. In some aspects, a PCS comprises a MSR, SLB, and a surface cue, wherein the surface cue comprises an anti-CD28 antibody. In some aspects, a PCS comprises a MSR, SLB, and a surface cue, wherein the surface cue comprises an anti-CD3 antibody and an anti-CD28 antibody. In each of the above aspects, the surface cue can be loaded onto the scaffold. Methods of Making [0417] The scaffolds of the disclosure (i.e., PCS) can be generated in a variety of ways and used for various applications, including, but not limited to, modulating the type and abundance of functional molecules or additional agents in accordance with a scaffold, for use in the manipulation of target effector cells, e.g., T-cells, isolation of a specific population of effector cells, e.g., a sub-population of CD8 ⁺ T-cells, therapy of diseases, and the production of compositions and kits. Examples of methods of making and using such scaffolds is described in PCT Publication No. WO 2018/013797 A1 and Chung et al. (Nature Biotechnology 36(2): 160-169 (2018)), the entire contents of which are incorporated by reference herein. [0418] For isolation and/or expansion of a desired population of cells, the concentration of cells and scaffold surface can be varied. In some aspects, the volume in which the scaffolds and cells are mixed is decreased (i.e., increasing the concentration of cells), to ensure maximum contact of cells and scaffolds. In some aspects, a concentration of 2 billion cells/ml is used. In some aspects, a concentration of 1 billion cells/ml is used. In some aspects, greater than 100 million cells/ml is used. In some aspects, a concentration of cells of 10 million, 15 million, 20 million, 25 million, 30 million, 35 million, 40 million, 45 million, or 50 million cells/ml is used. In some aspects, a concentration of cells from 75 million, 80 million, 85 million, 90 million, 95 million, or 100 million cells/ml is used. In some aspects, a concentration of 125 million or 150 million cells/ml is used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion. Further, use of high cell concentrations can allow more efficient capture of cells that can weakly express target antigens of interest, such as CD28− negative T cells, or from samples where there are many tumor cells present (i.e., leukemic blood, tumor tissue, etc.). Such populations of cells can have a therapeutic value and would be desirable to obtain. For example, using high concentration of cells allows more efficient selection of CD8 ⁺ T cells that normally have weaker CD28 expression. [0419] In some aspects, it is desirable to use lower concentrations of cells. This can be achieved by lowering the scaffold:cell ratio, such that interactions between the scaffolds and cells are minimized. This method selects for cells that express high amounts of desired antigens to be bound to the scaffolds. For example, CD4 ⁺ T cells express higher levels of CD28 and are more efficiently captured than CD8 ⁺ T cells in dilute concentrations. In some aspects, the concentration of cells used is about 5 x 10 ⁶ /ml. In some aspects, the concentration used can be from about 1 × 10 ⁴ /ml to about 1 × 10 ⁹ /ml, and any integer value in between, e.g., 1 × 10 ⁵ /ml to 1 × 10 ⁸ /ml, 1 × 10 ⁶ /ml to 1 × 10 ⁷ /ml, 1 × 10 ⁷ /ml to 1 × 10 ⁹ /ml. [0420] Some aspects of the present disclosure are directed to methods of contacting immune cells with PCS and culturing immune cells (e.g., T cells and/or NK cells edited to exhibit reduced expression of a member of the NR4A family) in a culture condition (e.g., media), wherein the culture condition (e.g., certain ion concentrations, tonicity of the media, cytokines, and/or any combination thereof) is capable of reducing, limiting or preventing the differentiation of the immune cells, thereby affecting or improving their use in cell therapy, e.g., adoptive cell therapy. More specifically, as described herein, in some aspects, immune cells (e.g., T cells and/or NK cells) are contacted with a programmable cell-signaling scaffold (PCS) in a medium comprising potassium ion at a concentration higher than 5 mM (also referred to herein as "metabolic reprogramming media" or "MRM") and edited to exhibit a reduced expression level of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3) as compared to corresponding immune cells which have not been edited. In some aspects, the activating (i.e., contacting) and editing can occur concurrently (e.g., in the same day). In some aspects, the activating (i.e., contacting) and editing can occur non-concurrently (i.e., on separate days). In some aspects, the immune cells are further modified (i.e., transduced) to express a ligand binding protein (e.g., CAR and/or TCR) and/or exhibit an increased expression of a c-Jun protein. For instance, in some aspects, the immune cells are further transduced to express a ligand-binding protein (e.g., CAR and/or TCR). In some aspects, the immune cells are further transduced to As further described herein, in some aspects, after the activating and the modifying, the immune cells can be further cultured in additional MRM. In some aspects, the additional MRM is the same as the MRM used to activate the immune cells. In some aspects, the additional MRM is different compared to the MRM used to activate the immune cells (e.g., does not comprise the PCS). Cells [0421] The present disclosure also provides a modified cell which exhibits a reduced expression of a member of the NR4A family as compared to a reference cell (e.g., corresponding cell that has not been modified to have reduced expression of the NR4A family member). For instance, in some aspects, a modified cell described herein exhibits a reduced expression of NR4A1 (NR4A1 gene and/or NR4A1 protein). In some aspects, a modified cell described herein exhibits a reduced expression of NR4A2 (NR4A2 gene and/or NR4A2 protein). In some aspects, a modified cell described herein exhibits a reduced expression of NR4A3 (NR4A3 gene and/or NR4A3 protein). In some aspects, a modified cell described herein exhibits a reduced expression of both NR4A1 (NR4A1 gene and/or NR4A1 protein) and NR4A2 (NR4A2 gene and/or NR4A2 protein). In some aspects, a modified cell described herein exhibits a reduced expression of both NR4A1 (NR4A1 gene and/or NR4A1 protein) and NR4A3 (NR4A3 gene and/or NR4A3 protein). In some aspects, a modified cell described herein exhibits a reduced expression of both NR4A2 (NR4A2 gene and/or NR4A2 protein) and NR4A3 (NR4A3 gene and/or NR4A3 protein). In some aspects, a modified cell described herein exhibits a reduced expression of each of NR4A1 (NR4A1 gene and/or NR4A1 protein), NR4A2 (NR4A2 gene and/or NR4A2 protein), and NR4A3 (NR4A3 gene and/or NR4A3 protein). [0422] As further described herein, in some aspects, modified immune cells described herein (e.g., T cells and/or NK cells) have been further modified to express a ligand-binding protein (e.g., CAR or engineered TCR). Accordingly, in some aspects, a modified cell provided herein expresses a ligand-binding protein and exhibits a reduced expression of NR4A1 (NR4A1 gene and/or NR4A1 protein). In some aspects, a modified cell provided herein expresses a ligand-binding protein and exhibits a reduced expression of NR4A2 (NR4A2 gene and/or NR4A2 protein). In some aspects, a modified cell provided herein expresses a ligand-binding protein and exhibits a reduced expression of NR4A3 (NR4A3 gene and/or NR4A3 protein). In some aspects, a modified cell provided herein expresses a ligand-binding protein and exhibits a reduced expression of both NR4A1 (NR4A1 gene and/or NR4A1 protein) and NR4A2 (NR4A2 gene and/or NR4A2 protein). In some aspects, a modified cell provided herein expresses a ligand-binding protein and exhibits a reduced expression of both NR4A1 (NR4A1 gene and/or NR4A1 protein) and NR4A3 (NR4A3 gene and/or NR4A3 protein). In some aspects, a modified cell provided herein expresses a ligand-binding protein and exhibits a reduced expression of both NR4A2 (NR4A2 gene and/or NR4A2 protein) and NR4A3 (NR4A3 gene and/or NR4A3 protein). In some aspects, a modified cell provided herein expresses a ligand-binding protein and exhibits a reduced expression of each of NR4A1 (NR4A1 gene and/or NR4A1 protein), NR4A2 (NR4A2 gene and/or NR4A2 protein), and NR4A3 (NR4A3 gene and/or NR4A3 protein). [0423] As described herein, any suitable methods known in the art can be used to modify the cells described herein. In some aspects, a cell useful for the present disclosure has been modified to comprise an exogenous nucleotide sequence encoding a protein of interest, such that the encoded protein is expressed in the cell. For instance, in some aspects, an immune cell (e.g., T cell and/or NK cell) useful for the present disclosure has been modified (e.g., in a medium comprising potassium ion at a concentration higher than 5 mM) to comprise an exogenous nucleotide sequence encoding a ligand-binding protein (e.g., CAR or engineered TCR). As described herein, in some aspects, after the modification, the expression of the encoded protein is increased compared to a reference cell (e.g., corresponding cell that has not been modified to comprise the exogenous nucleotide sequence). For instance, in some aspects, after the modification, the expression of the ligand-binding protein in the cell is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 100%, as compared to a reference cell (e.g., corresponding cell that has not been modified to comprise the nucleotide sequence encoding the ligand-binding protein). In some aspects, after the modification, the expression of the ligand-binding protein is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750- fold, or at least about 1000-fold, as compared to the reference cells. In some aspects, a cell described herein has been modified to comprise multiple exogenous nucleotide sequences encoding different proteins of interest (e.g., a ligand-binding protein and/or EGFRt). Where multiple exogenous nucleotide sequences are involved, in some aspects, the multiple exogenous nucleotide sequences can be part of a single polycistronic polynucleotide. [0424] As used herein, the term "transcriptional activator" refers to a protein that increases the transcription of a gene or set of genes (e.g., by binding to enhancers or promoter-proximal elements of a nucleic acid sequence and thereby, inducing its transcription). Non-limiting examples of such transcriptional activators that can be used with the present disclosure include: Transcription Activator-like Effector (TALE)-based transcriptional activator, zinc finger protein (ZFP)-based transcriptional activator, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein (Cas) system-based transcriptional activator, or a combination thereof. See, e.g., Kabadi et al., Methods 69(2): 188-197 (Sep. 2014), which is incorporated herein by reference in its entirety. [0425] In some aspects, a cell described herein has been modified with a CRISPR/Cas- system-based transcriptional activator, such as CRISPR activation (CRISPRa). See, e.g., Nissim et al., Molecular Cell 54: 1-13 (May 2014), which is incorporated herein by reference in its entirety. CRISPRa is a type of CRISPR tool that comprises the use of modified Cas proteins that lacks endonuclease activity but retains the ability to bind to its guide RNA and the target DNA nucleic acid sequence. Non-limiting examples of such modified Cas proteins which can be used with the present disclosure are known in the art. See, e.g., Pandelakis et al., Cell Systems 10(1): 1-14 (Jan. 2020), which is incorporated herein by reference in its entirety. In some aspects, the modified Cas protein comprises a modified Cas9 protein (also referred to in the art as "dCas9"). In some aspects, the modified Cas protein comprises a modified Cas12a protein. In some aspects, a modified Cas protein that is useful for the present disclosure is bound to a guide polynucleotide (e.g., small guide RNA) ("modified Cas-guide complex"), wherein the guide polynucleotide comprises a recognition sequence that is complementary to a region of a nucleic acid sequence encoding a protein of interest. In some aspects, the guide polynucleotide comprises a recognition sequence that is complementary to the promoter region of an endogenous nucleic acid sequence encoding a protein of interest. In some aspects, one or more transcriptional activators are attached to the modified Cas-guide complex (e.g., the N- and/or C-terminus of the modified Cas protein), such that when the modified Cas-guide complex is introduced into a cell, the one or more transcription activators can bind to a regulatory element (e.g., promoter region) of a nucleic acid sequence, and thereby induce and/or increase the expression of the encoded protein. In some aspects, the one or more transcription activators can bind to a regulatory element (e.g., promoter region) of an endogenous gene, and thereby induce and/or increase the expression of the encoded protein. Non-limiting Illustrative examples of common general activators that can be used include the omega subunit of RNAP, VP16, VP64 and p65. See, e.g., Kabadi and Gersbach, Methods 69: 188-197 (2014), which is incorporated herein by reference in its entirety. [0426] In some aspects, one or more transcriptional repressors (e.g., Kruppel-associated box domain (KRAB)) can be attached to the modified Cas-guide complex (e.g., the N- and/or C-terminus of the modified Cas protein), such that when introduced into a cell, the one or more transcriptional repressors can repress or reduce the transcription of a gene. See, e.g., US20200030379A1 and Yang et al., J Transl Med 19:459 (2021), each of which is incorporated herein by reference in its entirety. In some aspects, a modified Cas protein useful for the present disclosure can be attached to both one or more transcriptional activators and one or more transcriptional repressors. [0427] Not to be bound by any one theory, in some aspects, the use of such modified Cas proteins can allow for the conditional transcription and expression of a gene of interest. For example, in some aspects, a cell (e.g., T cells) is modified to comprise a ligand binding protein (e.g., CAR or TCR described herein), which is linked to a protease (e.g., tobacco etch virus (TEV)) and a single guide RNA (sgRNA) targeting the promoter region of a protein of interest. In some aspects, the cell is modified to further comprise a linker for activation of T cells (LAT), complexed to the modified Cas protein attached to a transcriptional activator (e.g., dCas9-VP64-p65-Rta transcriptional activator (VPR)) via a linker (e.g., TEV-cleavable linker). Upon activation of the ligand binding protein, the modified Cas protein is released for nuclear localization and conditionally and reversibly induces the expression of a protein of interest. Yang et al., J Immunother Cancer 9(Suppl2): A164 (2021), which is herein incorporated by reference in its entirety. [0428] In some aspects, an immune cell (e.g., T cell and/or NK cell) provided herein has been modified to exhibit a reduced expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3). Any suitable methods known in the art can be used to edit the immune cells, such that the cells exhibit reduced expression of a member of the NR4A family. In some aspects, editing an immune cell to exhibit reduced expression of a member of the NR4A family comprises contacting the immune cell with a gene editing tool which is capable of reducing the expression of the NR4A family member. Non-limiting examples of gene editing tools that can be used include: a shRNA, siRNA, miRNA, antisense oligonucleotides, CRISPR, zinc finger nuclease, TALEN, meganuclease, restriction endonuclease, or any combination thereof. Additional disclosure relating to gene editing tools that can be used to reduce the expression of a NR4A family member are provided elsewhere in the present disclosure. [0429] As will be apparent to those skilled in the art, in some aspects, a cell (e.g., T cell and/or NK cell) described herein has been modified using a combination of multiple approaches. For instance, in some aspects, a cell has been modified to comprise (i) an exogenous nucleotide sequence encoding one or more proteins (e.g., a ligand-binding protein), and (ii) a gene editing tool that is capable of reducing the expression of a NR4A family member. In some aspects, a cell has been modified to comprise (i) an exogenous nucleotide sequence encoding a ligand-binding protein (e.g., CAR and/or TCR), (ii) an agent that is capable of increasing the expression of a c-Jun protein (e.g., nucleotide sequence encoding a c-Jun protein and/or transcriptional activator described herein), and (iii) a gene editing tool that is capable of reducing the expression of a NR4A family member. In some aspects, the modified cell can further comprise an exogenous nucleotide sequence encoding one or more additional proteins (e.g., EGFRt). As described herein, in some aspects, the exogenous nucleotide sequences encoding the first, second, and third proteins can be part of a single polycistronic vector. [0430] Unless indicated otherwise, the one or more exogenous nucleotide sequences, transcriptional activators, and/or gene editing tools can be introduced into a cell using any suitable methods known in the art. Non-limiting examples of such suitable methods include: transfection (also known as transformation and transduction), electroporation, non-viral delivery, viral transduction, lipid nanoparticle delivery, and combinations thereof. [0431] As further described elsewhere in the present disclosure, modifying immune cells (e.g., T cells and/or NK cells) as described herein (e.g., contacted with a PCS in MRM and modified to exhibit a reduced expression of a member of the NR4A family) can improve and/or enhance one or more properties of the immune cells. Non-limiting examples of such properties include: resistance to exhaustion (e.g., as indicated by reduced expression of exhaustion markers, such as PD-1, CD39, TIM-3, and/or LAG-3; increased persistence/survival; delay of the onset of dysfunctional states; and/or increased cytokine (e.g., IFN-γ and/or IL-2) production), increased expansion/proliferation, increased antigen sensitivity, improved effector function, in particular, improved effector function following repeated antigen stimulation (e.g., cytokine production upon antigen stimulation, lysis of cells expressing the target antigen, or both), or combinations thereof. [0432] Assays useful for measuring exhaustion, cell phenotype, persistence, cytotoxicity and/or killing, proliferation, cytokine production/release, and gene expression profiles are known in the art and include, for example flow cytometry, intracellular cytokine staining (ICS), INCUCYTE ^® immune cell killing analysis, Meso Scale Discovery (MSD) or similar assay, persistent antigen stimulation assays, bulk and single cell RNAseq (see e.g., Fron Genet.2020; 11:220; 2019 Bioinformatics 35:i436-445; 2019 Annual Review of Biomed. Data Sci.2:139-173), cytotoxicity/killing assays, ELISA, western blot and other standard molecular and cell biology methods such as described herein or as described, for example, in Current Protocols in Molecular Biology or Current Protocols in Immunology (John Wiley & Sons, Inc., 1999-2021) or elsewhere. [0433] In some aspects, immune cells modified as described herein (e.g., contacted with PCS in MRM and edited to exhibit a reduced expression of a member of the NR4A family) exhibit increased resistance to exhaustion, as compared to reference immune cells. In some aspects, the resistance to exhaustion is increased by at least about 0.5-fold, by at least about 1-fold, by at least about 2-fold, by at least about 3-fold, by at least about 4-fold, by at least about 5-fold, by at least about 6-fold, by at least about 7-fold, by at least about 8-fold, by at least about 9-fold, by at least about 10-fold, by at least about 12-fold, by at least about 14-fold, by at least about 16-fold, by at least about 18-fold, by at least about 20-fold, by at least about 25-fold, by at least about 30-fold, by at least about 35-fold, by at least about 40- fold, by at least about 45-fold, by at least about 50-fold, by at least about 75-fold, by at least about 100-fold, by at least about 200-fold, by at least about 300-fold, by at least about 400- fold, by at least about 500-fold, by at least about 750-fold, or by at least about 1000-fold, compared to a reference cell (e.g., corresponding cell that was not modified to have reduced NR4A family member expression and/or cultured in MRM). [0434] In some aspects, modifying immune cells as described herein (e.g., contacted with PCS in MRM and edited to exhibit reduced expression of a member of the NR4A family) can decrease exhaustion in an exhausted cell. Accordingly, where the immune cells are exhausted, modifying the immune cells as described herein (e.g., contacted with PCS in MRM and modified to exhibit a reduced expression of a member of the NR4A family) can decrease exhaustion by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, compared to a reference cell (e.g., corresponding exhausted cell that was not modified to have reduced NR4A expression and/or cultured in MRM), as measured, for example, using one or more assays as described herein. [0435] In some aspects, the exhaustion state of a population of immune cells (e.g., modified and cultured using the methods provided herein) can be determined by quantifying the amount (e.g., number and/or percentage) of cells within the population of immune cells that express a given exhaustion marker (e.g., TIGIT, PD-1, TIM-3, and/or LAG-3). For instance, when a population of immune cells is modified to exhibit a reduced expression of one or more members of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3), the amount (e.g., number and/or percentage) of cells that express a given exhaustion marker is reduced, compared to the amount in a corresponding population of immune cells that was not modified as described herein. Accordingly, in some aspects, the amount of cells that express a given exhaustion marker in a population of modified immune cells described herein is decreased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the amount in a corresponding population of immune cells that was not modified as described herein. [0436] In some aspects, modifying immune cells (e.g., T cells and/or NK cells) can increase the persistence/survival of the immune cell, e.g., when administered to a subject in vivo. In some aspects, the persistence/survival of the cell is increased by at least about 0.5-fold, by at least about 1-fold, by at least about 2-fold, by at least about 3-fold, by at least about 4- fold, by at least about 5-fold, by at least about 6-fold, by at least about 7-fold, by at least about 8-fold, by at least about 9-fold, by at least about 10-fold, by at least about 12-fold, by at least about 14-fold, by at least about 16-fold, by at least about 18-fold, by at least about 20-fold, by at least about 25-fold, by at least about 30-fold, by at least about 35-fold, by at least about 40-fold, by at least about 45-fold, by at least about 50-fold, by at least about 75-fold, by at least about 100-fold, by at least about 200-fold, by at least about 300- fold, by at least about 400-fold, by at least about 500-fold, by at least about 750-fold, or by at least about 1000-fold, compared to a reference cell (e.g., corresponding cell that was not modified to have reduced expression of a NR4A family member). In some aspects, the persistence/survival of the immune cell described herein is increased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the amount in a corresponding population of immune cells that was not modified as described herein. [0437] Accordingly, in some aspects, immune cells provided herein have been modified to exhibit a reduced expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3), and cultured in a medium comprising potassium ion at a concentration higher than 5 mM, such that after the modification and the culturing, the persistence/survival of the immune cells is increased compared to reference cells. [0438] In some aspects, modifying the immune cells (e.g., T cells and/or NK cells) can increase the expansion/proliferation of the immune cell, e.g., upon antigen stimulation. In some aspects, the expansion/proliferation of the cell is increased by at least about 0.5-fold, by at least about 1-fold, by at least about 2-fold, by at least about 3-fold, by at least about 4-fold, by at least about 5-fold, by at least about 6-fold, by at least about 7-fold, by at least about 8-fold, by at least about 9-fold, by at least about 10-fold, by at least about 12-fold, by at least about 14-fold, by at least about 16-fold, by at least about 18-fold, by at least about 20-fold, by at least about 25-fold, by at least about 30-fold, by at least about 35-fold, by at least about 40-fold, by at least about 45-fold, by at least about 50-fold, by at least about 75-fold, by at least about 100-fold, by at least about 200-fold, by at least about 300- fold, by at least about 400-fold, by at least about 500-fold, by at least about 750-fold, or by at least about 1000-fold, compared to a reference cell (e.g., corresponding cell that was not modified as described herein). In some aspects, the expansion/proliferation of the modified immune cell provided herein, e.g., upon antigen stimulation, is increased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the amount in a corresponding population of immune cells that was not modified as described herein. [0439] Accordingly, in some aspects, immune cells provided herein have been modified to exhibit a reduced expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3), and cultured in a medium comprising potassium ion at a concentration higher than 5 mM, such that after the modification and the culturing, the expansion/proliferation of the immune cells is increased compared to reference cells. [0440] In some aspects, modifying immune cells as described herein can increase the effector function of the cell, e.g., increased cytokine (e.g., IFN-γ, TNF-α, and/or IL-2) production, granzyme release, and/or cytotoxicity. In some aspects, the increase in effector function is in response to persistent antigen stimulation. As used herein, the term "persistent antigen stimulation" or "chronic antigen stimulation" refers to repeated exposure of an immune cell (e.g., T cell) to its cognate antigen, such that the immune cell is stimulated or activated. In some aspects, persistent antigen stimulation comprises exposing an immune cell (e.g., T cells) to its cognate antigen for at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 1 year. In some aspects, the persistent antigen stimulation can be continuous. In some aspects, the persistent antigen stimulation can comprise multiple rounds of antigen stimulation, where each round of antigen stimulation is followed by a period of non-antigen stimulation. In some aspects, persistent antigen stimulation comprises at least about 2, at least about 3, at least about 4, at least about 5, or at least about 6 or more rounds of antigen stimulation. As is apparent from the present disclosure and known in the art, such persistent antigen stimulation of an immune cell can result in the exhaustion of the immune cell. [0441] In some aspects, when modified using the methods provided herein (e.g., contacted with PCS in MRM and modified to exhibit a reduced expression of a NR4A family member) the effector function of the cell is increased by at least about 0.5-fold, by at least about 1-fold, by at least about 2-fold, by at least about 3-fold, by at least about 4-fold, by at least about 5-fold, by at least about 6-fold, by at least about 7-fold, by at least about 8- fold, by at least about 9-fold, by at least about 10-fold, by at least about 12-fold, by at least about 14-fold, by at least about 16-fold, by at least about 18-fold, by at least about 20-fold, by at least about 25-fold, by at least about 30-fold, by at least about 35-fold, by at least about 40-fold, by at least about 45-fold, by at least about 50-fold, by at least about 75-fold, by at least about 100-fold, by at least about 200-fold, by at least about 300-fold, by at least about 400-fold, by at least about 500-fold, by at least about 750-fold, or by at least about 1000-fold, compared to a reference cell (e.g., corresponding cell that was not modified as described herein). In some aspects, the reduced expression of the NR4A family member can increase the effector function of the cell by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, compared to a reference cell. [0442] Accordingly, in some aspects, immune cells provided herein have been modified to exhibit a reduced expression of a member of the NR4A family and cultured in a medium comprising potassium ion at a concentration higher than 5 mM, such that after the modification and the culturing, the effector function of the immune cells, e.g., in response to persistent antigen stimulation, is increased compared to reference cells. [0443] In some aspects, a cell modified as described herein retains effector function, e.g., increased cytokine (e.g., IFN-γ, TNF-α, and/or IL-2) production, granzyme release, and/or cytotoxicity (e.g., ability to kill relevant target cells) for at least one, at least two, at least three, or more, additional rounds in an antigen stimulation assay, such as a serial, chronic or sequential stimulation assay (such as that described in Zhao et al., 2015 Cancer Cell 28(4):415-428; Kunkele et al., 2015 Cancer Immunology Research 3(4):368-379; each of which is incorporated herein by reference in its entirety) as compared to reference immune cells. [0444] In some aspects, as compared to the reference immune cells, the modified immune cells provided herein are able to produce higher amounts of cytokines (e.g., IFN-γ and/or IL-2) after at least two rounds of antigen stimulation, after at least three rounds of antigen stimulation, after at least four rounds of antigen stimulation, after at least five rounds of antigen stimulation, after at least six rounds of antigen stimulation. Accordingly, in some aspects, provided herein is a method of increasing the production of a cytokine by immune cells in response to antigen stimulation, wherein the method comprises culturing the immune cells in a medium comprising potassium ion at a concentration higher than 5 mM. [0445] In some aspects, after the culturing, the production of the cytokine by the modified immune cells provided herein in response to an antigen stimulation is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750- fold, or at least about 1,000-fold or more, as compared to reference cells (e.g., described herein). In some aspects, after the culturing, the production of the cytokine by the modified immune cells in response to an antigen stimulation is increased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100%, as compared to the reference cell. NR4A Family [0446] As described herein, immune cells provided herein (e.g., modified and cultured in a medium comprising potassium ion at a concentration higher than 5 mM) exhibit a reduced expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3). The NR4A family of orphan nuclear receptors includes NR4A1 (Nur77), NR4A2 (Nurr1), and NR4A3 (Nor-1). They work as transcription factors in a ligand-independent manner. Their functions are mostly controlled by the rapid and transient induction of their expression by a variety of extracellular signals, and thus are considered as immediate-early genes. The NR4As are involved in various cellular functions including apoptosis, survival, proliferation, angiogenesis, inflammation, DNA repair, and fatty acid metabolism. NR4A3 [0447] Nuclear Receptor Subfamily 4 Group A Member 3, generally abbreviated "NR4A3," and also known as MINOR, CSMF, NOR1, CHN, Mitogen-Induced Nuclear Orphan Receptor, Neuron-Derived Orphan Receptor, Nuclear Hormone Receptor NOR-1, “Chondrosarcoma, Extraskeletal Myxoid, Fused to EWS,” and TEC, is a protein which in humans is encoded by the NR4A3 gene. The NR4A3 gene is located on chromosome 9 (bases 99,821,885 to 99,866,893; 45,039 bases; plus strand orientation; NCBI Reference Sequence: NC_000009.12). NR4A3 is a transcriptional activator that binds to regulatory elements in promoter regions in a cell- and response element (target)-specific manner. NR4A3 induces gene expression by binding as monomers to the NR4A1 response element (NBRE) 5'-AAAAGGTCA-3' site and as homodimers to the Nur response element (NurRE) site in the promoter of their regulated target genes (by similarity) and plays a role in the regulation of proliferation, survival, and differentiation of many different cell types. [0448] The NR4A3 proteins have three isoforms produced by alternative splicing. The sequences are shown in the Table 1 below. Table 1. NR4A3 protein isoforms. [0449] In some aspects, immune cells provided herein (e.g., modified and cultured in a medium comprising potassium ion at a concentration higher than 5 mM) exhibit reduced expression level of NR4A3 gene and/or NR4A3 protein. In some aspects, such modified immune cells also have reduced level of one of the following: (i) NR4A1 gene and/or NR4A1 protein; (ii) NR4A2 gene and/or NR4A2 protein; or (iii) both (i) and (ii). Therefore, unless indicated otherwise, modified immune cells having reduced level of NR4A3 gene and/or NR4A3 protein can have endogenous (i.e., normal level) or reduced expression of the other members of the NR4A family. As used herein, the term “NR4A3 gene” refers to any transcript, genomic DNA, pre-mRNA, or mRNA. As used herein, the term “NR4A3 protein” refers to isoform alpha, isoform beta, or isoform 3 disclosed above, as well as variants and mutants thereof. As used herein, the term NR4A3 protein also encompasses any fragment or variant of any of the isoforms disclosed herein that has at least one function of the wild type NR4A3 protein. [0450] In some aspects, the NR4A3 expression level of an immune cell provided herein (e.g., modified and cultured in a medium comprising potassium ion at a concentration higher than 5 mM) is reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference immune cell. In some aspects, the reference immune cell comprises one or more of the following (a) corresponding cells that have not been modified to exhibit reduced NR4A3 expression and cultured in a metabolic reprogramming media, (b) corresponding cells that have been modified to exhibit reduced NR4A3 expression and cultured in a non-metabolic reprogramming media (e.g., in a medium that does not comprise potassium ion at a concentration higher than 5 mM), (c) corresponding cells that have not been modified to exhibit reduced NR4A3 expression and cultured in a non-metabolic reprogramming media. In some aspects, the NR4A3 expression of immune cells provided herein (e.g., modified and cultured using the methods provided herein) is completely inhibited. NR4A2 [0451] Nuclear receptor subfamily 4 group A member 2, generally abbreviated NR4A2, also known as NOT, RNR1, HZF-3, NURR1, TINUR, is a protein which in humans is encoded by the NR4A2 gene. The NR4A2 gene is located on chromosome 2 (bases 156,324,432 to 156,332,724, NCBI Reference Sequence: NC_000002.12). The NR4A2 proteins have two isoforms produced by alternative splicing. The sequences are shown in Table 2 below. Table 2. NR4A2 protein isoforms. [0452] In some aspects, immune cells provided herein (e.g., modified and cultured in a medium comprising potassium ion at a concentration higher than 5 mM) exhibit reduced expression of NR4A2 gene and/or NR4A2 protein. In some aspects, such modified immune cells also has reduced level of one of the following: (i) NR4A1 gene and/or NR4A1 protein; (ii) NR4A3 gene and/or NR4A3 protein; or (iii) both (i) and (ii). Therefore, unless indicated otherwise, modified immune cells having reduced level of NR4A2 gene and/or NR4A2 protein can have endogenous (i.e., normal level) or reduced expression of the other members of the NR4A family. As used herein, the term “NR4A2 gene” refers to any transcript, genomic DNA, pre-mRNA, or mRNA. As used herein, the term “NR4A2 protein” refers to isoform 1 or 2 disclosed above, as well as variants and mutants thereof. As used herein, the term NR4A2 protein also encompasses any fragment or variant of any of the isoforms disclosed herein that has at least one function of the wild type NR4A2 protein. [0453] In some aspects, the NR4A2 expression level of an immune cell provided herein (e.g., modified and cultured in a medium comprising potassium ion at a concentration higher than 5 mM) is reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference immune cell. In some aspects, the reference immune cell comprises one or more of the following (a) corresponding cells that have not been modified to exhibit reduced NR4A2 expression and cultured in a metabolic reprogramming media, (b) corresponding cells that have been modified to exhibit reduced NR4A2 expression and cultured in a non-metabolic reprogramming media (e.g., in a medium that does not comprise potassium ion at a concentration higher than 5 mM), (c) corresponding cells that have not been modified to exhibit reduced NR4A2 expression and cultured in a non-metabolic reprogramming media. In some aspects, the NR4A2 expression of immune cells provided herein (e.g., modified and cultured using the methods provided herein) is completely inhibited. NR4A1 [0454] Nuclear Receptor Subfamily 4 Group A Member 1, generally abbreviated NR4A1, and also known as HMR, N10, TR3, NP10, GFRP1, NAK-1, NGFIB, and NUR77, is a protein which in humans is encoded by the NR4A1 gene. The NR4A1 gene is located on chromosome 12 (bases 52022832 to 52059507; NCBI Reference Sequence NC_000012.12). The NR4A1 proteins have three isoforms produced by alternative splicing. The sequences are shown in Table 3 below. Table 3. NR4A1 protein isoforms. [0455] In some aspects, immune cells provided herein (e.g., modified and cultured in a medium comprising potassium ion at a concentration higher than 5 mM) exhibit reduced expression of NR4A1 gene and/or NR4A1 protein. In some aspects, such modified immune cells also have reduced level of one of the following: (i) NR4A2 gene and/or NR4A2 protein; (ii) NR4A3 gene and/or NR4A3 protein; or (iii) both (i) and (ii). Therefore, unless indicated otherwise, modified immune cells having reduced level of NR4A1 gene and/or NR4A1 protein can have endogenous or reduced expression of the other members of the NR4A family. As used herein, the term “NR4A1 gene” refers to any transcript, genomic DNA, pre-mRNA, or mRNA. As used herein, the term “NR4A1 protein” refers to isoform 1, isoform 2, or isoform 3 disclosed above, as well as variants and mutants thereof. As used herein, the term NR4A1 protein also encompasses any fragment or variant of any of the isoforms disclosed herein that has at least one function of the wild type NR4A1 protein. [0456] In some aspects, the NR4A1 expression level of an immune cell provided herein (e.g., modified and cultured in a medium comprising potassium ion at a concentration higher than 5 mM) is reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference immune cell. In some aspects, the reference immune cell comprises one or more of the following (a) corresponding cells that have not been modified to exhibit reduced NR4A1 expression and cultured in a metabolic reprogramming media, (b) corresponding cells that have been modified to exhibit reduced NR4A1 expression and cultured in a non-metabolic reprogramming media (e.g., in a medium that does not comprise potassium ion at a concentration higher than 5 mM), (c) corresponding cells that have not been modified to exhibit reduced NR4A1 expression and cultured in a non-metabolic reprogramming media. In some aspects, the NR4A1 expression of immune cells provided herein (e.g., modified and cultured using the methods provided herein) is completely inhibited. NR4A-Targeting Gene Editing Tools [0457] As described herein, in some aspects, modifying an immune cell (e.g., T cell and/or NK cell) to reduce the expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3) comprises contacting the immune cells with a gene editing tool that is capable of reducing the expression of the NR4A family member. [0458] Gene editing, e.g., base editing, can be conducted using any editing tool known in the art. For example, in some aspects a modified cell (e.g., an immune cell) can be modified using techniques such as CRISPR/Cas, TALEN, Zinc finger nucleases (ZFN), meganucleases, restriction endonucleases, interference RNAs (RNAi), or antisense oligonucleotides. In some aspects, a NR4A (NR4A1, NR4A2, and/or NR4A3) gene and/or expression can also be modified using shRNA, siRNA, or miRNA. All these techniques are discussed more in detail below. In some aspects, the method used for reducing the expression of a NR4A (NR4A1, NR4A2, and/or NR4A3) gene and/or protein comprises using one or more gene editing tools (e.g., two, three, or more tools). In some aspects, the method used for reducing the expression of a NR4A (NR4A1, NR4A2, and/or NR4A3) gene and/or protein comprises at least one method acting on NR4A DNA (e.g., CRISPR) or RNA (e.g., antisense oligonucleotides) and at least one method acting on NR4A protein (e.g., inhibition of binding to cell signaling partner or post-translational modifications). [0459] In some aspects, cells (e.g., immune cells) modified as disclosed herein, e.g., by using a gene editing tool to reduce or abolish NR4A (NR4A1, NR4A2, and/or NR4A3) gene levels, can be further modified to express a ligand binding protein (e.g., CAR or a TCR). Accordingly, in some aspects, a method of preparing an immune cell described herein comprises modifying an immune cell with (i) a gene editing tool (e.g., capable of specifically targeting one or more members of the NR4A family), and (ii) a nucleotide sequence encoding a ligand binding protein (e.g., CAR or TCR). In some aspects, a gene editing tool useful for the present disclosure comprises a guide RNA that specifically targets a NR4a transcript described herein (e.g., mRNA encoding NR4A1, NR4A2, and/or NR4A3). Non-limiting examples of such guide RNAs are provided in Tables 4 and 5. As described herein, in some aspects, the gene editing tool comprises a guide RNA which comprises, consists essentially of, or consists of the sequence set forth in any one of SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 161, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 186, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, or SEQ ID NO: 133. (See, e.g., Tables 4 and 5). Non-limiting examples of other gene editing tools that can be used are further described elsewhere in the present disclosure. Table 4. NR4A1 and NR4A2-specific guide RNAs Table 5. NR4A3-specific guide RNAs [0460] One or more gene editing tools can be used to modify the cells of the present disclosure. Non-limiting examples of the gene editing tools are disclosed below: CRISPR/Cas System [0461] In some aspects, the gene editing tool that can be used in the present disclosure comprises a CRISPR/Cas system. Such systems can employ, for example, a nucleic acid molecule encoding a Cas9 nuclease, which in some instances, is codon-optimized for the desired cell type in which it is to be expressed (e.g., T cells, e.g., CAR-expressing or engineered TCR-expressing T cells). As further described herein, in some aspects, such a system can comprise a Cas9 nuclease protein. [0462] CRISPR/Cas systems use Cas nucleases, e.g., Cas9 nucleases, that are targeted to a genomic site by complexing with a guide RNA (e.g., synthetic guide RNA) (gRNA) that hybridizes to a target DNA sequence immediately preceding an NGG motif recognized by the Cas nuclease, e.g., Cas9. This results in a double-strand break three nucleotides upstream of the NGG motif. A unique capability of the CRISPR/Cas9 system is the ability to simultaneously target multiple distinct genomic loci by co-expressing a single Cas9 protein with two or more gRNAs (e.g., at least one, two, three, four, five, six, seven, eight, nine or ten gRNAs). Such systems can also employ a guide RNA that comprises two separate molecules. In some aspects, the two-molecule gRNA comprises a crRNA-like ("CRISPR RNA" or "targeter-RNA" or "crRNA" or "crRNA repeat") molecule and a corresponding tracrRNA-like ("trans-acting CRISPR RNA" or "activator-RNA" or "tracrRNA" or "scaffold") molecule. [0463] A crRNA comprises both the DNA-targeting segment (single stranded) of the gRNA and a stretch of nucleotides that forms one half of a double stranded RNA (dsRNA) duplex of the protein-binding segment of the gRNA. A corresponding tracrRNA (activator- RNA) comprises a stretch of nucleotides that forms the other half of the dsRNA duplex of the protein-binding segment of the gRNA. Thus, a stretch of nucleotides of a crRNA is complementary to and hybridizes with a stretch of nucleotides of a tracrRNA to form the dsRNA duplex of the protein-binding domain of the gRNA. As such, each crRNA can be said to have a corresponding tracrRNA. The crRNA additionally provides the single stranded DNA-targeting segment. Accordingly, a gRNA comprises a sequence that hybridizes to a target sequence (e.g., NR4A1, NR4A2, and/or NR4A3 mRNA), and a tracrRNA. Thus, a crRNA and a tracrRNA (as a corresponding pair) hybridize to form a gRNA. If used for modification within a cell, the exact sequence and/or length of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecules will be used (e.g., humans). [0464] Naturally-occurring genes encoding the three elements (Cas9, tracrRNA and crRNA) are typically organized in operon(s). Naturally-occurring CRISPR RNAs differ depending on the Cas9 system and organism but often contain a targeting segment of between 21 to 72 nucleotides length, flanked by two direct repeats (DR) of a length of between 21 to 46 nucleotides (see, e.g., WO2014/131833). In the case of S. pyogenes, the DRs are 36 nucleotides long and the targeting segment is 30 nucleotides long. The 3′ located DR is complementary to and hybridizes with the corresponding tracrRNA, which in turn binds to the Cas9 protein. [0465] Alternatively, a CRISPR system used herein can further employ a fused crRNA- tracrRNA construct (i.e., a single transcript) that functions with the codon-optimized Cas9. This single RNA is often referred to as a guide RNA or gRNA. Within a gRNA, the crRNA portion is identified as the "target sequence" for the given recognition site and the tracrRNA is often referred to as the "scaffold." Briefly, a short DNA fragment containing the target sequence is inserted into a guide RNA expression plasmid. The gRNA expression plasmid comprises the target sequence (in some aspects around 20 nucleotides), a form of the tracrRNA sequence (the scaffold) as well as a suitable promoter that is active in the cell and necessary elements for proper processing in eukaryotic cells. Many of the systems rely on custom, complementary oligos that are annealed to form a double stranded DNA and then cloned into the gRNA expression plasmid. [0466] The gRNA expression cassette and the Cas9 expression cassette are then introduced into the cell. See, for example, Mali P et al., (2013) Science 2013 Feb.15; 339(6121):823- 6; Jinek M et al., Science 2012 Aug. 17; 337(6096):816-21; Hwang W Y et al., Nat Biotechnol 2013 March; 31(3):227-9; Jiang W et al., Nat Biotechnol 2013 March; 31(3):233-9; and Cong L et al., Science 2013 Feb.15; 339(6121):819-23, each of which is herein incorporated by reference in its entirety. See also, for example, WO/2013/176772 A1, WO/2014/065596 A1, WO/2014/089290 A1, WO/2014/093622 A2, WO/2014/099750 A2, and WO/2013142578 A1, each of which is herein incorporated by reference in its entirety. [0467] In some aspects, the Cas9 nuclease can be provided in the form of a protein. For instance, in some aspects, a cell useful for the present disclosure (e.g., CAR or TCR expressing immune cell) can be modified (e.g., to have reduced level of a NR4A gene and/or NR4A protein) by introducing a Cas9 nuclease protein and a nucleic acid molecule comprising a gRNA. In some aspects, the Cas9 nuclease protein and the nucleic acid molecule comprising a gRNA can be introduced into the cell sequentially. In some aspects, the Cas9 nuclease protein and the nucleic acid molecule comprising a gRNA can be introduced into the cell concurrently. For instance, in some aspects, the concurrent administration comprises introducing the Cas9 nuclease protein and the nucleic acid molecule comprising a gRNA at the same time but as separate compositions. In some aspects, the Cas9 protein can be provided in the form of a complex with the nucleic acid molecule comprising a gRNA (i.e., as a single composition). [0468] In some aspects, the Cas9 nuclease can be provided in the form of a nucleic acid encoding the protein. Accordingly, in some aspects, a cell useful for the present disclosure (e.g., CAR or TCR expressing immune cell) can be modified (e.g., to have reduced level of a NR4A gene and/or NR4A protein) by introducing a first nucleic acid molecule encoding a Cas9 nuclease protein and a second nucleic acid molecule comprising a gRNA. In some aspects, the first and second nucleic acid molecules can be introduced the cell sequentially. In some aspects, the first and second nucleic acid molecules can be introduced into the cell concurrently. For instance, in some aspects, the first and second nucleic acid molecules can be introduced into the cell at the same time but as separate compositions. In some aspects, the first and second nucleic acid molecules can be part of a single polynucleotide, and the cell is modified to comprise the single polynucleotide. [0469] The nucleic acid encoding the Cas9 nuclease can be RNA (e.g., messenger RNA (mRNA)) or DNA. In some aspects, the gRNA can be provided in the form of RNA. In some aspects, the gRNA can be provided in the form of DNA encoding the RNA. In some aspects, the gRNA can be provided in the form of separate crRNA and tracrRNA molecules, or separate DNA molecules encoding the crRNA and tracrRNA, respectively. [0470] In some aspects, the gRNA comprises a third nucleic acid sequence encoding a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA). In some aspects, the Cas protein is a type I Cas protein. In some aspects, the Cas protein is a type II Cas protein. In some aspects, the type II Cas protein is Cas9. In some aspects, the type II Cas, e.g., Cas9, is a human codon- optimized Cas. [0471] In some aspects, the Cas protein is a "nickase" that can create single strand breaks (i.e., "nicks") within the target nucleic acid sequence without cutting both strands of double stranded DNA (dsDNA). Cas9, for example, comprises two nuclease domains—a RuvC- like nuclease domain and an HNH-like nuclease domain—which are responsible for cleavage of opposite DNA strands. Mutation in either of these domains can create a nickase. Examples of mutations creating nickases can be found, for example, WO/2013/176772 A1 and WO/2013/142578 A1, each of which is herein incorporated by reference. [0472] In some aspects, two separate Cas proteins (e.g., nickases) specific for a target site on each strand of dsDNA can create overhanging sequences complementary to overhanging sequences on another nucleic acid, or a separate region on the same nucleic acid. The overhanging ends created by contacting a nucleic acid with two nickases specific for target sites on both strands of dsDNA can be either 5′ or 3′ overhanging ends. For example, a first nickase can create a single strand break on the first strand of dsDNA, while a second nickase can create a single strand break on the second strand of dsDNA such that overhanging sequences are created. The target sites of each nickase creating the single strand break can be selected such that the overhanging end sequences created are complementary to overhanging end sequences on a different nucleic acid molecule. The complementary overhanging ends of the two different nucleic acid molecules can be annealed by the methods disclosed herein. In some aspects, the target site of the nickase on the first strand is different from the target site of the nickase on the second strand. [0473] In some aspects, the expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3) is reduced by contacting the cell with a CRISPR (e.g., CRISPR-Cas9 system) that can specifically target a gene encoding the NR4A family member. In some aspects, the CRISPR is specific to the NR4A1 gene. Accordingly, in some aspects, after the contacting with the CRISPR, the cell (e.g., CAR or TCR expressing immune cell) has: (i) a reduced level of the NR4A1 gene and/or protein, (ii) endogenous level of the NR4A2 gene and/or protein, and (iii) endogenous level of the NR4A3 gene and/or protein. In some aspects, the CRISPR is specific for the NR4A2 gene. Accordingly, in some aspects, after the contacting with the CRISPR, the cell (e.g., CAR or TCR expressing immune cell) has: (i) endogenous level of the NR4A1 gene and/or protein, (ii) reduced level of the NR4A2 gene and/or protein, and (iii) endogenous level of the NR4A3 gene and/or protein. In some aspects, the CRISPR is specific for the NR4A3 gene. Accordingly, in some aspects, after the contacting with the CRISPR, the cell (e.g., CAR or TCR expressing immune cell) has: (i) endogenous level of the NR4A1 gene and/or protein, (ii) endogenous level of the NR4A2 gene and/or protein, and (iii) reduced level of the NR4A3 gene and/or protein. [0474] As described herein, in some aspects, the CRISPR targets multiple NR4A genes. For instance, in some aspects, the CRISPR is capable of targeting both the NR4A1 gene and the NR4A2 gene. Accordingly, in some aspects, after the contacting with the CRISPR, the cell (e.g., CAR or TCR expressing immune cell) has: (i) reduced level of the NR4A1 gene and/or protein, (ii) reduced level of the NR4A2 gene and/or protein, and (iii) endogenous level of the NR4A3 gene and/or protein. In some aspects, the CRISPR is capable of targeting both the NR4A1 gene and the NR4A3 gene. Accordingly, in some aspects, after the contacting with the CRISPR, the cell (e.g., CAR or TCR expressing immune cell) has: (i) reduced level of the NR4A1 gene and/or protein, (ii) endogenous level of the NR4A2 gene and/or protein, and (iii) reduced level of the NR4A3 gene and/or protein. In some aspects, the CRISPR is capable of targeting both the NR4A2 gene and/or the NR4A3 gene. In some aspects, after the contacting with the CRISPR, the cell (e.g., CAR or TCR expressing immune cell) has: (i) endogenous level of the NR4A1 gene and/or protein, (ii) reduced level of the NR4A2 gene and/or protein, and (iii) reduced level of the NR4A3 gene and/or protein. In some aspects, the CRISPR is capable of targeting the NR4A1 gene, the NR4A2 gene, and the NR4A3 gene. Accordingly, in some aspects, after the contacting with the CRISPR, the cell (e.g., CAR or TCR expressing immune cell) has: (i) reduced level of the NR4A1 gene and/or protein, (ii) reduced level of the NR4A2 gene and/or protein, and (iii) reduced level of the NR4A3 gene and/or protein. [0475] In some aspects, gene editing using CRISPR reduces the level of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% as compared to a reference cell (e.g., a corresponding cell that has not been subjected to gene editing using CRISPR). In some aspects, the CRISPR completely abolishes the expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3) in the immune cells. In some aspects, the NR4A expression can be measured using any technique known in the art, e.g., by digital droplet PCR. [0476] In some aspects, a nucleic acid encoding a gRNA and/or a Cas9 disclosed herein is an RNA or a DNA. In some aspects, the RNA or DNA encoding a gRNA and/or a Cas9 disclosed herein is a synthetic RNA or a synthetic DNA, respectively. In some aspects, the synthetic RNA or DNA comprises at least one unnatural nucleobase. In some aspects, all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 5-methoxyuridine or pseudouridine). In some aspects, the polynucleotide (e.g., a synthetic RNA or a synthetic DNA) comprises only natural nucleobases, i.e., A, C, T and U in the case of a synthetic DNA, or A, C, T, and U in the case of a synthetic RNA or synthetic DNA. [0477] In general, the CRISPR gene editing methods disclosed herein comprise contacting a cell, e.g., an immune cell, in vivo, in vitro, or ex vivo with (i) a Cas9 or a nucleic acid encoding the Cas9; and, (ii) at least one guide RNA (gRNA) or a nucleic acid encoding the gRNA, wherein the gRNA targets a sequence in the NR4A gene (e.g., an intron and/or exon sequence), wherein contacting the cell with the Cas9 and the at least one gRNA results in a reduction of the expression of the NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3). [0478] In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of any one or more of the sequences set forth in SEQ ID NOs: 151-158, 161, 165, 167, 168, 170, 171, 175, 176, 182, 183, 186, 194, and 196. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 151. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 151. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 151. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 151. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 152. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 152. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 152. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 152. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 153. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 153. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 153. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 153. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 154. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 154. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 154. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 154. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 155. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 155. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 155. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 155. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 156. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 156. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 156. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 156. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 157. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 157. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 157. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 157. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 158. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 158. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 158. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 158. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 161. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 161. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 161. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 161. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 165. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 165. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 165. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 165. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 167. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 167. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 167. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 167. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 168. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 168. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 168. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 168. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 170. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 170. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 170. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 170. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 171. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 171. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 171. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 171. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 175. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 175. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 175. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 175. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 176. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 176. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 176. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 176. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 182. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 182. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 182. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 182. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 183. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 183. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 183. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 183. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 186. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 186. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 186. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 186. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 194. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 194. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 194. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 194. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 196. In some aspects, a gRNA that can be used to target the NR4A3 gene comprises the sequence set forth in SEQ ID NO: 196. In some aspects, a gRNA that can be used to target the NR4A3 gene consists of the sequence set forth in SEQ ID NO: 196. In some aspects, a gRNA that can be used to target the NR4A3 gene consists essentially of the sequence set forth in SEQ ID NO: 196. [0479] As described herein, in some aspects, the gene editing methods can further comprise reducing the level of (i) NR4A1 gene and/or NR4A1 protein, (ii) NR4A2 gene and/or NR4A2 protein, or (iii) both (i) and (ii). In some aspects, a gRNA that can be used to target the NR4A1 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 125. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises the sequence set forth in SEQ ID NO: 125. In some aspects, a gRNA that can be used to target the NR4A1 gene consists of the sequence set forth in SEQ ID NO: 125. In some aspects, a gRNA that can be used to target the NR4A1 gene consists essentially of the sequence set forth in SEQ ID NO: 125. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 126. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises the sequence set forth in SEQ ID NO: 126. In some aspects, a gRNA that can be used to target the NR4A1 gene consists of the sequence set forth in SEQ ID NO: 126. In some aspects, a gRNA that can be used to target the NR4A1 gene consists essentially of the sequence set forth in SEQ ID NO: 126. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 130. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises the sequence set forth in SEQ ID NO: 130. In some aspects, a gRNA that can be used to target the NR4A1 gene consists of the sequence set forth in SEQ ID NO: 130. In some aspects, a gRNA that can be used to target the NR4A1 gene consists essentially of the sequence set forth in SEQ ID NO: 130. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 131. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises the sequence set forth in SEQ ID NO: 131. In some aspects, a gRNA that can be used to target the NR4A1 gene consists of the sequence set forth in SEQ ID NO: 131. In some aspects, a gRNA that can be used to target the NR4A1 gene consists essentially of the sequence set forth in SEQ ID NO: 131. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 132. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises the sequence set forth in SEQ ID NO: 132. In some aspects, a gRNA that can be used to target the NR4A1 gene consists of the sequence set forth in SEQ ID NO: 132. In some aspects, a gRNA that can be used to target the NR4A1 gene consists essentially of the sequence set forth in SEQ ID NO: 132. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 133. In some aspects, a gRNA that can be used to target the NR4A1 gene comprises the sequence set forth in SEQ ID NO: 133. In some aspects, a gRNA that can be used to target the NR4A1 gene consists of the sequence set forth in SEQ ID NO: 133. In some aspects, a gRNA that can be used to target the NR4A1 gene consists essentially of the sequence set forth in SEQ ID NO: 133. In some aspects, a gRNA that can be used to target the NR4A2 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 127. In some aspects, a gRNA that can be used to target the NR4A2 gene comprises the sequence set forth in SEQ ID NO: 127. In some aspects, a gRNA that can be used to target the NR4A2 gene consists of the sequence set forth in SEQ ID NO: 127. In some aspects, a gRNA that can be used to target the NR4A2 gene consists essentially of the sequence set forth in SEQ ID NO: 127. In some aspects, a gRNA that can be used to target the NR4A2 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 128. In some aspects, a gRNA that can be used to target the NR4A2 gene comprises the sequence set forth in SEQ ID NO: 128. In some aspects, a gRNA that can be used to target the NR4A2 gene consists of the sequence set forth in SEQ ID NO: 128. In some aspects, a gRNA that can be used to target the NR4A2 gene consists essentially of the sequence set forth in SEQ ID NO: 128. In some aspects, a gRNA that can be used to target the NR4A2 gene comprises, consists of, or consists essentially of the sequence set forth in SEQ ID NO: 129. In some aspects, a gRNA that can be used to target the NR4A2 gene comprises the sequence set forth in SEQ ID NO: 129. In some aspects, a gRNA that can be used to target the NR4A2 gene consists of the sequence set forth in SEQ ID NO: 129. In some aspects, a gRNA that can be used to target the NR4A2 gene consists essentially of the sequence set forth in SEQ ID NO: 129. [0480] As used herein, the term "contacting" (for example, contacting a cell, e.g., an immune cell with at least one gRNA and at least one Cas9) is intended to include incubating at least one gRNA and at least one Cas protein, e.g., Cas9, in the cell together in vitro (e.g., adding the gRNA and/or Cas protein, or nucleic acid(s) encoding the gRNA(s) and/or Cas9 protein(s) to cells in culture) or contacting a cell in vivo or ex vivo. [0481] The step of contacting an NR4A (NR4A1, NR4A2, and/or NR4A3) gene target sequence with at least one gRNA and at least one Cas protein, e.g., Cas9, as disclosed herein (or at least one nucleic acid encoding them) can be conducted in any suitable manner. For example, the cells, e.g., immune cells, can be treated in cell culture conditions. It is understood that the cells contacted with at least one gRNA and at least one Cas protein, e.g., a Cas9 protein, disclosed herein (or at least one nucleic acid encoding them) can also be simultaneously or subsequently contacted with another agent, e.g., a vector comprising at least one nucleic acid sequence encoding a CAR or a TCR. In some aspects, after the cell has been contacted in vitro or ex vivo, the method further comprises introducing the cell into the subject, thereby treating or ameliorating the symptoms of a disease or condition, e.g., cancer. [0482] For ex vivo methods, cells can include autologous cells, i.e., an immune cell or cells taken from a subject who is in need of altering a target polynucleotide sequence (e.g., the NR4A (NR4A1, NR4A2, and/or NR4A3) gene) in the cell or cells (i.e., the donor and recipient are the same individual). Autologous cells have the advantage of avoiding any immunologically-based rejection of the cells. Alternatively, the cells can be heterologous, e.g., taken from a donor. Typically, when the cells come from a donor, they will be from a donor who is sufficiently immunologically compatible with the recipient, i.e., will not be subject to transplant rejection, to lessen or remove the need for immunosuppression. In some aspects, the cells are taken from a xenogeneic source, i.e., a non-human mammal that has been genetically engineered to be sufficiently immunologically compatible with the recipient, or the recipient's species. Methods for determining immunological compatibility are known in the art, and include tissue typing to assess donor-recipient compatibility for HLA and ABO determinants. See, e.g., Transplantation Immunology, Bach and Auchincloss, Eds. (Wiley, John & Sons, Incorporated 1994). [0483] In some aspects, the present disclosure provides a method of generating a modified immune cell comprising altering the NR4A (NR4A1, NR4A2, and/or NR4A3) gene sequence in a cell, e.g., an immune cell (such as a T cell), ex vivo by contacting the NR4A gene sequence in the cell with a Cas9 protein (or a nucleic acid encoding such Cas9 protein) and one gRNA which target motifs in the NR4A (NR4A1, NR4A2, and/or NR4A3) gene (for example motifs located in exons 3 and 4 of NR4A3, wherein the gRNAs direct the Cas9 protein to the target gene and hybridize to the target motifs, wherein the NR4A gene is partially or totally cleaved, and wherein the efficiency of cleavage is from about 10% to about 100%. Non-limiting examples of such gRNAs are provided herein (see, e.g., Tables 4 and 5). As described herein, in some aspects, the method of generating a modified immune cell described herein comprises altering the NR4A gene sequence by contacting the cell with a first nucleic acid molecule encoding the Cas9 protein and a second nucleic acid molecule comprising a gRNA that targets one or more members of the NR4A gene family. In some aspects, the first and nucleic acid molecules are contacted with the cell sequentially. In some aspects, the first and nucleic acid molecules are contacted with the cell concurrently. For instance, in some aspects, the cell is contacted with a single polynucleotide comprising the first nucleic acid molecule encoding the Cas9 protein and the second nucleic acid molecule comprising a gRNA. [0484] In some aspects, the cell has been modified (e.g., transfected) with a nucleic acid (e.g., a vector) encoding a ligand binding protein (e.g., CAR or a TCR) previously, subsequently, or concurrently to the altering step described above. [0485] In some aspects, the efficiency of cleavage is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%. [0486] The CRISPR/Cas system of the present disclosure can use gRNA spacer sequences of varying lengths, depending on the Cas used, e.g., a Cas9. Cas9 from different species must be paired with their corresponding gRNAs to form a functional ribonucleoprotein (RNP) complex, in other words, chimeric gRNA frames engineered from different bacterial species can have different length due to differences in spacer sequence and chimeric frame sequence. [0487] In some aspects, the gRNA spacer sequence can be least about 18 nucleotides (e.g., about 18, about 19, about 20, about 21, or about 22 nucleotides) long. For example, the length of S. pyogenes gRNA spacer sequences in gRNAs binding to S. pyogenes Cas9 is 20 nucleotides, while the length of S. aureus gRNA spacer sequences in gRNAs binding to S. aureus Cas9 is 21 nucleotides. In some aspects, the gRNA spacer sequence can comprise 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleotides. [0488] Although a perfect match between the gRNA spacer sequence and the DNA strand to which it binds on the NR4A (NR4A1, NR4A2, and/or NR4A3) gene is preferred, a mismatch between a gRNA spacer sequence and a NR4A target sequence is also permitted as along as it still results in a reduction of NR4A gene levels or a decrease in NR4A gene function. A "seed" sequence of between about 8- about 12 consecutive nucleotides on the gRNA perfectly complementary to the target NR4A sequence is preferred for proper recognition of the target sequence on the NR4A gene. The remainder of the gRNA spacer sequence can comprise one or more mismatches. [0489] In general, gRNA activity is inversely correlated with the number of mismatches. Preferably, the gRNA spacer sequences of the present disclosure comprise less than about 7 mismatches. In some aspects, gRNA spacer sequence comprises 7 mismatches, 6 mismatches, 5 mismatches, 4 mismatches, 3 mismatches, more preferably 2 mismatches, or less, and even more preferably no mismatch, with the corresponding NR4A gene target sequence. The smaller the number of nucleotides in the gRNA the smaller the number of mismatches tolerated. The binding affinity is thought to depend on the sum of matching gRNA-DNA combinations. [0490] The gRNA spacer sequences of the present disclosure can be selected to minimize off-target effects of the CRISPR/Cas editing system. Accordingly, in some aspects, the gRNA spacer sequence is selected such that it contains at least two mismatches when compared with all other genomic nucleotide sequences in the cell. In some aspects, the gRNA spacer sequence is selected such that it contains at least one mismatch when compared with all other genomic nucleotide sequences in the cell. Those skilled in the art will appreciate that a variety of techniques can be used to select suitable gRNA spacer sequences for minimizing off-target effects (e.g., bioinformatics analyses). [0491] In some aspects, editing efficacy can be increased by targeting multiple location. [0492] In some aspects, two gRNAs are complementary to and/or hybridize to sequences on the same strand of the NR4A gene. In some aspects, two gRNAs are complementary to and/or hybridize to sequences on the opposite strands of the NR4A gene. In some aspects, the two gRNAs are not complementary to and/or do not hybridize to sequences on the opposite strands of the NR4A gene. In some aspects, two gRNAs are complementary to and/or hybridize to overlapping target motifs of the NR4A gene. In some aspect, two gRNAs are complementary to and/or hybridize to offset target motifs of the NR4A gene. [0493] In general, the gRNAs of the present disclosure can comprise any variant of its sequence or chemical modifications provided that it allows for the binding of the corresponding Cas protein, e.g., a Cas9 protein, to a target sequence, and subsequent ablation (total or partial) of the NR4A (NR4A1, NR4A2, and/or NR4A3) gene. [0494] The Cas proteins, e.g., Cas9, used in the methods disclosed herein are endonucleases that cleave nucleic acids and are encoded by the CRISPR loci of numerous bacterial genomes and is involved in the Type II CRISPR system. Cas9 proteins are produced by numerous species of bacteria including Streptococcus pyogenes, Staphylococcus aureus, Streptococcus thermophilus, Neisseria meningitidis, etc. Accordingly, the Cas9 protein useful for the present disclosure can be derived from any suitable bacteria known in the art. Non-limiting examples of such bacteria include Streptococcus pyogenes, Streptococcus mutans, Streptococcus pneumonia, Streptococcus aureus, Streptococcus thermophilus, Campylobacter jejuni, Neisseria meningitidis, Pasteurella multocida, Listeria innocua, and Francisella novicida. The methods disclosed herein can be practiced with any Cas9 known in the art. In some aspects, the Cas9 is a wild type Cas9. In some aspects, the Cas9 is a mutated Cas9 with enhanced enzymatic activity or a fusion protein comprising a Cas9 moiety. In some aspects, the Cas9 nuclease protein is Streptococcus pyogenes Cas9 protein. [0495] Because Cas9 nuclease proteins are normally expressed in bacteria, it can be advantageous to modify their nucleic acid sequences for optimal expression in eukaryotic cells (e.g., mammalian cells) when designing and preparing Cas9 recombinant proteins. Accordingly, in some aspects, the nucleic acid encoding a Cas9 used in the methods disclosed herein has been codon optimized for expression in eukaryotic cells, e.g., for expression in cell of a human subject in need thereof. [0496] In some aspects, a Cas9 protein used in the methods disclosed herein comprises one or more amino acid substitutions or modifications. In some aspects, the one or more amino acid substitutions comprises a conservative amino acid substitution. In some instances, substitutions and/or modifications can prevent or reduce proteolytic degradation and/or extend the half-life of the polypeptide in a cell. In some aspects, the Cas9 protein can comprise a peptide bond replacement (e.g., urea, thiourea, carbamate, sulfonyl urea, etc.). In some aspects, the Cas9 protein can comprise a naturally occurring amino acid. In some aspects, the Cas9 protein can comprise an alternative amino acid (e.g., D-amino acids, beta- amino acids, homocysteine, phosphoserine, etc.). In some aspects, the Cas9 protein can comprise a modification to include a heterologous moiety (e.g., PEGylation, glycosylation, lipidation, acetylation, end-capping, etc.). [0497] Although the methods disclosed herein are generally practiced using Cas9 proteins, it is envisioned that in some aspects, the Cas protein can be a Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, or Cas8. In some aspects, the Cas protein is Cas9 protein from any bacterial species or functional portion thereof. In some specific aspects, the Cas9 protein used in the methods disclosed herein is a Streptococcus pyogenes or Staphylococcus aureus Cas9 protein or a functional portion thereof, or a nucleic acid encoding such Cas9 or functional portion thereof. Non-limiting examples of other Cas nucleases that can be used are known in the art and described in, e.g., US 9,970,001 B2; US 10,221,398 B2; and US 2020/0190487 A1, each of which is incorporated herein by reference in its entirety. In some aspects, a Cas nuclease useful for the present disclosure comprises a Type I Cas protein. Non-limiting examples of Type I Cas proteins include Cas3, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, and variants thereof. In some aspects, a Cas nuclease useful for the present disclosure comprises a Type II Cas protein. Non-limiting examples of Type II Cas proteins include Cas9, Csn2, Cas4, and variants thereof. In some aspects, a Cas nuclease useful for the present disclosure comprises a Type III Cas protein. Non-limiting examples include Cas10, Csm2, Cmr5, Csx10, Csx11, and variants thereof. In some aspects, a Cas nuclease useful for the present disclosure comprises a Type IV Cas protein. Non-limiting example of such a Cas protein includes Csf1. In some aspects, a Cas nuclease useful for the present disclosure comprises a Type V Cas protein. Non-limiting examples include, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (Cas14, C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), C2c4, C2c8, C2c9, and variants thereof. In some aspects, a Cas nuclease useful for the present disclosure comprises a Type VI Cas protein. Non-limiting examples of Type VI Cas proteins include Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, and variants thereof. [0498] In some cases, a Cas protein useful for the present disclosure comprises orthologues or homologues of the above-mentioned Cas proteins. The terms “orthologue” (also referred to as “ortholog” herein) and “homologue” (also referred to as “homolog” herein) are well known in the art. By means of further guidance, a “homologue” of a protein as used herein is a protein of the same species which performs the same or a similar function as the protein it is a homologue of. Homologous proteins can but need not be structurally related, or are only partially structurally related. An “orthologue” of a protein as used herein is a protein of a different species which performs the same or a similar function as the protein it is an orthologue of. Orthologous proteins can but need not be structurally related, or are only partially structurally related. [0499] As used herein, "functional portion" refers to a portion of a peptide, e.g., Cas9, which retains its ability to complex with at least one gRNA and cleave a target sequence, resulting in reduced expression of the NR4A (NR4A1, NR4A2, and/or NR4A3) gene and/or protein. In some aspects, the functional portion comprises a combination of operably linked Cas9 protein functional domains selected from the group consisting of a DNA binding domain, at least one RNA binding domain, a helicase domain, and an endonuclease domain. In some aspects, the functional domains form a non-covalent complex. In some aspects, the functional domains form a fusion complex (e.g., a fusion protein). In some aspects, the functional domains are chemically linked (e.g., through one or more spacers or linkers). In some aspects, the functional domains are conjugated. [0500] It should be appreciated that the present disclosure contemplates various ways of contacting the NR4A (NR4A1, NR4A2, and/or NR4A3) gene with at least one gRNA and at least one Cas protein, e.g., Cas9. In some aspects, exogenous Cas protein, e.g., Cas9, can be introduced into the cell in polypeptide form. In some aspects, a Cas protein, e.g., Cas9, can be conjugated to or fused to a cell-penetrating polypeptide or cell-penetrating peptide. As used herein, "cell-penetrating polypeptide" and "cell-penetrating peptide" refers to a polypeptide or peptide, respectively, which facilitates the uptake of molecule into a cell. The cell- penetrating polypeptides can contain a detectable label. [0501] In some aspects, Cas protein, e.g., Cas9, can be conjugated to or fused to a charged protein, e.g., a protein that carries a positive, negative or overall neutral electric charge. Such linkage can be covalent. In some aspects, the Cas protein, e.g., Cas9, can be fused to a superpositively charged peptide to significantly increase the ability of the Cas protein, e.g., Cas9, to penetrate a cell. See Cronican et al. ACS Chem. Biol.5(8):747-52 (2010). In some aspects, the Cas protein, e.g., Cas9, can be fused to a protein transduction domain (PTD) to facilitate its entry into a cell. Exemplary PTDs include, but are not limited to, Tat, oligoarginine, and penetratin. Thus, in some specific aspects, the methods disclosed herein can be practiced using a Cas protein, e.g., a Cas9 protein, comprising a Cas protein fused to a cell-penetrating peptide, a Cas protein fused to a PTD, a Cas protein fused to a tat domain, a Cas protein fused to an oligoarginine domain, a Cas protein fused to a penetratin domain, or a combination thereof. [0502] In some aspects, the Cas protein, e.g., Cas9, can be introduced into a cell, e.g., an immune cell, such as an immune cell expressing a CAR or TCR, containing the target polynucleotide sequence, e.g., the NR4A (NR4A1, NR4A2, and/or NR4A3) gene, in the form of a nucleic acid encoding the Cas protein, e.g., Cas9. The process of introducing the nucleic acids into cells can be achieved by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some aspects, the nucleic acid comprises DNA. In some aspects, the nucleic acid comprises a modified DNA, as described herein. In some aspects, the nucleic acid comprises mRNA. In some aspects, the nucleic acid comprises a modified mRNA, as described herein (e.g., a synthetic, modified mRNA). [0503] The gRNA sequences and/or nucleic sequences encoding Cas9 used in the methods disclosed herein can be chemically modified to enhance, for example, their stability (e.g., to increase their plasma half-life after administration to a subject in need thereof). Possible chemical modifications to the gRNAs disclosed herein and/or nucleic sequences encoding, e.g., Cas9, are discussed in detail below in this specification. [0504] In some aspects, the entire gRNA is chemically modified. In some aspects, only the gRNA spacer is chemically modified. In some aspects, the gRNA spacer and gRNA frame sequence are chemically modified. Non-limiting examples of specific chemical modifications are disclosed in detail below. [0505] Accordingly, in some aspects of the methods disclosed herein, the Cas protein (e.g., Cas9) and one or more gRNAs are provided to a target cell through expression from one or more delivery vectors coding therefor. In some aspects, the above-mentioned vector or vectors for introducing the gRNA or gRNAs and Cas9 in a target cell are viral vectors. In some aspects, the above-mentioned vector or vectors for introducing the gRNA or gRNAs and Cas9 in a target cell are non-viral vectors. In some aspects, the viral vector is an adeno- associated vector (AAV), a lentiviral vector (LV), a retroviral vector, an adenovirus vector, a herpes virus vector, or a combination thereof. The AAV vector or vectors can be based on one or more of several capsid types, including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9. In some aspects, the AAV vector is AAVDJ-8, AAV2DJ9, or a combination thereof. [0506] In addition to the method disclosed above, the present disclosure further provides compositions to practice the disclosed methods. Accordingly, the present disclosure provides a nucleic acid encoding at least one the above-mentioned gRNAs. [0507] Also provided is a composition and/or at least one Cas9. In some aspects, the nucleic acid encoding Cas9 encodes (i) a Cas9 from S. aureus, (ii) a Cas9 from S. pyogenes, (iii) a mutant Cas9 derived from Cas9 from S. aureus or from Cas9 from S. pyogenes wherein the mutant protein retains Cas9 activity, (iv) a fusion protein comprising a Cas9 moiety, or (v) a combination thereof. [0508] In some aspects, one or more gene editing tools (e.g., those disclosed herein) can be used to modify the cells of the present disclosure. TALEN [0509] In some aspects, a gene editing tool that can be used to edit (e.g., reduce or inhibit) the expression of a NR4A (NR4A1, NR4A2, and/or NR4A3) gene and/or protein is a nuclease agent, such as a Transcription Activator-Like Effector Nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a prokaryotic or eukaryotic organism. TAL effector nucleases are created by fusing a native or engineered transcription activator- like (TAL) effector, or functional part thereof, to the catalytic domain of an endonuclease, such as, for example, FokI. [0510] The unique, modular TAL effector DNA binding domain allows for the design of proteins with potentially any given DNA recognition specificity. Thus, the DNA binding domains of the TAL effector nucleases can be engineered to recognize specific DNA target sites and thus, used to make double-strand breaks at desired target sequences. See, WO 2010/079430; Morbitzer et al., (2010) PNAS 10.1073/pnas.1013133107; Scholze & Boch (2010) Virulence 1:428-432; Christian et al., Genetics (2010) 186:757-761; Li et al., (2010) Nuc. Acids Res. (2010) doi:10.1093/nar/gkq704; and Miller et al., (2011) Nature Biotechnology 29:143-148; all of which are herein incorporated by reference in their entirety. [0511] Non-limiting examples of suitable TAL nucleases, and methods for preparing suitable TAL nucleases, are disclosed, e.g., in US Patent Application No. 2011/0239315 A1, 2011/0269234 A1, 2011/0145940 A1, 2003/0232410 A1, 2005/0208489 A1, 2005/0026157 A1, 2005/0064474 A1, 2006/0188987 A1, and 2006/0063231 A1 (each hereby incorporated by reference). [0512] In various aspects, TAL effector nucleases are engineered that cut in or near a target nucleic acid sequence in, e.g., a genomic locus of interest, wherein the target nucleic acid sequence is at or near a sequence to be modified by a targeting vector. The TAL nucleases suitable for use with the various methods and compositions provided herein include those that are specifically designed to bind at or near target nucleic acid sequences to be modified by targeting vectors as described herein. [0513] In some aspects, each monomer of the TALEN comprises about 12-about 25 TAL repeats, wherein each TAL repeat binds a 1 bp subsite. In some aspects, the nuclease agent is a chimeric protein comprising a TAL repeat-based DNA binding domain operably linked to an independent nuclease. In some aspects, the independent nuclease is a FokI endonuclease. In some aspects, the nuclease agent comprises a first TAL-repeat-based DNA binding domain and a second TAL-repeat-based DNA binding domain, wherein each of the first and the second TAL-repeat-based DNA binding domain is operably linked to a FokI nuclease, wherein the first and the second TAL-repeat-based DNA binding domain recognize two contiguous target DNA sequences in each strand of the target DNA sequence separated by about 6 bp to about 40 bp cleavage site, and wherein the FokI nucleases dimerize and make a double strand break at a target sequence. [0514] In some aspects, the nuclease agent comprises a first TAL-repeat-based DNA binding domain and a second TAL-repeat-based DNA binding domain, wherein each of the first and the second TAL-repeat-based DNA binding domain is operably linked to a FokI nuclease, wherein the first and the second TAL-repeat-based DNA binding domain recognize two contiguous target DNA sequences in each strand of the target DNA sequence separated by a 5 bp or 6 bp cleavage site, and wherein the FokI nucleases dimerize and make a double strand break. Zinc Finger Nuclease (ZFN) [0515] In some aspects, a gene editing tool useful for the present disclosure includes a nuclease agent, such as a zinc-finger nuclease (ZFN) system. Zinc finger-based systems comprise a fusion protein comprising two protein domains: a zinc finger DNA binding domain and an enzymatic domain. A “zinc finger DNA binding domain”, “zinc finger protein”, or “ZFP” is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The zinc finger domain, by binding to a target DNA sequence (e.g., NR4A1, NR4A2, or NR4A3), directs the activity of the enzymatic domain to the vicinity of the sequence and, hence, induces modification of the endogenous target gene in the vicinity of the target sequence. A zinc finger domain can be engineered to bind to virtually any desired sequence. As disclosed herein, in some aspects, the zinc finger domain binds a DNA sequence that encodes the NR4A (NR4A1, NR4A2, and/or NR4A3) protein. Accordingly, after identifying a target genetic locus containing a target DNA sequence at which cleavage or recombination is desired, one or more zinc finger binding domains can be engineered to bind to one or more target DNA sequences in the target genetic locus. Expression of a fusion protein comprising a zinc finger binding domain and an enzymatic domain in a cell, effects modification in the target genetic locus. [0516] In some aspects, a zinc finger binding domain comprises one or more zinc fingers. Miller et al., (1985) EMBO J. 4:1609-1614; Rhodes (1993) Scientific American February:56-65; U.S. Pat. No. 6,453,242. Typically, a single zinc finger domain is about 30 amino acids in length. An individual zinc finger binds to a three-nucleotide (i.e., triplet) sequence (or a four-nucleotide sequence which can overlap, by one nucleotide, with the four-nucleotide binding site of an adjacent zinc finger). Therefore, the length of a sequence to which a zinc finger binding domain is engineered to bind (e.g., a target sequence) will determine the number of zinc fingers in an engineered zinc finger binding domain. For example, for ZFPs in which the finger motifs do not bind to overlapping subsites, a six- nucleotide target sequence is bound by a two-finger binding domain; a nine-nucleotide target sequence is bound by a three-finger binding domain, etc. Binding sites for individual zinc fingers (i.e., subsites) in a target site need not be contiguous, but can be separated by one or several nucleotides, depending on the length and nature of the amino acids sequences between the zinc fingers (i.e., the inter-finger linkers) in a multi-finger binding domain. In some aspects, the DNA-binding domains of individual ZFNs comprise between three and six individual zinc finger repeats and can each recognize between about 9 and about 18 basepairs. [0517] Zinc finger binding domains can be engineered to bind to a sequence of choice. See, for example, Beerli et al., (2002) Nature Biotechnol.20:135-141; Pabo et al., (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al., (2001) Nature Biotechnol. 19:656-660; Segal et al., (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al., (2000) Curr. Opin. Struct. Biol. 10:411-416. An engineered zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein. Engineering methods include, but are not limited to, rational design and various types of selection. [0518] Selection of a target DNA sequence for binding by a zinc finger domain can be accomplished, for example, according to the methods disclosed in U.S. Pat. No.6,453,242. It will be clear to those skilled in the art that simple visual inspection of a nucleotide sequence can also be used for selection of a target DNA sequence. Accordingly, any means for target DNA sequence selection can be used in the methods described herein. A target site generally has a length of at least about 9 nucleotides and, accordingly, is bound by a zinc finger binding domain comprising at least three zinc fingers. However, binding of, for example, a 4-finger binding domain to a 12-nucleotide target site, a 5-finger binding domain to a 15-nucleotide target site or a 6-finger binding domain to an 18-nucleotide target site, is also possible. As will be apparent, binding of larger binding domains (e.g., 7-, 8-, 9- finger and more) to longer target sites is also possible. [0519] The enzymatic domain portion of the zinc finger fusion proteins can be obtained from any endo- or exonuclease. Exemplary endonucleases from which an enzymatic domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalogue, New England Biolabs, Beverly, Mass.; and Belfort et al., (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes which cleave DNA are known (e.g., 51 Nuclease; mung bean nuclease; pancreatic DNaseI; micrococcal nuclease; yeast HO endonuclease; see also Linn et al., (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains. [0520] Exemplary restriction endonucleases (restriction enzymes) suitable for use as an enzymatic domain of the ZFPs described herein are present in many species and are capable of sequence-specific binding to DNA (at a recognition site), and cleaving DNA at or near the site of binding. Certain restriction enzymes (e.g., Type IIS) cleave DNA at sites removed from the recognition site and have separable binding and cleavage domains. For example, the Type IIS enzyme FokI catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, U.S. Pat. Nos.5,356,802; 5,436,150 and 5,487,994; as well as Li et al., (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al., (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al., (1994a) Proc. Natl. Acad. Sci. USA 91:883- 887; Kim et al., (1994b) J. Biol. Chem.269: 31,978-31,982. Thus, in some aspects, fusion proteins comprise the enzymatic domain from at least one Type IIS restriction enzyme and one or more zinc finger binding domains. [0521] An exemplary Type IIS restriction enzyme, whose cleavage domain is separable from the binding domain, is FokI. This particular enzyme is active as a dimer. Bitinaite et al., (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Thus, for targeted double- stranded DNA cleavage using zinc finger-FokI fusions, two fusion proteins, each comprising a FokI enzymatic domain, can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two FokI enzymatic domains can also be used. Exemplary ZFPs comprising FokI enzymatic domains are described in US Patent No. 9,782,437, which is incorporated herein by reference in its entirety. Meganucleases [0522] In some aspects, a gene editing tool that be used to regulate NR4A (NR4A1, NR4A2, and/or NR4A3) expression in a cell includes a nuclease agent such as a meganuclease system. Meganucleases have been classified into four families based on conserved sequence motifs, the families are the "LAGLIDADG," "GIY-YIG," "H-N-H, " and "His-Cys box" families. These motifs participate in the coordination of metal ions and hydrolysis of phosphodiester bonds. [0523] HEases are notable for their long recognition sites, and for tolerating some sequence polymorphisms in their DNA substrates. Meganuclease domains, structure and function are known, see, for example, Guhan and Muniyappa (2003) Crit Rev Biochem Mol Biol 38:199-248; Lucas et al., (2001) Nucleic Acids Res 29:960-9; Jurica and Stoddard, (1999) Cell Mol Life Sci 55:1304-26; Stoddard, (2006) Q Rev Biophys 38:49-95; and Moure et al., (2002) Nat Struct Biol 9:764. [0524] In some examples a naturally occurring variant, and/or engineered derivative meganuclease is used. Methods for modifying the kinetics, cofactor interactions, expression, optimal conditions, and/or recognition site specificity, and screening for activity are known, see for example, Epinat et al., (2003) Nucleic Acids Res 31:2952-62; Chevalier et al., (2002) Mol Cell 10:895-905; Gimble et al., (2003) Mol Biol 334:993-1008; Seligman et al., (2002) Nucleic Acids Res 30:3870-9; Sussman et al., (2004) J Mol Biol 342:31-41; Rosen et al., (2006) Nucleic Acids Res 34:4791-800; Chames et al., (2005) Nucleic Acids Res 33:e178; Smith et al., (2006) Nucleic Acids Res 34:e149; Gruen et al., (2002) Nucleic Acids Res 30:e29; Chen and Zhao, (2005) Nucleic Acids Res 33:e154; WO2005105989; WO2003078619; WO2006097854; WO2006097853; WO2006097784; and WO2004031346; each of which is herein incorporated by reference in its entirety. [0525] Any meganuclease can be used herein, including, but not limited to, I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SecVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I- CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F- TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I- CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I- PcuVI, I-PgrIP, I-PobIP, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I- SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I- UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP, PI-MtuHIIP, PI-PfuI, PI-PfuII, PI- PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII, or any active variants or fragments thereof. [0526] In some aspects, the meganuclease recognizes double-stranded DNA sequences of 12 to 40 base pairs. In some aspects, the meganuclease recognizes one perfectly matched target sequence in the genome. In some aspects, the meganuclease is a homing nuclease. In some aspects, the homing nuclease is a "LAGLIDADG" family of homing nuclease. In some aspects, the "LAGLIDADG" family of homing nuclease is selected from I-SceI, I- CreI, I-Dmol, or combinations thereof. Restriction Endonucleases [0527] In some aspects, a gene editing tool useful for the present disclosure includes a nuclease agent such as a restriction endonuclease, which includes Type I, Type II, Type III, and Type IV endonucleases. Type I and Type III restriction endonucleases recognize specific recognition sites, but typically cleave at a variable position from the nuclease binding site, which can be hundreds of base pairs away from the cleavage site (recognition site). In Type II systems the restriction activity is independent of any methylase activity, and cleavage typically occurs at specific sites within or near to the binding site. Most Type II enzymes cut palindromic sequences, however Type IIa enzymes recognize non- palindromic recognition sites and cleave outside of the recognition site, Type IIb enzymes cut sequences twice with both sites outside of the recognition site, and Type IIs enzymes recognize an asymmetric recognition site and cleave on one side and at a defined distance of about 1-20 nucleotides from the recognition site. Type IV restriction enzymes target methylated DNA. Restriction enzymes are further described and classified, for example in the REBASE database (webpage at rebase.neb.com; Roberts et al., (2003) Nucleic Acids Res 31:418-20), Roberts et al., (2003) Nucleic Acids Res 31:1805-12, and Belfort et al., (2002) in Mobile DNA II, pp.761-783, Eds. Craigie et al., (ASM Press, Washington, D.C.). [0528] As described herein, in some aspects, a gene editing tool (e.g., CRISPR, TALEN, meganuclease, restriction endonuclease, RNAi, antisense oligonucleotides) can be introduced into the cell by any means known in the art. In some aspects, the polypeptide encoding the particular gene editing tool can be directly introduced into the cell. Alternatively, a polynucleotide encoding the gene editing tool can be introduced into the cell. In some aspects, when a polynucleotide encoding the gene editing tool is introduced into the cell, the gene editing tool can be transiently, conditionally or constitutively expressed within the cell. Thus, the polynucleotide encoding the gene editing tool can be contained in an expression cassette and be operably linked to a conditional promoter, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. Alternatively, the gene editing tool is introduced into the cell as an mRNA encoding or comprising the gene editing tool. [0529] Active variants and fragments of nuclease agents (i.e., an engineered nuclease agent) are also provided. Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the native nuclease agent, wherein the active variants retain the ability to cut at a desired recognition site and hence retain nick or double-strand-break-inducing activity. For example, any of the nuclease agents described herein can be modified from a native endonuclease sequence and designed to recognize and induce a nick or double-strand break at a recognition site that was not recognized by the native nuclease agent. Thus in some aspects, the engineered nuclease has a specificity to induce a nick or double-strand break at a recognition site that is different from the corresponding native nuclease agent recognition site. Assays for nick or double-strand-break-inducing activity are known and generally measure the overall activity and specificity of the endonuclease on DNA substrates containing the recognition site. [0530] When the nuclease agent is provided to the cell through the introduction of a polynucleotide encoding the nuclease agent, such a polynucleotide encoding a nuclease agent can be modified to substitute codons having a higher frequency of usage in the cell of interest, as compared to the naturally occurring polynucleotide sequence encoding the nuclease agent. For example the polynucleotide encoding the nuclease agent can be modified to substitute codons having a higher frequency of usage in a given cell of interest. Interference RNA (RNAi) [0531] In some aspects, a gene editing tool that can be used to reduce the expression of NR4A (NR4A1, NR4A2, and/or NR4A3) in a cell includes an RNA interference molecule ("RNAi"). As used herein, RNAi are RNA polynucleotide that mediates the decreased expression of an endogenous target gene product by degradation of a target mRNA through endogenous gene silencing pathways (e.g., Dicer and RNA-induced silencing complex (RISC)). Non-limiting examples of RNAi agents include micro RNAs (also referred to herein as "miRNAs"), short hair-pin RNAs (shRNAs), small interfering RNAs (siRNAs), RNA aptamers, or combinations thereof. [0532] In some aspects, the gene editing tools useful for the present disclosure comprises one or more miRNAs. "miRNAs" refer to naturally occurring, small non-coding RNA molecules of about 21-25 nucleotides in length. In some aspects, the miRNAs useful for the present disclosure are at least partially complementary to a NR4A (NR4A1, NR4A2, and/or NR4A3) mRNA molecule. miRNAs can downregulate (e.g., decrease) expression of an endogenous target gene product (i.e., NR4A protein) through translational repression, cleavage of the mRNA, and/or deadenylation. [0533] In some aspects, a gene editing tool that can be used with the present disclosure comprises one or more shRNAs. "shRNAs" (or "short hairpin RNA" molecules) refer to an RNA sequence comprising a double-stranded region and a loop region at one end forming a hairpin loop, which can be used to reduce and/or silence a gene expression. The double- stranded region is typically about 19 nucleotides to about 29 nucleotides in length on each side of the stem, and the loop region is typically about three to about ten nucleotides in length (and 3′- or 5′-terminal single-stranded overhanging nucleotides are optional). shRNAs can be cloned into plasmids or in non-replicating recombinant viral vectors to be introduced intracellularly and result in the integration of the shRNA-encoding sequence into the genome. As such, an shRNA can provide stable and consistent repression of endogenous target gene (i.e., NR4A1, NR4A2, and/or NR4A3) translation and expression. [0534] In some aspects, a gene editing tool disclosed herein comprises one or more siRNAs. "siRNAs" refer to double stranded RNA molecules typically about 21-23 nucleotides in length. The siRNA associates with a multi protein complex called the RNA- induced silencing complex (RISC), during which the "passenger" sense strand is enzymatically cleaved. The antisense "guide" strand contained in the activated RISC then guides the RISC to the corresponding mRNA because of sequence homology and the same nuclease cuts the target mRNA (e.g., NR4A (NR4A1, NR4A2, and/or NR4A3) mRNA), resulting in specific gene silencing. In some aspects, an siRNA is 18, 19, 20, 21, 22, 23 or 24 nucleotides in length and has a 2 base overhang at its 3’ end. siRNAs can be introduced to an individual cell and/or culture system and result in the degradation of target mRNA sequence (i.e., NR4A (NR4A1, NR4A2, and/or NR4A3) mRNA). siRNAs and shRNAs are further described in Fire et al., Nature 391:19, 1998 and US Patent Nos. 7,732,417; 8,202,846; and 8,383,599; each of which is herein incorporated by reference in its entirety. Antisense Oligonucleotides (ASO) [0535] In some aspects, a gene editing tool that can be used to reduce the expression of a NR4A (NR4A1, NR4A2, and/or NR4A3) gene and/or protein in a cell includes antisense oligonucleotides. As used herein, "antisense oligonucleotide" or "ASO" refer to an oligonucleotide capable of modulating expression of a target gene (e.g., NR4A1, NR4A2, and/or NR4A3) by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. Antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs. [0536] In some aspects, ASOs useful for the present disclosure are single stranded. It is understood that single stranded oligonucleotides of the present disclosure can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity is less than approximately 50% across of the full length of the oligonucleotide. In some aspects, ASOs useful for the present disclosure can comprise one or more modified nucleosides or nucleotides, such as 2’ sugar modified nucleosides. Additional modifications that can be made to an ASO (e.g., such as those that can be used to inhibit or reduce NR4A1, NR4A2, and/or NR4A3 gene expression) are provided in, e.g., US Publ. No.2019/0275148 A1. [0537] In some aspects, ASOs can reduce the expression of NR4A (NR4A1, NR4A2, or NR4A3) protein via nuclease mediated degradation of the NR4A transcript (e.g., mRNA), where the ASOs are capable of recruiting a nuclease, e.g., RNase H, such as RNaseH1. RNase H is a ubiquitous enzyme that hydrolyzes the RNA strand of an RNA/DNA duplex. Accordingly, in some aspects, once bound to the target sequence (e.g., NR4A1, NR4A2, and/or NR4A3 mRNA), ASOs can induce the degradation of the NR4A3 mRNA and thereby, reduce the expression of NR4A protein. [0538] As disclosed herein, the above examples of gene editing tools are not intended to be limiting and any gene editing tool available in the art can be used to reduce or inhibit the expression of NR4A (NR4A1, NR4A2, and/or NR4A3) gene and/or protein. Repressors [0539] In some aspects, a gene editing tool that can be used with the present disclosure (e.g., to reduce the expression of NR4A1, NR4A2, and/or NR4A3 gene and/or protein) comprises a repressor. As used herein, the term "repressor" refers to any agent that is capable of binding to the following NR4A response elements without activating transcription: (i) NGFI-B response element (NBRE), (ii) Nur-response element (NurRE), or (iii) both (i) and (ii). Accordingly, by binding to NBRE and/or NurRE, the repressors described herein are capable of repressing (or reducing or inhibiting) the level of one or more NR4A family members in a cell (e.g., immune cell expressing a CAR or TCR). In some aspects, the binding of the repressor to NBRE and/or NurRE reduces the level of a NR4A1 gene and/or NR4A1 protein in a cell when the cell is contacted with the repressor. In some aspects, the binding of the repressor to NBRE and/or NurRE reduces the level of a NR4A2 gene and/or NR4A2 protein in a cell when the cell is contacted with the repressor. In some aspects, the binding of the repressor to NBRE and/or NurRE reduces the level of a NR4A3 gene and/or NR4A3 protein in a cell when the cell is contacted with the repressor. In some aspects, the binding of the repressor to NBRE and/or NurRE reduces the level of both (i) a NR4A1 gene and/or NR4A1 protein and (ii) a NR4A2 gene and/or NR4A2 protein. In some aspects, the binding of the repressor to NBRE and/or NurRE reduces the level of both (i) a NR4A1 gene and/or NR4A1 protein and (ii) a NR4A3 gene and/or NR4A3 protein. In some aspects, the binding of the repressor to NBRE and/or NurRE reduces the level of both (i) a NR4A2 gene and/or NR4A2 protein and (ii) a NR4A3 gene and/or NR4A3 protein. In some aspects, the binding of the repressor to NBRE and/or NurRE reduces the level of each of the following: (i) a NR4A1 gene and/or NR4A1 protein, (ii) a NR4A2 gene and/or NR4A2 protein, and (iii) a NR4A3 gene and/or NR4A3 protein. Repressors that are capable of reducing the level of all members of the NR4A family (i.e., NR4A1, NR4A2, and NR4A3) are also known as "NR4A super-repressors." See, e.g., WO2020237040A1, which is incorporated herein by reference in its entirety. [0540] As is apparent from at least the above disclosure, repressors that are useful for the present disclosure comprises a DNA-binding domain that is capable of binding to the NBRE and/or NurRE response elements. In some aspects, such repressors comprise additional domains. Non-limiting examples of such additional domains include: NR4A ligand-binding domain, FLAG domain, Kruppel-associated box (KRAB) domain, NCOR domain, T2A domain, self-cleavage domain, nuclear localization signal, dimerization domain (e.g., diZIP dimerization domain), transcriptional repressor domain, chromatin compaction domain, an epitope tag, or any combination thereof. Additional disclosure relating to such additional domains can be found, e.g., in WO2020237040A1, which is incorporated herein by reference in its entirety. In some aspects, the additional domains do not comprise a transcriptional activation domain. [0541] As described herein, in some aspects, in reducing the level of one or more members of the NR4A family, a cell can be contacted with a NR4A repressor protein described herein. In some aspects, a cell is contacted with a nucleic acid sequence encoding a NR4A repressor. Additional Translatable Sequences [0542] In some aspects, an immune cell described herein (e.g., modified and cultured using the methods provided herein) can express one or more additional proteins of interest. For instance, in some aspects, a modified immune cell described herein further comprise one or more exogenous nucleotide sequences encoding additional proteins of interest. Accordingly, in some aspects, an immune cell (e.g., T cell and/or NK cell) disclosed herein exhibits: (i) a reduced expression level of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3), and (ii) an increased expression of a ligand-binding protein. Non- limiting examples of such additional translatable sequences are described below. Ligand Binding Proteins [0543] As used herein, the term "ligand binding protein" refers to any protein that is able to bind a molecule of interest (i.e., ligand) (e.g., an antigen expressed on a tumor cell or a peptide/MHC complex). In some aspects, a ligand binding protein is a chimeric binding protein. As used herein, the term "chimeric binding protein" refers to proteins that are capable of binding to one or more ligands (e.g., antigens (e.g., comprising an antigen- binding moiety)) and are created through the joining of two or more polynucleotide sequences which originally code for separate proteins. Unless indicated otherwise, the terms can be used interchangeably in the present disclosure. [0544] Non-limiting examples of ligand binding proteins (e.g., chimeric binding proteins) include a chimeric antigen receptor (CAR), T cell receptor (TCR), chimeric antibody-T cell receptor (caTCR), chimeric signaling receptor (CSR), T cell receptor mimic (TCR mimic), and combinations thereof. [0545] As further described elsewhere in the present disclosure, in some aspects, the ligand binding protein can be associated with a gene editing tool (e.g., CRISPR-Cas system), where the activation of the ligand binding protein can induce the activation of the gene- editing tool, such that the expression and/or activity of one or more genes are modulated in the cell. For example, in some aspects, a cell described herein (e.g., T cells) is modified to comprise a chimeric binding protein (e.g., CAR) which is linked to a protease and a single guide RNA targeting a regulatory region (e.g., promoter) of a gene of interest. In some aspects, the cell is modified to further comprise a linker for activation of T cells (LAT), complexed to a gene-editing tool, e.g., via a linker. Activation of the chimeric binding protein (e.g., via antigen stimulation) allows the release of the gene editing tool for nuclear localization and modulation of gene expression. Additional aspects of such chimeric binding proteins are provided elsewhere in the present disclosure. See also Pietrobon et al., Int J Mol Sci 22(19): 10828 (Oct.2021), which is incorporated herein by reference in its entirety. Chimeric Antigen Receptor (CAR) [0546] As described herein, in some aspects, a ligand-binding protein useful for the present disclosure comprises a CAR. Accordingly, in some aspects, an immune cell that can be cultured using the methods provided herein has been modified to express a CAR, and a reduced expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3). In some aspects, the immune cell is a CD8 ⁺ T cell and expresses a CAR, and a reduced expression of a NR4A family member. In some aspects, the immune cell is a CD4 ⁺ T cell and expresses a CAR, and a reduced expression of a NR4A family member. In some aspects, the immune cells comprise both CD8 ⁺ T cells and CD4 ⁺ T cells, wherein each of the CD8 ⁺ T cells and CD4 ⁺ T cells express a CAR, and a reduced expression of a NR4A family member. In some aspects, a CAR-expressing cell disclosed herein is a CAR T cell, e.g., a mono CAR T cell, a genome-edited CAR T cell, a dual CAR T cell, or a tandem CAR T cell. Examples of such CAR T cells are provided in International Publication No. WO2020028400 (also published as US20210299223A1), which is incorporated by reference herein in its entirety. [0547] In some aspects, the CAR is designed as a standard CAR. In a "standard CAR", the different components (e.g., the extracellular targeting domain, transmembrane domain, and intracellular signaling/activation domain) are linearly constructed as a single fusion protein. In some aspects, the CAR is designed as a first generation CAR. "First generation" CARs are composed of an extracellular binding domain, a hinge region, a transmembrane domain, and one or more intracellular signaling domains. All first generation CARs contain the CD3ζ chain domain as the intracellular signaling domain. In some aspects, the CAR is designed as a second generation CAR. "Second generation" CARs additionally contain a costimulatory domain (e.g., CD28 or 4-1BB). In some aspects, the CAR is designed as a third generation CAR. "Third generation" CARs are similar to the second generation CARs except that they contain multiple costimulatory domains (e.g., CD28-4-1BB or CD28- OX40). In some aspects, the CAR is designed as a fourth generation CAR. "Fourth generation" CARs (also known as TRUCKs or armored CARs) additionally contain additional factors that can further improve function. For example, in some aspects, the fourth generation CARs additionally contain cytokines which can be released upon CAR signaling in the targeted tumor tissue. In some aspects, the fourth generation CARs comprise one or more additional elements such as homing and suicide genes, which can help further regulate the activity of the CAR. In some aspects, the CAR is designed as a split CAR. In a "split CAR" system, one or more components of the CAR (e.g., extracellular targeting domain, transmembrane domain, and intracellular signaling/activation domain) are split into two or more parts such that it is dependent on multiple inputs that promote assembly of the intact functional receptor. In some aspects, the CAR is designed as a switchable CAR. With a "switchable CAR," the CAR can be switched (e.g., transiently) on (on-switch CAR) or off (off-switch CAR) in the presence of a stimulus. Additional examples of CARs that can be used with the present disclosure are described, e.g., in US 2020/0172879 A1 and US 2019/0183932 A1, each of which is incorporated herein by reference in its entirety. Engineered T Cell Receptor [0548] In some aspects, a ligand-binding protein that can be used with the present disclosure comprises an engineered T cell receptor (TCR) (also referred to in the art as "transgenic" TCRs). As used herein, the term "engineered TCR" or "engineered T cell receptor" refers to a T cell receptor (TCR) that is isolated or engineered to specifically bind with a desired affinity to a major histocompatibility complex (MHC)/peptide target antigen and that is introduced into a population of immune cells, e.g., T cells and/or NK cells. [0549] Accordingly, in some aspects, an immune cell that can be cultured using the methods provided herein have been modified to express a transgenic TCR and have a reduced level of a NR4A family member. For instance, in some aspects, the immune cell comprises a CD8 ⁺ T cell and expresses a transgenic TCR and has a reduced level of a NR4A family member. In some aspects, the immune cell comprises a CD4 ⁺ T cell and expresses a transgenic TCR and has a reduced level of a NR4A family member. In some aspects, the immune cells comprise both CD8 ⁺ T cells and CD4 ⁺ T cells, wherein each of the CD8 ⁺ T cells and CD4 ⁺ T cells comprises a transgenic TCR and has reduced level of a NR4A family member. [0550] TCR is a molecule found on the surface of T cells which is responsible for recognizing fragments of antigen as peptides bound to major histocompatibility complex (MHC) molecules. The TCR is a heterodimer composed of two different protein chains. In some aspects, the TCR consists of an alpha (α) chain and a beta (β) chain (encoded by TRA and TRB, respectively). In some aspects, the TCR consists of gamma and delta (γ/δ) chains (encoded by TRG and TRD, respectively). When the TCR engages with an antigenic peptide presented by an MHC molecule (peptide/MHC), the T lymphocyte is activated through signal transduction. [0551] In some aspects, an engineered TCR is Class I MHC restricted. In some aspects, the engineered TCR is Class II MHC restricted. In some aspects, the engineered TCR recognizes a tumor antigen peptide:MHC complex. In some aspects, the engineered TCR recognizes a neoantigen peptide:MHC complex. In some aspects, the engineered TCR comprises a transmembrane domain and a TCR domain that facilitates recruitment of at least one TCR-associated signaling molecule. In some aspects, the engineered TCR further comprises one or more TCR derived constant domains, e.g., a CH1 and a CL. T Cell Receptor Mimics (TCRm) [0552] In some aspects, the ligand-binding protein which can be used to modify an immune cell provided herein comprises a T cell receptor mimic (TCR mimic). As used herein, the term "T cell receptor mimic" or "TCR mimic" refers to an antibody (or a fragment thereof) that has been engineered to recognize tumor antigens, where the tumor antigens are displayed in the context of HLA molecules. As will be apparent to those skilled in the art, these antibodies can mimic the specificity of TCR. Non-limiting examples of TCR mimics are provided, e.g., in US 2009/0226474 A1; US 2019/0092876 A1; and Traneska et al., Front. Immunol. 8(1001):1-12 (2017), each of which is incorporated herein by reference in its entirety. In some aspects, the TCR mimic comprises (i) an antibody moiety that specifically binds to a peptide:MHC complex of interest, and (ii) a T cell receptor module capable of recruiting at least one TCR-associated signaling molecule. In some aspects, the TCR mimic comprises (i) an antibody moiety that specifically binds to a peptide:MHC complex of interest, and (ii) a transmembrane domain, one or more intracellular signaling domains (e.g., the CD3ζ chain domain) and optionally one or more costimulatory domains (e.g., CD28 or 4-1BB). [0553] Accordingly, in some aspects, an immune cell that can be cultured using the methods provided herein have been modified to express a TCR mimic and have a reduced level of a NR4A family member. In some aspects, the immune cell comprises a CD8 ⁺ T cell and expresses a TCR mimic, and has a reduced level of a NR4A family member. In some aspects, the immune cell comprises a CD4 ⁺ T cell and expresses a TCR mimic, and has a reduced level of a NR4A family member. In some aspects, the immune cells comprise both CD8 ⁺ T cells and CD4 ⁺ T cells, wherein each of the CD8 ⁺ T cells and CD4 ⁺ T cells express a TCR mimic, and has a reduced level of a NR4A family member. [0554] In some aspects, the TCR mimic comprises a chimeric antibody-T cell receptor (caTCR). As used herein, a "chimeric antibody-T cell receptor" or "caTCR" comprises (i) an antibody moiety that specifically binds to an antigen of interest and (ii) a T cell receptor module capable of recruiting at least one TCR-associated signaling molecule. In some aspects, the antibody moiety and the T cell receptor module are fused together. Additional disclosure relating to caTCRs that are useful for the present disclosure is provided in, e.g., US 10,822,413 B2; and Xu et al., Cell Discovery 4:62 (2018), each of which is herein incorporated by reference in its entirety. [0555] Accordingly, in some aspects, an immune cell that can be cultured using the methods provided herein have been modified to express a caTCR and have a reduced level of a NR4A family member. In some aspects, the immune cells modified to express a caTCR and a reduced level of a NR4A family member are further modified to express a chimeric co-stimulatory receptor. In some aspects, an immune cell (such as a T cell) provided herein expresses a reduced level of a NR4A family member and comprises: a caTCR and a chimeric co-stimulatory receptor, comprising: i) a ligand-binding module that is capable of binding or interacting with a target ligand; ii) a transmembrane module; and iii) a co- stimulatory immune cell signaling module that is capable of providing a co-stimulatory signal to the immune cell, wherein the ligand-binding module and the co-stimulatory immune cell signaling module are not derived from the same molecule, and wherein the chimeric co-stimulatory receptor lacks a functional primary immune cell signaling domain. In some aspects, the chimeric co-stimulatory receptor comprises a ligand-binding module that binds to a tumor antigen. Exemplary chimeric co-stimulatory receptors are described in e.g., US 10,822,413, which is herein incorporated by reference in its entirety. In some aspects, the immune cell described herein comprises a CD8 ⁺ T cell and expresses a caTCR and has a reduced level of a NR4A family member. In some aspects, the immune cell comprises a CD4 ⁺ T cell and expresses a caTCR and has a reduced level of a NR4A family member. In some aspects, the immune cells comprise both CD8 ⁺ T cells and CD4 ⁺ T cells, wherein each of the CD8 ⁺ T cells and CD4 ⁺ T cells express a caTCR and has a reduced level of a NR4A family member. Chimeric Signaling Receptor (CSR) [0556] In some aspects, a ligand-binding protein comprises a chimeric signaling receptor (CSR). "Chimeric signaling receptor" or "CSR" comprises a ligand-binding domain that specifically binds to a target ligand and a co-stimulatory signaling domain capable of providing a stimulatory signal to an immune cell that expresses the CSR. A chimeric signaling receptor can comprise (1) an extracellular binding domain (e.g., natural/modified receptor extracellular domain, natural/modified ligand extracellular domain, scFv, nanobody, Fab, DARPin, and affibody), (2) a transmembrane domain, and (3) an intracellular signaling domain (e.g., a domain that activates transcription factors, or recruits and/or activates JAK/STAT, kinases, phosphatases, and ubiquitin; SH3; SH2; and PDZ). See, e.g., EP340793B1, US 2021/0253665 A1, US 10,822,413 B2, and Xu et al., Cell Discovery 4:62 (2018), each of which is incorporated herein by reference in its entirety. [0557] In some aspects, an immune cell that can be cultured using the methods provided herein (e.g., modified to express a reduced level of a NR4A family member) expresses a chimeric signaling receptor. In some aspects, the immune cell comprises a CD8 ⁺ T cell and expresses a CSR and has a reduced level of a NR4A family member. In some aspects, the immune cell comprises a CD4 ⁺ T cell and expresses a CSR and has a reduced level of a NR4A family member. In some aspects, the immune cells comprise both CD8 ⁺ T cells and CD4 ⁺ T cells, wherein each of the CD8 ⁺ T cells and CD4 ⁺ T cells express a CSR and has a reduced level of a NR4A family member. Antigen-Binding Domain [0558] As described herein, a ligand binding protein useful for the present disclosure (e.g., CAR, TCR, caTCR, CSR, or TCR mimic) comprises an antigen-binding domain, a transmembrane domain, a costimulatory domain, an intracellular signaling domain, or combinations thereof. Additional disclosure relating to the transmembrane domain, costimulatory domain, and intracellular signaling domain are provided elsewhere in the present disclosure. [0559] In some aspects, the antigen-binding domain recognizes and specifically binds to an antigen. In some aspects, the antigen-binding domain of a ligand binding protein described herein specifically binds to an antigen expressed on a tumor cell. [0560] In some aspects, the antigen-binding domain of a ligand binding protein specifically binds to an antigen selected from CD19, TRAC, TCRβ, BCMA, CLL-1, CS1, CD38, TSHR, CD123, CD22, CD30, CD70, CD171, CD33, EGFRvIII, GD2, GD3, Tn Ag, PSMA, ROR1, ROR2, GPC1, GPC2, FLT3, FAP, TAG72, CD44v6, CEA, EPCAM, B7H3, KIT, IL- 13Ra2, mesothelin, IL-l lRa, PSCA, PRSS21, VEGFR2, LewisY, CD24, PDGFR-beta, SSEA-4, CD20, folate receptor alpha, ERBB2 (Her2/neu), MUC1, MUC16, EGFR, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gp100, bcr-abl, tyrosinase, EphA2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1/CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WTl, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD- CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, prostein, survivin, telomerase, PCTA- 1/Galectin 8, MelanA/MARTl, Ras mutant (e.g., HRAS, KRAS, NRAS), hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5, IGLL1, CD2, CD3ε, CD4, CD5, CD7, the extracellular portion of the APRIL protein, neoantigen, or any combinations thereof. [0561] In some aspects, the antigen-binding domain specifically recognizes and binds to BCMA. In some aspects, the antigen-binding domain specifically recognizes and binds to CD147. In some aspects, the antigen-binding domain specifically recognizes and binds to CD19. In some aspects, the antigen-binding domain specifically recognizes and binds to ROR1. In some aspects, the antigen-binding domain specifically recognizes and binds to GPC3. In some aspects, the antigen-binding domain specifically recognizes and binds to GPC2. In some aspects, the antigen-binding domain specifically recognizes and binds to CD19 and CD22. In some aspects, the antigen-binding domain specifically recognizes and binds to CD19 and CD28. In some aspects, the antigen-binding domain specifically recognizes and binds to CD20. In some aspects, the antigen-binding domain specifically recognizes and binds to CD20 and CD19. In some aspects, the antigen-binding domain specifically recognizes and binds to CD22. In some aspects, the antigen-binding domain specifically recognizes and binds to CD30. In some aspects, the antigen-binding domain specifically recognizes and binds to CEA. In some aspects, the antigen-binding domain specifically recognizes and binds to DLL3. In some aspects, the antigen-binding domain specifically recognizes and binds to EGFRvIII. In some aspects, the antigen-binding domain specifically recognizes and binds to GD2. In some aspects, the antigen-binding domain specifically recognizes and binds to HER2. In some aspects, the antigen-binding domain specifically recognizes and binds to IL-1RAP. In some aspects, the antigen-binding domain specifically recognizes and binds to mesothelin. In some aspects, the antigen- binding domain specifically recognizes and binds to NKG2D. In some aspects, the antigen- binding domain specifically recognizes and binds to PSMA. In some aspects, the antigen- binding domain specifically recognizes and binds to TnMUC1. [0562] In some aspects, the antigen-binding domain of a chimeric binding protein described herein specifically recognizes and binds an antigen in complex with an MHC. [0563] As further described elsewhere in the present disclosure, the antigen-binding domain of a chimeric binding protein (e.g., CAR, TCR, caTCR, CSR, or TCR mimic) can be any polypeptide capable of binding one or more antigens (e.g., tumor antigens). In some aspects, the antigen-binding domain comprises, or is derived from, an Ig NAR, a Fab fragment, a Fab′ fragment, a F(ab)′2 fragment, a F(ab)′3 fragment, an Fv, a single chain variable fragment (scFv), a bis-scFv, a (scFv)2, a minibody, a diabody, a triabody, a tetrabody, an intrabody, a disulfide stabilized Fv protein (dsFv), a unibody, a nanobody, and an antigen binding region derived from an antibody that can specifically bind to any of a protein of interest, a ligand, a receptor, a receptor fragment, a peptide aptamer, or combinations thereof. In some aspects, the antigen-binding domain is a single chain Fv (scFv). [0564] In some aspects, a chimeric binding protein described herein comprises an antigen- binding domain which is a natural ligand. As used herein, the term "natural ligand" refers to a naturally existing moiety that specifically binds to an antigen of interest. For instance, in some aspects, the antigen-binding domain can comprise a NKG2D cell receptor, which is a known natural ligand for NKG2D. NKG2D has been described to be expressed on many tumors. See, e.g., Sentman et. al., Cancer J 20(2): 156-159 (2014). [0565] In some aspects, the immune cells described herein (e.g., modified CAR or TCR engineered cells exhibiting a reduced expression of a NR4A family member) can target many types of antigens (e.g., tumor antigens): shared tumor-associated antigens (shared TAAs) and unique tumor-associated antigens (unique TAAs), or tumor-specific antigens. The former can include, without any limitation, cancer-testis (CT) antigens, overexpressed antigens, and differentiation antigens, while the latter can include, without any limitation, neoantigens and oncoviral antigens. Human papillomavirus (HPV) E6 protein and HPV E7 protein belong to the category of oncoviral antigens. [0566] In some aspects, the immune cells described herein (e.g., modified CAR or TCR engineered cells) can target a CT antigen, e.g., melanoma-associated antigen (MAGE) including, but not limited to, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A8, MAGE-A9.23, MAGE-A10, and MAGE-A12. In some aspects, the immune cells described herein (e.g., modified CAR or TCR engineered cells) can target glycoprotein (gp100), melanoma antigen recognized by T cells (MART-1), and/or tyrosinase, which are mainly found in melanomas and normal melanocytes. In some aspects, the immune cells described herein (e.g., modified CAR or TCR engineered cells) can target Wilms tumor 1 (WT1), i.e., one kind of overexpressed antigen that is highly expressed in most acute myeloid leukemia (AML), acute lymphoid leukemia, almost every type of solid tumor and several critical tissues, such as heart tissues. In some aspects, the immune cells described herein (e.g., modified CAR or TCR engineered cells) can target mesothelin, another kind of overexpressed antigen that is highly expressed in mesothelioma but is also present on mesothelial cells of several tissues, including trachea. [0567] In some aspects, a modified immune cell of the present disclosure, e.g., a CAR T or NK cell or a TCR-engineered T cell, can target any one of the tumor antigens disclosed above or a combination thereof. As described herein, in some aspects, the immune cells provided herein can specifically target a ROR1 antigen. Receptor tyrosine kinase–like orphan receptor 1 (ROR1) is overexpressed in approximately 57% of patients with triple negative breast cancer (TNBC) and 42% of patients with non-small cell lung carcinoma (NSCLC) adenocarcinomas (Balakrishnan 2017) and represents a highly attractive target for chimeric antigen receptor (CAR) T cells. Receptor tyrosine kinase–like orphan receptor 1-positive (ROR1 ⁺ ) solid tumors can be safely targeted with anti-ROR1 CAR T cells (Specht 2020); however, efficacy has been limited, in part, because the CAR T cells exhibit exhaustion or dysfunction following infusion in patients with solid-tumor malignancies. In addition, solid tumors have immune-suppressive barriers that limit antitumor activity of immunotherapies, such as CAR T cells (Newick 2016, Srivastava 2018, Martinez 2019). [0568] Accordingly, in some aspects, modified immune cells provided herein (e.g., T cells and/or NK cells modified to exhibit a reduced expression of a NR4A family member and cultured in a medium comprising potassium ion at a concentration higher than 5 mM) has been further modified to express a ROR1-binding protein (e.g., anti-ROR1 CAR or anti- ROR1 TCR). In producing a modified immune cell provided herein, any suitable ROR1- binding protein known in the art can be used. In some aspect, the ROR1-binding protein comprises an antibody or fragment thereof comprising the VH and/or VL sequences of the 2A2, R11, and R12 anti-ROR1 monoclonal antibodies described in, e.g., Hudecek et al., Clin. Cancer Res. 19(12):3153-64 (2013); Baskar et al., MAbs 4:349-61 (2012); Yang et al., PLoS ONE 6:e21018 (2011); US 9,316,646 B2; and US 9,758,586 B2, which are incorporated herein by reference in their entirety. For instance, in some aspects, the ROR1- binding protein is capable of cross-competing with an anti-ROR1 antibody, e.g., R12, antibody. The R12 antibody sequences are shown in Table 6. [0569] In some aspects, an anti-ROR1 chimeric binding protein useful for the present disclosure (e.g., anti-ROR1 CAR or anti-ROR1 TCR) is capable of cross-competing with an anti-ROR1 antibody, e.g., R12, antibody. The R12 antibody sequences are shown in Table 6. Table 6. R12 antibody CDRs and heavy chain variable region/ light chain variable region [0570] In some aspects, the ROR1-binding protein comprises the VH and/or VL sequences (or one or more of the CDR sequences) of any of the anti-ROR1 binding proteins (e.g., anti-ROR1 antibodies) disclosed in, e.g., WO2019225992A1 (e.g., AB4, A2F2, A2F3, BA6, CC9, C2E3, DG6, D2B12, A2F2 M1, and BA6 M1; e.g., SEQ ID NOs: 43-58); US20210317204A1 (e.g., SEQ ID NOs: 45-59); WO2022129622A1 (e.g., B1, B1G4, 1E2, 1E5, 1B11, C3CP, 2G5, 1G12, G5CP, 2F4, 1G9, 1H8, G11CP, D9CP, 1B6, 1F10, E6CP, F2CP, B6CP, 1G1, A10CP, G3CP, G3CP G4, G3CP V15, 1H8 G4, 1H8 V15, C3CP G4, C3CP V15, P3A1 G1 including variants; see Tables 1 and 2 for sequences); WO2022020388A1 (e.g., SEQ ID NOs: 641-644 and 641-744); US20200338210A1 (e.g., m2A2, h2A2, and Y31; SEQ ID NOs: 1, 2, 9, 10, 36, and 37); US20190153092A1 (e.g., 2A2, hu2A2B, rbQ11, rbD4, rbQ12, huR12_4, huR12_7, huR12_11, and huR12_16; SEQ ID NOs: 7-14, 21-28, and 35-44); WO2021048564A2 (e.g., 1D4, 3F6, 4E2, 5D2, 8B2, 8B3, and 9G1; SEQ ID NOs: 7, 8, 15, 16, 23, 24, 31, 32, 39, 40, 47, 48, 55, and 56); WO2022029431A1 (e.g., SEQ ID NO: 5); WO2017156479A1 (e.g., anti-ROR1 CAR24 - SEQ ID NO: 146; SEQ ID NOs: 7, 8, 15, 16, 23, 24, 31, 32, 39, 40, 47, 48, 55, 56, 63, 64, 71, 72, 79, 80, 87, 88, 95, 96, 103, 104, 111, 112, 119, and 120); US20180147271A1 (e.g., SEQ ID NOs: 7, 15, 23, 31, 39, 47, 55, 63, 71, 79, 87, 95, 103, 111, 119, 127, 135, 143, 151, 159, 167, 175, 183, 191, 199, 207, 215, 223, 231, 239, 247, 255, 263, 271, 279, 287, 295, 303, 311, 319, 327, 335, 343, 351, 359, 8, 16, 24, 32, 40, 48, 56, 64, 72, 80, 88, 96, 104, 112, 120, 128, 136, 144, 152, 160, 168, 176, 184, 192, 200, 208, 216, 224, 232, 240, 248, 256, 264, 272, 280, 288, 296, 304, 312, 320, 328, 336, 344, 352, and 360); US10752684B2 (e.g., 2A2, 4A5, D10, G6, G3, H10, 2A4, and 1C11; SEQ ID NOs: 11, 15, 19, 23, 27, 32, 37, 41, 45, 49, 53, 58, 63, 67, 71, and 75); US10759868B2 (e.g., H8, A1, A2, and A3; SEQ ID NOs: 11-18); WO2021190629A1 (e.g., antibody #1, 11, 32, 101, 103, 115, 140, and 162); US20200157174A1 (e.g., SEQ ID NOs: 105, 113, 121, 129, 137, 145, 153, 109, 117, 125, 133, 141, 149, and 157); US20200255521A1 (e.g., SEQ ID NOs: 2-9); US20170306018A1 (e.g., MAB1, MAB2, MAB3, and MAB4; SEQ ID NOs: 2, 6, and 42- 47); WO2022042488A1 (e.g., mAb004 including humanized variants; SEQ ID NOs: 8- 20); WO2022026759A1 (e.g., SEQ ID NOs: 450, 454, 458, and 462); US20210155692A1 (e.g., I2A-3, I2A-4, I2A-6, I2-A8, I2-A12, I2-A20, I2-A25, I2-A26, I2-A27, I2-A30, I2- A32, I2-A33, and I2-A37; sequences provided in Table 6); US11155615B2 (e.g., 601-147, 601-149, 601-28, 601-37, 601-4, 601-5, 601-50, 601-65, 601-66, 601-70, 601-87, and 601- 9; sequences provided in Tables 6 and 7); US10968275B2 (e.g., SEQ ID NOs: 12-16); US20210145882A1 (e.g., 2A2, R12, R11, Y31, UC-961, D10, and H10; SEQ ID NOs: 1- 45); EP4039707A1 (e.g., PR000374; SEQ ID NOs: 84 and 85); WO2021115497A2 (e.g., 1015M2-H4; SEQ ID NOs: 63 and 71); WO2022048581A1 (e.g., SEQ ID NOs: 93-134 and 186-197); US20220195041A1 (e.g., SEQ ID NOs: 156 and 166); WO2021057822A1 (e.g., C3, G3, and G6; SEQ ID NOs: 1, 5, 15, 19, 29, and 33); WO2022150831A1 (e.g., SEQ ID NOs: 34-36 and 256-270); US20210177902A1 (e.g., SEQ ID NOs: 15-74); US10889652B2 (e.g., clones 83B, 83, 305, 298, 350, 20, 16, 48, 43, 366, 40, 461, 65, 81, and 7; sequences provided in Table 3B); US20220168344A1 (e.g., SEQ ID NOs: 152-157); US10647768B2 (e.g., SEQ ID NOs: 51 and 52); WO2022152168A1 (e.g., SEQ ID NOs: 24, 25, 27, 28, 30, 31, 33, 34, 36, 37, 68, 69, 72, 73, 76, 77, 80, 81, 84, 85, 88, 89, 92, and 93); WO2020026987A1 (e.g., SEQ ID NOs: 17 and 22); US20190153092A1 (e.g., SEQ ID NOs: 9-44); US20210139579A1 (e.g., SEQ ID NOs: 20, 21, 4, 5, 8, 9, 22, 23, 2, and 3); US10758556B2 (e.g., SEQ ID NOs: 4 and 5); US2021379194A1 (e.g., SEQ ID NOs: 1, 2, 20, and 21); US10618959B2 (SEQ ID NOs: 130-141); WO2022084440A2 (e.g., SEQ ID NOs: 212-214 and 221-223); WO2022167460A1 (e.g., SEQ ID NOs: 7-12 and 20-29); US9228023B2 (e.g., A1-A14; SEQ ID NOs: 1-14, 29-42, 268, and 270); WO2021202863A1 (e.g., SEQ ID NOs: 3 and 4); US2021277109A1 (e.g., 226E12, 323H7, 324C7, 323D10, 324E2, 324C6, 338H4, and 330F11; SEQ ID NOs: 4, 8, 12, 16, 20, 24, 28, 32, 44, 48, 52, 56, 60, 64, 68, 72, 76, 80, 84, 88, 92, 96, 100, 104, 108, 112, 116, 120, 124, 128, and 132); US2019276540A1 (e.g., SEQ ID NOs: 65, 69, and 79); US20200405759A1 (e.g., SEQ ID NOs: 3-14); US9938350B2 (e.g., SEQ ID NOs: 1 and 2); US11312787B2 (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 27-32); US20190112380A1 (e.g., SEQ ID NOs: 454, 455, 755, and 756); EP3548055A2 (e.g., see Tables 6 and 7 for exemplary sequences); US20210137977A1 (e.g., SEQ ID NOs: 9699, 9637, 9638, and 11145-11193); WO2021188599A1 (e.g., SEQ ID NOs: 19065-19133); US2021253729A1 (e.g., SEQ ID NOs: 24-26); US20220152214A1 (e.g., Ab1; SEQ ID NOs: 3 and 4); US20220227866A1 (e.g., Ab2, Ab3, Ab6, Ab7; SEQ ID NOs: 72-75, 100, and 103); WO2021159029A1; WO2022011075A1; US20220133901A1; each of which is incorporated herein by reference in its entirety. Signaling (Intracellular), Transmembrane, and Costimulatory Domains [0571] In some aspects, a chimeric binding protein described herein (e.g., CAR, TCR, caTCR, CSR, or TCR mimic) comprises an intracellular signaling domain that transduces the effector function signal upon binding of an antigen to the extracellular domain and directs the cell expressing the chimeric binding protein (e.g., T cell) to perform a specialized function. Non-limiting examples of intracellular signaling domain include an intracellular signaling domain region derived from CD3 zeta, FcR gamma, common FcR gamma (FCER1G), Fc gamma RIIa, FcR beta (Fc Epsilon Rib), CD3 gamma, CD3 delta, CD3 epsilon, CD22, CD79a, CD79b, CD278 (“ICOS”), FcεRI, CD66d, CD32, DAP10, DAP12, or any combination thereof. In some aspects, the intracellular signaling domain comprises a CD3 zeta intracellular signaling domain (e.g., such as that set forth in SEQ ID NO: 90). [0572] In some aspects, the chimeric binding protein comprises the entire intracellular domain of a protein disclosed herein. In some aspects, the intracellular domain is truncated. Truncated portion of an intracellular domain can be used in place of the intact chain as long as it still transduces the effector function signal. The term intracellular domain is thus meant to include any truncated portion of the intracellular domain sufficient to transduce the effector function signal. [0573] In some aspects, a chimeric binding protein useful for the present disclosure (e.g., CAR, TCR, caTCR, CSR, or TCR mimic) further comprises a transmembrane domain. In some aspects, the antigen-binding domain of a chimeric binding protein is linked to the intracellular domain by a transmembrane domain. In some aspects, the antigen-binding domain of a chimeric binding protein is connected to the transmembrane domain by a linker. In some aspects, the inclusion of a linker between the antigen-binding domain and the transmembrane domain can affect flexibility of the antigen-binding domain and thereby, improve one or more properties of a chimeric binding protein. [0574] Any transmembrane domain known in the art can be used in the chimeric binding proteins described herein (e.g., CAR, TCR, caTCR, CSR, or TCR mimic). In some aspects, the transmembrane domain is artificial (e.g., an engineered transmembrane domain). In some aspects, the transmembrane domain is derived from a naturally occurring polypeptide. In some aspects, the transmembrane domain comprises a transmembrane domain from a naturally occurring polypeptide. Non-limiting examples of transmembrane domain include a transmembrane domain region of KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, IL2R beta, IL2R gamma, IL7R α, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO- 3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG/Cbp, NKG2D, NKG2C, CD19, CD8, or any combination thereof. In some aspects, the transmembrane domain comprises a CD28 transmembrane domain (e.g., such as that set forth in SEQ ID NO: 75). [0575] As described herein, in some aspects, a chimeric binding protein useful for the present disclosure (e.g., CAR, TCR, caTCR, CSR, or TCR mimic) comprises one or more costimulatory domains (e.g., second and third generation CARs). Not to be bound by any one theory, these costimulatory domains can further improve the expansion, activation, memory, persistence, and/or effector function of an immune cell engineered to express the chimeric binding protein. In some aspects, the transmembrane domain is fused to the costimulatory domain, optionally a costimulatory domain is fused to a second costimulatory domain, and the costimulatory domain is fused to a signaling domain, not limited to CD3ζ. Non-limiting examples of costimulatory domain include interleukin-2 receptor (IL-2R), interleukin-12 receptor (IL-12R), IL-7, IL-21, IL-23, IL-15, CD2, CD3, CD4, CD7, CD8, CD27, CD28, CD30, CD40, 4-1BB/CD137, ICOS, lymphocyte function- associated antigen-1 (LFA-1), LIGHT, NKG2C, OX40, DAP10, or any combination thereof. In some aspects, the costimulatory domain comprises a 4-1BB/CD137 costimulatory domain (e.g., such as that set forth in SEQ ID NO: 76). Truncated EGFR [0576] In some aspects, immune cells disclosed herein (e.g., modified and cultured using the methods provided herein) further comprise an exogenous nucleotide sequence encoding a truncated epidermal growth factor receptor (EGFRt), such that the EGFRt comprises only a partial sequence of the full-length EGFR protein (e.g., SEQ ID NO: 19). In some aspects, the EGFRt comprises EGFR extracellular Domains III and IV and an EGFR transmembrane domain, but lacks EGFR extracellular Domains I and II and EGFR intracellular sequence. Accordingly, in some aspects, an immune cell disclosed herein has been modified to comprise: (i) an exogenous nucleotide sequence encoding a chimeric binding protein, (ii) a gene editing tool targeting one or more members of the NR4A family (e.g., gRNAs provided herein), and (iii) an exogenous nucleotide sequence encoding an EGFRt. In each of the above aspects, one or more of the multiple exogenous nucleotide sequences can be part of a single polycistronic polynucleotide. [0577] EGFR is a 180 kDa monomeric glycoprotein comprising a large extracellular region, a single spanning transmembrane domain, an intracellular juxtamembrane region, a tyrosine kinase domain, and a C-terminal regulatory region. The extracellular region comprises four domains: Domains I and III are homologous ligand binding domains, and domains II and IV are cysteine rich domains (Ferguson, Annu Rev Biophys. (2008) 37:353- 3). Unless otherwise indicated, EGFR as used herein refers to human EGFR. Due to alternative splicing, there are at least four known isoforms of human EGFR. Sequences for the different EGFR isoforms are provided in Table 7 (below). Table 7: Human EGFR sequences [0578] In the above canonical sequence for EGFR (i.e., isoform 1), the various EGFR domains are delineated as follows. The signal peptide spans amino acids 1-24. The extracellular sequence spans amino acids 25-645, wherein Domain I, Domain II, Domain III, and Domain IV span amino acids 25-188, 189-333, 334-504, and 505-645, respectively. The transmembrane domain spans amino acids 646-668. The intracellular domain spans amino acids 669-1,210, where the juxtamembrane domain spans amino acids 669-703 and the tyrosine kinase domain spans amino acids 704-1,210. [0579] In some aspects, the EGFRt useful for the present disclosure comprises an amino acid sequence having at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19. [0580] In some aspects, the EGFRt that can be used with the present disclosure comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 21. In some aspects, the EGFRt comprises the amino acid sequence set forth in SEQ ID NO: 21 (see Table 7). In some aspects, the EGFRt that can be used with the present disclosure comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 24. In some aspects, the EGFRt comprises the amino acid sequence set forth in SEQ ID NO: 24 (see Table 8). Table 8: Truncated EGFR sequences [0581] In some aspects, the EGFRt described herein additionally comprises a juxtamembrane domain. As used herein, the term "juxtamembrane domain" refers to an intracellular portion of a cell surface protein (e.g., EGFR) immediately C-terminal to the transmembrane domain. Not to be bound by any one theory, in some aspects, the addition of the juxtamembrane domain can increase the expression of the protein encoded by the polynucleotides of the present disclosure. [0582] In some aspects, the juxtamembrane domain can be from about 1 to about 20 (e.g., 2-20, 3-20, 4-20, 5-20, 2-18, 3-18, 4-18, or 5-18) amino acids long. In some aspects, the juxtamembrane domain can be longer than 20 amino acids. In some aspects, the first 1 or more (e.g., first 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 ,14, 15, 16, 17, 18, 19, or 20) amino acids of the juxtamembrane domain is a net-neutral or net-positively charged sequence (e.g., the number of arginine and lysine residues is greater than or equal to the number of aspartic acid and glutamic acid residues). In some aspects, those first amino acids contain more than about 30% (e.g., more than 40, 50, 60, 70, 80, or 90%) hydrophilic amino acids. Non-limiting examples of juxtamembrane domains that are useful for the present disclosure are provided in Table 9 (below). Table 9: Juxtamembrane domain sequences [0583] In some aspects, the juxtamembrane domain that can be used with the present disclosure can be derived from the juxtamembrane region of a natural cell surface protein, such as a juxtamembrane region (e.g., the entire or partial sequence of the first 20 juxtamembrane amino acids) of a human receptor tyrosine kinase that interacts with phosphatidylcholine (PC), phosphatidylserine (PS), or phosphatidylinositol-4,5- bisphosphate (PIP2) (see, e.g., Hedger et al., Sci Rep. (2015) 5: 9198). Non-limiting examples of receptor tyrosine kinases are ERBB1 (EGFR), ERBB2 (HER2), ERBB3 (HER3), ERBB4 (HER4), INSR, IGF1R, INSRR, PGFRA, PGFRB, KIT, CSF1R, FLT3, VGFR1, VGFR2, VGFR3, FGFR1, FGFR2, FGFR3, FGFR4, PTK7, NTRK1, NTRK2, NTRK3, ROR1, ROR2, MUSK, MET, RON, UFO, TYRO3, MERTK, TIE1, TIE2, EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHAA, EPHB1, EPHB2, EPHB3, EPHB4, EPHB6, RET, RYK, DDR1, DDR2, ROS1, LMTK1, LMTK2, LMTK3, LTK, ALK, and STYK1. In some aspects, the juxtamembrane domain can comprise one or more mutations (e.g., substitutions or deletions) that remove residues known to be phosphorylated so as to circumvent any unintended signal transducing ability of the protein encoded by the polynucleotides of the present disclosure. [0584] In some aspects, the juxtamembrane domain is derived from a juxtamembrane region of EGFR. Non-limiting examples of EGFR-derived juxtamembrane domains comprise one of the sequences provided in Table 10 (below). In some aspects, the juxtamembrane domain comprises the amino acid sequence RRR. In some aspects, an EGFRt comprising such a juxtamembrane domain comprises the sequence set forth in SEQ ID NO: 24. Table 10: EGFR-derived juxtamembrane domain sequences [0585] As is apparent from the present disclosure, modifying an immune cell described herein (e.g., expressing a reduced expression of a NR4A family member and/or comprising an exogenous nucleotide sequence encoding a chimeric binding protein) to further comprise an exogenous nucleotide sequence encoding EGFRt provides certain advantages. For instance, in some aspects, the EGFRt can function as a kill switch. In some aspects, when the engineered cells described herein are no longer needed in the body, a pharmaceutical grade anti-EGFR antibody, such as cetuximab, panitumumab, nimotuzumab, or necitumumab, can be administered to a subject who had received the engineered cells, thereby removing the engineered cells, e.g., through antibody-dependent cellular cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), and/or antibody- dependent cellular phagocytosis (ADCP). Spacers [0586] In some aspects, immune cells described herein (e.g., modified and cultured using the methods provided herein) also comprise an exogenous nucleotide sequence encoding a spacer. Accordingly, in some aspects, an immune cell described herein has been modified to exhibit a reduced expression of a member of the NR4A family (e.g., with a gRNA targeting NR4A1, NR4A2, and/or NR4A3) and comprise: an exogenous nucleotide sequence encoding a chimeric binding protein, and an exogenous nucleotide sequence encoding a spacer. In some aspects, an immune cell has been modified to exhibit a reduced expression of a member of the NR4A family and comprise: an exogenous nucleotide sequence encoding a chimeric binding protein, an exogenous nucleotide sequence encoding an EGFRt, and an exogenous nucleotide sequence encoding a spacer. In some aspects, the one or more exogenous nucleotide sequences are part of a single polycistronic polynucleotide. As used herein, the term "spacer" refers to a polypeptide sequence which is capable of covalently linking together two spaced moieties (e.g., P2A linker and a chimeric binding protein). [0587] In some aspects, the spacer is derived from an immunoglobulin (e.g., derived from hinge regions or loop regions). In some aspects, the spacer comprises IgA1, IgA2, IgG1, IgG2, IgG3, IgG4, IgD, IgE, or IgM hinge regions, fragments thereof (alone or capped by additional sequences, e.g., CH1 or CH2 regions sequences), or combinations of fragments from IgA1, IgA2, IgG1, IgG2, IgG3, IgG4, IgD, IgE, or IgM hinge regions (referred to herein as a "hinge region derived spacer"). In some aspects, the spacer comprises IgA1, IgA2, IgG1, IgG2, IgG3, IgG4, IgD, IgE, or IgM constant domain loop regions, fragments thereof (alone or capped by additional sequences, e.g., from adjacent β-strands), or combinations of fragments from IgA1, IgA2, IgG1, IgG2, IgG3, IgG4, IgD, IgE, or IgM loop regions (referred to herein as a "loop region derived spacer"). In some aspects, the spacer comprises hinge region derived spacer, loop region derived spacer, or both (e.g., two or more concatenated hinge region derived spacers and loop region derived spacers). [0588] In some aspects, a spacer useful for the present disclosure comprises a subsequence of an immunoglobulin heavy chain selected the group consisting of human IgA1 (Uniprot: P01876, IGHA1_HUMAN, immunoglobulin heavy constant alpha 1; SEQ ID NO: 41), human IgA2 (Uniprot P01877, IGHA2_HUMAN, immunoglobulin heavy constant alpha 2; SEQ ID NO: 42), murine IgG2A (Uniprot P01665, GCAM_MOUSE, immunoglobulin gamma 2A chain C region; SEQ ID NO: 43), human IgG1 (Uniprot P01857, IGHG1_HUMAN, immunoglobulin heavy constant gamma 1; SEQ ID NO: 44), human IgG2 (Uniprot P01859, IGHG2_HUMAN, immunoglobulin heavy constant gamma 2; SEQ ID NO: 45), human IgG3 (Uniprot P01860, IGHG3_HUMAN, immunoglobulin heavy constant gamma 3; SEQ ID NO: 46), human IgG4 (Uniprot P01861, IGHG4, immunoglobulin heavy constant gamma 4; SEQ ID NO: 47), human IgD (Uniprot P01880, IGHD_HUMAN, immunoglobulin heavy constant delta; SEQ ID NO: 48), human IgE (Uniprot P01854, IGHE_HUMAN, immunoglobulin heavy constant chain epsilon; SEQ ID NO: 49), or IgM (Uniprot P01871, IGHM_HUMAN, immunoglobulin heavy constant mu; SEQ ID NO: 50), wherein the subsequence comprises the CH1-CH2 hinge region or a portion thereof. In some aspects, the subsequence further comprises an adjacent portion of a CH1 and/or CH2 constant domain. [0589] In some aspects, a spacer comprises a subsequence of an immunoglobulin heavy chain selected the group consisting of human IgA1 (Uniprot: P01876, IGHA1_HUMAN, immunoglobulin heavy constant alpha 1; SEQ ID NO: 41), human IgA2 (Uniprot P01877, IGHA2_HUMAN, immunoglobulin heavy constant alpha 2; SEQ ID NO: 42), murine IgG2A (Uniprot P01665, GCAM_MOUSE, immunoglobulin gamma 2A chain C region; SEQ ID NO: 43), human IgG1 (Uniprot P01857, IGHG1_HUMAN, immunoglobulin heavy constant gamma 1; SEQ ID NO: 44), human IgG2 (Uniprot P01859, IGHG2_HUMAN, immunoglobulin heavy constant gamma 2; SEQ ID NO: 45), human IgG3 (Uniprot P01860, IGHG3_HUMAN, immunoglobulin heavy constant gamma 3; SEQ ID NO: 46), human IgG4 (Uniprot P01861, IGHG4, immunoglobulin heavy constant gamma 4; SEQ ID NO: 47), human IgD (Uniprot P01880, IGHD_HUMAN, immunoglobulin heavy constant delta; SEQ ID NO: 48), human IgE (Uniprot P01854, IGHE_HUMAN, immunoglobulin heavy constant chain epsilon; SEQ ID NO: 49), or IgM (Uniprot P01871, IGHM_HUMAN, immunoglobulin heavy constant mu; SEQ ID NO: 50), wherein the subsequence comprises a loop region from a constant domain or a portion thereof. In some aspects, the subsequence further comprises an adjacent portion of a β- strand. [0590] In some aspects, a spacer useful for the present disclosure is derived from an IgG, e.g., IgG1, IgG2, IgG3, or IgG4. In some aspects, the spacer is derived from an IgG2 hinge. In some aspects, the IgG2 hinge derived spacer comprises at least five, six, or seven consecutive amino acids of SEQ ID NO: 51 (KPCPPCKCP). In some aspects, the spacer comprises an amino acid sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the sequence set forth in SEQ ID NO: 51 (KPCPPCKCP). In some aspects, the spacer comprises, consists, or consists essentially of the sequence set forth in SEQ ID NO: 51 (KPCPPCKCP). In some aspects, the spacer comprises the sequence set forth in SEQ ID NO: 51 (KPCPPCKCP) except for one, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some aspects, the amino acid substitution comprises at least one non-conservative amino acid substitution. [0591] In some aspects, a spacer of the present disclosure comprises of the sequence set forth in SEQ ID NO: 51, wherein the spacer sequence further comprises an optional flexible linker (e.g., the linker of GGGSG (SEQ ID NO: 40)). Thus, in some aspects, a spacer of the present disclosure comprises a spacer sequence (e.g., SEQ ID NO: 51) and an optional C-terminal or N-terminal flexible linker. In some aspects, any optional flexible linkers (e.g., gly/ser rich linker) disclosed herein can be appended to the C-terminus and/or the N- terminus of a spacer. Signal Peptide [0592] As described herein, in some aspects, an immune cell provided herein has been modified to further express a signal peptide (e.g., comprises an exogenous nucleotide sequence encoding a signal peptide). The signal peptide can facilitate the cell surface expression of the encoded protein and then can be subsequently cleaved from the mature protein. In some aspects, such an immune cell has been modified to exhibit a reduced expression of a member of the NR4A family (e.g., with a gRNA targeting NR4A1, NR4A2, and/or NR4A3) and comprises: an exogenous nucleotide sequence encoding a chimeric binding protein, and an exogenous nucleotide sequence encoding a signal peptide. In some aspects, an immune cell has been modified to exhibit a reduced expression of a member of the NR4A family (e.g., with a gRNA targeting NR4A1, NR4A2, and/or NR4A3) and comprise: an exogenous nucleotide sequence encoding a chimeric binding protein, an exogenous nucleotide sequence encoding an EGFRt, and an exogenous nucleotide sequence encoding a signal peptide. In some aspects, an immune cell has been modified to exhibit a reduced expression of a member of the NR4A family (e.g., with a gRNA targeting NR4A1, NR4A2, and/or NR4A3) and comprise: an exogenous nucleotide sequence encoding a chimeric binding protein, an exogenous nucleotide sequence encoding an EGFRt, an exogenous nucleotide sequence encoding a spacer, and an exogenous nucleotide sequence encoding a signal peptide. In some aspects, the one or more exogenous nucleotide sequences are part of a single polycistronic polynucleotide. [0593] Any suitable signal peptide known in the art can be used with the present disclosure. Non-limiting examples of signal peptides are provided in Table 11 (below). In some aspects, the signal peptide is derived from human Ig kappa. In some aspects, the signal peptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 54 (MVLQTQVFISLLLWISGAYG). In some aspects, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 54 (MVLQTQVFISLLLWISGAYG). In some aspects, the signal peptide is derived from GM- CSF. In some aspects, such a signal peptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 53 (MLLLVTSLLLCELPHPAFLLIP). In some aspects, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 53 (MLLLVTSLLLCELPHPAFLLIP). Table 11: Signal Peptide Sequences [0594] In some aspects, a polynucleotide that can be used to modify an immune cell described herein comprises a single signal peptide (e.g., SEQ ID NO: 53 or 54). In some aspects, the polynucleotide comprises multiple signal peptides (e.g., at least two, three, four, or more). Where multiple signal peptides are involved, in some aspects, each of the multiple signal peptides are different. In some aspects, two or more of the multiple signal peptides are the same. Linkers [0595] In some aspects, an immune cell described herein (e.g., modified to exhibit a reduced expression of a NR4A family member and cultured using the methods provided herein) has been modified to additionally comprise an exogenous nucleotide sequence encoding a linker. Accordingly, in some aspects, an immune cell described herein has been modified to exhibit a reduced expression of a NR4A family member (e.g., with a gRNA targeting NR4A1, NR4A2, and/or NR4A3) and comprise: an exogenous nucleotide sequence encoding a chimeric binding protein, and an exogenous nucleotide sequence encoding a linker. In some aspects, the immune cell has been modified to exhibit a reduced expression of a NR4A family member and comprise: an exogenous nucleotide sequence encoding a chimeric binding protein, an exogenous nucleotide sequence encoding an EGFRt, and an exogenous nucleotide sequence encoding a linker. In some aspects, the immune cell has been modified to exhibit a reduced expression of a NR4A family member and comprises: an exogenous nucleotide sequence encoding a chimeric binding protein, an exogenous nucleotide sequence encoding an EGFRt, an exogenous nucleotide sequence encoding a spacer, and an exogenous nucleotide sequence encoding a linker. In some aspects, a modified immune cell described herein exhibits a reduced expression of a NR4A family member and comprises: an exogenous nucleotide sequence encoding a chimeric binding protein, an exogenous nucleotide sequence encoding an EGFRt, an exogenous nucleotide sequence encoding a spacer, an exogenous nucleotide sequence encoding a signal peptide, and an exogenous nucleotide sequence encoding a linker. [0596] Where multiple exogenous nucleotide sequences are involved, in some aspects, the one or more exogenous nucleotide sequences are part of a single polycistronic polynucleotide. For such aspects, the linker can be between any of the different components of a polynucleotide described herein. In some aspects, the multiple linkers are the same. In some aspects, the multiple linkers are different. [0597] In some aspects, the linker is a peptide linker. In some aspect, the linker comprises at least about 1 amino acid, at least about 2 amino acids, at least about 3 amino acids, at least about 4 amino acids, at least about 5 amino acids, at least about 6 amino acids, at least about 7 amino acids, at least about 8 amino acids, at least about 9 amino acids, at least about 10 amino acids, at least about 11 amino acids, at least about 12 amino acids, at least about 13 amino acids, at least about 14 amino acids, at least about 15 amino acids, at least about 16 amino acids, at least about 17 amino acids, at least about 18 amino acids, at least about 19 amino acids, at least about 20 amino acids, at least about 25 amino acids, or at least about 30 amino acids. In some aspects, the linker is rich in glycine (e.g., for flexibility). In some aspects, the linker comprises serine and/or threonine (e.g., for solubility). In some aspects, the linker is a Gly/Ser linker. [0598] In some aspects, the glycine/serine linker is according to the formula [(Gly)n-Ser]m (SEQ ID NO: 77) where n is any integer from 1 to 100 and m is any integer from 1 to 100. In some aspects, the glycine/serine linker is according to the formula [(Gly)x-(Ser)y]z (SEQ ID NO: 78) wherein x in an integer from 1 to 4, y is 0 or 1, and z is an integers from 1 to 50. In some aspects, the Gly/Ser linker comprises the sequence Gn (SEQ ID NO: 79), where n can be an integer from 1 to 100. In some aspects, the optional linker can comprise the sequence (GlyAla)n (SEQ ID NO: 80), wherein n is an integer between 1 and 100. [0599] In some aspects, the sequence of the optional linker is GGGG (SEQ ID NO: 81). In some aspects, the sequence of the optional linker is GGGSG (SEQ ID NO: 82). [0600] In some aspects, the optional linker comprises the sequence (GGGSG)n (SEQ ID NO: 64). In some aspects, the optional linker comprises the sequence (GGGGS)n (SEQ ID NO: 65). In some aspects, the optional linker can comprise the sequence (GGGS)n (SEQ ID NO: 66). In some aspects, the optional linker can comprise the sequence (GGS)n (SEQ ID NO: 67). In these instances, n can be an integer from 1 to 100. In other instances, n can be an integer from one to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some aspects n is an integer from 1 to 100. [0601] Examples of the optional linker include, but are not limited to, e.g., GSGSGS (SEQ ID NO: 68), GGSGG (SEQ ID NO: 69), SGGSGGS (SEQ ID NO: 70), GGSGGSGGSGGSGGG (SEQ ID NO: 71), GGSGGSGGGGSGGGGS (SEQ ID NO: 72), GGSGGSGGSGGSGGSGGS (SEQ ID NO: 73), or GGGGSGGGGSGGGGS (SEQ ID NO: 74). [0602] In some aspects, the optional linker comprises the sequence PGG. In some aspects, the optional linker comprises additional amino acids in addition to Glycine and Serine. In some aspects, the optional linker comprises 1, 2, 3, 4, or 5 non-gly/non-ser amino acids. In some aspects, the Gly/Ser-linker comprises at least about 60%, at least about 65%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, or at least 95% glycine or serine amino acids. [0603] In some specific aspects, the optional linker is between 1 and 10 amino acids in length. In some aspects, the optional linker as between about 5 and about 10, between about 10 and about 20, between about 20 and about 30, between about 30 and about 40, between about 40 and about 50, between about 50 and about 60, between about 60 and about 70, between about 70 and about 80, between about 80 and about 90, or between about 90 and about 100 amino acids in length. [0604] In some aspects, the linker is a non-cleavable linker, such that the linker and the different components of a polynucleotide provided herein (e.g., chimeric binding protein) are expressed as a single polypeptide. In some aspects, the linker is a cleavable linker. As used herein, the term "cleavable linker" refers to a linker that comprises a cleavage site, such that when expressed can be selectively cleaved to produce two or more products. In some aspects, the linker is selected from a P2A linker, a T2A linker, an F2A linker, an E2A linker, a furin cleavage site, or any combination thereof (see Table 12 below). In some aspects, the linker further comprises a GSG linker sequence. In some aspects, a linker useful for the present disclosure comprises an Internal Ribosome Entry Site (IRES), such that separate polypeptides encoded by the first and second genes are produced during translation. Additional description of linkers that can be used with the present disclosure are provided, e.g., in WO 2020/223625 A1 and US 2019/0276801 A1, each of which is incorporated herein by reference in its entirety. Table 12: Linker Sequences [0605] In some aspects, the linker comprises a P2A linker. In some aspects, the linker comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 14. In some aspects, the linker comprises the amino acid sequence set forth in SEQ ID NO: 14. [0606] In some aspects, the linker comprises a T2A linker. In some aspects, the linker comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 15. In some aspects, the linker comprises the amino acid sequence set forth in SEQ ID NO: 15. [0607] In some aspects, the linker comprises an F2A linker. In some aspects, the linker comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 16. In some aspects, the linker comprises the amino acid sequence set forth in SEQ ID NO: 16. [0608] In some aspects, the linker comprises an E2A linker. In some aspects, the linker comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17. In some aspects, the linker comprises the amino acid sequence set forth in SEQ ID NO: 17. [0609] In some aspects, the linker comprises an amino acid sequence comprising a furin cleavage site. In some aspects, the linker comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18. In some aspects, the linker comprises the amino acid sequence set forth in SEQ ID NO: 18. c-Jun Encoding Nucleotide [0610] As described herein, in some aspects, immune cells described herein (e.g., modified and cultured using the methods provided herein) comprise, or are capable of expressing, a c-Jun protein. Where the immune cells are capable of naturally expressing the c-Jun protein, in some aspects, expression of the endogenous c-Jun protein is induced thereby resulting in increased or overexpression of the protein. In inducing the expression (or overexpression) of the c-Jun protein in a cell, in some aspects, the c-Jun protein is exogenously added. In some aspects, the c-Jun protein is recombinantly expressed in the cell. For instance, in some aspects, a cell described herein has been modified or engineered (e.g., genetically) to comprise an exogenous polynucleotide which comprises a nucleotide sequence encoding a c-Jun protein (also referred to herein as "c-Jun nucleotide sequence"), such that the expression of the c-Jun protein in the modified cell is increased compared to a reference cell (e.g., corresponding cell that was not modified to comprise the exogenous polynucleotide). In some aspects, a cell has been modified with a transcriptional activator (e.g., CRISPR/Cas-system-based transcription activator, e.g., CRISPRa), such that the expression of the endogenous c-Jun protein is increased compared to a reference cell (e.g., corresponding cell that has not been modified with the transcriptional activator). [0611] In some aspects, due to the modification (e.g., introduction of the exogenously introduced c-Jun nucleotide sequence and/or transcriptional activator), the engineered cells overexpress, i.e., express a higher level (e.g., at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% more, or at least about 1.5-, 2-, 3-, 4-, 5-, or 10-fold more) of, a c-Jun protein than corresponding cells without such a modification ("reference cell"). The terms "express increased levels [or amounts] of," "overexpress," or have "increased expression of" (and similar forms of the phrase used herein), are used interchangeably. [0612] In some aspects, the engineered (or modified) cells described herein express at least about 2-100 fold more, about 5-50 fold more, about 5-40 fold more, about 5-30 fold more, about 5-20 fold more, about 8-20 fold more, or about 10-20 fold more c-Jun protein than the reference cell. In some aspects, the expression of the c-Jun protein in a modified cell described herein is increased by at least about 0.5-fold, by at least about 1-fold, by at least about 2-fold, by at least about 3-fold, by at least about 4-fold, by at least about 5-fold, by at least about 6-fold, by at least about 7-fold, by at least about 8-fold, by at least about 9- fold, by at least about 10-fold, by at least about 12-fold, by at least about 14-fold, by at least about 16-fold, by at least about 18-fold, by at least about 20-fold, by at least about 25-fold, by at least about 30-fold, by at least about 35-fold, by at least about 40-fold, by at least about 45-fold, by at least about 50-fold, by at least about 75-fold, by at least about 100- fold, by at least about 200-fold, by at least about 300-fold, by at least about 400-fold, by at least about 500-fold, by at least about 750-fold, or by at least 1000-fold, compared to the expression of the c-Jun protein in the reference cell. [0613] Additionally, as described herein, in some aspects, a culture medium of the present disclosure (e.g., comprising potassium ion at a concentration higher than 5 mM) can also help further increase the expression of the c-Jun protein (or any other protein of interest) in the modified cells. Accordingly, in some aspects, when cultured using the methods provided herein, the expression of the c-Jun protein in the modified cells (e.g., resulting from the introduction of an exogenous nucleotide sequence encoding a c-Jun protein and/or a transcriptional activator that is capable of increasing the expression of the endogenous c- Jun protein) is further increased by at least 0.5-fold, by at least about 1-fold, by at least about 2-fold, by at least about 3-fold, by at least about 4-fold, by at least about 5-fold, by at least about 6-fold, by at least about 7-fold, by at least about 8-fold, by at least about 9- fold, by at least about 10-fold, by at least about 12-fold, by at least about 14-fold, by at least about 16-fold, by at least about 18-fold, by at least about 20-fold, by at least about 25-fold, by at least about 30-fold, by at least about 35-fold, by at least about 40-fold, by at least about 45-fold, by at least about 50-fold, by at least about 75-fold, by at least about 100- fold, by at least about 200-fold, by at least about 300-fold, by at least about 400-fold, by at least about 500-fold, by at least about 750-fold, or by at least 1000-fold, compared to the expression of the c-Jun protein in a reference cell. Accordingly, in some aspects, methods provided herein comprise modifying immune cells (e.g., T cells) with an exogenous polynucleotide, which encodes a c-Jun polypeptide, in a medium comprising potassium ion at a concentration higher than 5 mM, wherein after the modification the expression of the c-Jun polypeptide in the immune cell is increased compared to a reference cell. In some aspects, the immune cells can be modified with the exogenous polynucleotide in a separate medium and then subsequently transferred and cultured in the medium comprising the potassium ion at a concentration higher than 5 mM. [0614] As described herein, in some aspects, the reference cell can comprise any of the following: (i) a corresponding cell that has not been modified and not cultured in the culture medium (i.e., does not comprise potassium ion at a concentration higher than 5 mM, e.g., TCM); (ii) a corresponding cell that has been modified but not cultured in the culture medium; (iii) a corresponding cell that has not been modified but cultured in the culture medium; or (iv) any combination of (i), (ii), and (iii). [0615] c-Jun is an oncogenic transcription factor belonging to the activator protein-1 (AP- 1) family. It interacts with various proteins (e.g., c-Fos) to form dimeric complexes that modulate a diverse range of cellular signaling pathways, including cell proliferation and tumor progression. Accordingly, increased c-Jun expression has been observed in certain cancers, and there has been much interest in developing c-Jun antagonists to treat such cancer. See, e.g., Brennan, A., et al., J Exp Clin Cancer Res 39(1): 184 (Sep.2020). [0616] In humans, the c-Jun protein is encoded by the JUN gene, which is located on chromosome 1 (nucleotides 58,780,791 to 58,784,047 of GenBank Accession No. NC_000001.11, minus strand orientation). Synonyms of the JUN gene, and the encoded protein thereof, are known and include "Jun proto-oncogene, AP-1 transcription factor subunit," "v-Jun avian sarcoma virus 17 oncogene homolog," "transcription factor AP-1," "Jun oncogene," "AP-1," "Jun activation domain binding protein," “p39”, and "enhancer- binding protein AP1." The wild-type human c-Jun protein sequence is 331 amino acids in length. The amino acid and nucleic acid sequences of the wild-type human c-Jun are provided in Tables 13 and 14, respectively. [0617] The wild type human c-Jun (UniProt identifier: P05412-1) protein sequence is 331 amino acids in length (SEQ ID NO: 13). The amino acid and nucleic acid sequences are shown in Table 13 and 14, respectively. Table 13. c-Jun Protein Sequence Table 14. c-Jun Nucleic Acid Sequence [0618] In some aspects, the immune cells disclosed herein have been modified to exhibit a reduced expression of a NR4A family member and comprise an exogenous nucleotide sequence encoding a wild-type c-Jun protein, such as the wild-type nucleotide sequence set forth in SEQ ID NO: 12. Alternatively, in some aspects, the immune cells described herein are modified to exhibit a reduced expression of a NR4A family member and comprise an exogenous nucleotide sequence encoding a mutant c-Jun protein, which retains the ability to prevent and/or reduce exhaustion in the immune cells. In some aspects, a mutant c-Jun protein, which can be expressed on the immune cells disclosed herein, comprises at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%) sequence identity with the C-terminal amino acid residues (e.g., C- terminal 50, 75, 100, 150, 200, or 250 or more residues), the C-terminal portion (e.g., quarter, third, or half) or C-terminal domains (e.g., epsilon, bZIP, and amino acids C- terminal thereof) of a wildtype c-Jun (i.e., SEQ ID NO: 13). In some aspects, the N- terminal amino acid residues (e.g., N-terminal 50, 75, 100, or 150 or more), the N-terminal portion (e.g., quarter, third, or half) or N-terminal domains (e.g., delta, transactivation domain, and amino acids N-terminal thereof) of a wildtype c-Jun (i.e., SEQ ID NO: 13) are deleted, mutated, or otherwise inactivated. In some aspects, the c-Jun is a mutant human c- Jun, optionally comprising an inactivating mutation in its transactivation domain or delta domain. In some aspects, the c-Jun mutant comprises S63A and S73A mutations. In some aspects, the c-Jun mutant comprises a deletion between residues 2 and 102 as compared to the wild-type c-Jun (SEQ ID NO: 13). In some aspects, the c-Jun mutant comprises a deletion between residues 30 and 50 as compared to the wild-type c-Jun (SEQ ID NO: 13). In some aspects, the mutant c-Jun comprises (i) S63A and S73A mutations or (ii) a deletion between residues 2 and 102 or between residues 30 and 50 as compared to wild-type c-Jun (SEQ ID NO: 13). Non-limiting examples of mutant c-Jun proteins that are useful for the present disclosure are provided in US 2019/0183932 A1 and US 2017/0037376 A1, each of which is incorporated herein by reference in its entirety. [0619] In some aspects, an immune cell described herein has been modified to exhibit a reduced expression of a NR4A family member and comprise an exogenous nucleotide sequence encoding a c-Jun polypeptide, wherein the exogenous nucleotide sequence has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of the nucleic acid sequences set forth in SEQ ID NOs: 1 to 11. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 1 to 11. [0620] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 1. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 1. In some aspects, the exogenous polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 1. [0621] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 2. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 2. In some aspects, the exogenous polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 2. [0622] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 3. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 3. In some aspects, the exogenous polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 3. [0623] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 4. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 96%, at least 97%, at least 98%, or at least 99% to the nucleic acid sequence set forth in SEQ ID NO: 4. In some aspects, the exogenous polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 4. [0624] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 5. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 5. In some aspects, the exogenous polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 5. [0625] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 80%, at least 85%, at least 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 6. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 6. In some aspects, the exogenous polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 6. [0626] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 7. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 7. In some aspects, the exogenous polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 7. [0627] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 8. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 8. In some aspects, the exogenous polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 8. [0628] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 9. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 9. In some aspects, the exogenous polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 9. [0629] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 10. In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 10. In some aspects, the exogenous nucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 10. [0630] Exemplary c-Jun nucleotide sequences are provided in Table 15 (below).

Table 15. c-Jun Nucleotide Sequences [0631] The c-Jun nucleotide sequence disclosed herein can be codon-optimized using any methods known in the art. For instance, in some aspects, the codons of a c-Jun nucleotide sequence disclosed herein has been optimized to modify (e.g., increase or decrease) one or more of the following parameters compared to the wild-type nucleotide sequence (e.g., SEQ ID NO: 11): (i) codon adaptation index (i.e., codon usage bias); (ii) guanine-cytosine (GC) nucleotide content; (iii) mRNA secondary structure and unstable motifs; (iv) repeat sequences (e.g., direct repeats, inverted repeats, dyad repeats); (v) restriction enzyme recognition sites; or (vi) combinations thereof. [0632] In some aspects, an exogenous polynucleotide encoding a c-Jun polypeptide provided herein is capable of increasing the expression of the encoded c-Jun protein when transfected, transduced or otherwise introduced into an immune cell (e.g., human immune cell), as compared to a corresponding expression in a cell transfected with the wild-type c- Jun nucleotide sequence (e.g., SEQ ID NO: 11). In some aspects, the expression of the c- Jun protein in the immune cell modified to comprise the exogenous polynucleotide is increased by at least about 0.5-fold, by at least about 1-fold, by at least about 2-fold, by at least about 3-fold, by at least about 4-fold, by at least about 5-fold, by at least about 6-fold, by at least about 7-fold, by at least about 8-fold, by at least about 9-fold, by at least about 10-fold, by at least about 12-fold, by at least about 14-fold, by at least about 16-fold, by at least about 18-fold, by at least about 20-fold, by at least about 25-fold, by at least about 30- fold, by at least about 35-fold, by at least about 40-fold, by at least about 45-fold, by at least about 50-fold, by at least about 75-fold, by at least about 100-fold, by at least about 200- fold, by at least about 300-fold, by at least about 400-fold, by at least about 500-fold, by at least about 750-fold, or by at least 1000-fold, compared to the corresponding expression in the cell transfected, transduced, or otherwise genetically modified to express with the wild- type c-Jun nucleotide sequence (e.g., SEQ ID NO: 11). [0633] While certain disclosures provided above generally relate to modifying an immune cell to comprise an exogenous nucleotide sequence encoding a c-Jun protein (wild-type c- Jun or a variant thereof), it will be apparent to those skilled in the art that other suitable methods can be used to induce and/or increase c-Jun protein expression (either wild-type or a variant thereof) in a cell. For instance, as described herein, in some aspects, the endogenous c-Jun protein expression can be increased with a transcriptional activator (e.g., CRISPRa). Unless indicated otherwise, disclosures provided above using exogenous nucleotide sequences equally apply to other approaches of inducing and/or increasing c- Jun protein expression in a cell provided herein (e.g., transcriptional activator, e.g., CRISPRa). Delivery Vectors [0634] In some aspects, provided herein are vectors (e.g., expression vectors) that can be used to modify an immune cell described herein (e.g., cultured using the methods provided herein). In some aspects, a vector described herein comprises multiple (e.g., 2, 3, or 4 or more) polynucleotides, wherein the multiple polynucleotides each encode a protein described herein (e.g., gene editing tool, ligand binding protein (e.g., chimeric binding protein, e.g., CAR), c-Jun, or EGFRt). Accordingly, in some aspects, a vector comprises a polycistronic vector (e.g., bicistronic vector or tricistronic vector). In some aspects, the polynucleotides described herein are comprised on the same vector (e.g., on a multicistronic expression vector). In some aspects, the polynucleotides encoding the proteins described herein (e.g., gene editing tool, ligand binding protein (e.g., chimeric binding protein, e.g., CAR), c-Jun, or EGFRt) are provided on one or more separate vectors. [0635] As described herein, such vectors are useful for recombinant expression in host cells and cells targeted for therapeutic intervention. The term "vector," as used herein, is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked; or an entity comprising such a nucleic acid molecule capable of transporting another nucleic acid. In some aspects, the vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. In some aspects, the vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors, or polynucleotides that are part of vectors, are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication, and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply, "expression vectors"). In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present disclosure, "plasmid" and "vector" can sometimes be used interchangeably, depending on the context, as the plasmid is the most commonly used form of vector. However, also disclosed herein are other forms of expression vectors, such as viral vectors (e.g., lentiviruses, replication defective retroviruses, poxviruses, herpesviruses, baculoviruses, adenoviruses, and adeno-associated viruses), which serve equivalent functions. [0636] In some aspects, a vector comprises a polynucleotide described herein (e.g., encoding a ligand binding protein and/or c-Jun) and a regulatory element. For instance, in some aspects, a vector comprises a polynucleotide described herein (e.g., comprising a gene editing tool, c-Jun, and/or encoding a ligand binding protein), operatively linked to a promoter. In some aspects, the vector can comprise multiple promoters (e.g., at least two, at least three, at least four, at least five or more). For instance, in some aspects, the nucleotide sequence comprising the gene editing tool can be under the control of a first promoter, and the nucleotide sequence encoding one or more of the additional components of the polynucleotide (e.g., chimeric binding protein and/or c-Jun) can be under the control of a second promoter. In some aspects, each of the multiple promoters are the same. In some aspects, one or more of the multiple promoters are different. [0637] Any suitable promoter known in the art can be used with the present disclosure. In some aspects, the promoters useful for the present disclosure comprises a mammalian or viral promoter, such as a constitutive or inducible promoter. In some aspects, the promoters for the present disclosure comprises at least one constitutive promoter and at least one inducible promoter, e.g., tissue specific promoter. [0638] Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter, and other constitutive promoters. Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of Moloney leukemia virus, and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. As described herein, in some aspects, promoters that can be used with the present disclosure are inducible promoters. Inducible promoters are expressed in the presence of an inducing agent. For example, the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions. When multiple inducible promoters are present, they can be induced by the same inducer molecule or a different inducer. [0639] In some aspects, the promoter comprises a myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted (MND) promoter, EF1a promoter, or both. [0640] In some aspects, a vector useful for the present disclosure (e.g., comprising a gene editing tool described herein and/or a nucleotide sequence encoding a ligand binding protein) further comprises one or more additional regulatory elements. Non-limiting examples of regulatory elements include a translation enhancer element (TEE), a translation initiation sequence, a microRNA binding site or seed thereof, a 3’ tailing region of linked nucleosides, an AU rich element (ARE), a post transcription control modulator, a 5' UTR, a 3' UTR, a localization sequence (e.g., membrane-localization sequences, nuclear localization sequences, nuclear exclusion sequences, or proteasomal targeting sequences), post-translational modification sequences (e.g., ubiquitination, phosphorylation, or dephosphorylation), or combinations thereof. [0641] In some aspects, the vector can additionally comprise a transposable element. Accordingly, in some aspects, the vector comprises a polynucleotide described herein (e.g., gene editing tool described herein and/or encoding a ligand binding protein), which is flanked by at least two transposon-specific inverted terminal repeats (ITRs). In some aspects, the transposon-specific ITRs are recognized by a DNA transposon. In some aspects, the transposon-specific ITRs are recognized by a retrotransposon. Any transposon system known in the art can be used to introduce the nucleic acid molecules into the genome of a host cell, e.g., an immune cell. In some aspects, the transposon is selected from hAT- like Tol2, Sleeping Beauty (SB), Frog Prince, piggyBac (PB), and any combination thereof. In some aspects, the transposon comprises Sleeping Beauty. In some aspects, the transposon comprises piggyBac. See, e.g., Zhao et al., Transl. Lung Cancer Res.5(1):120- 25 (2016), which is incorporated by reference herein in its entirety. [0642] In some aspects, the vector is a transfer vector. The term "transfer vector" refers to a composition of matter which comprises an isolated nucleic acid (e.g., a polynucleotide described herein) and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "transfer vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to further include non- plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, a polylysine compound, liposome, and the like. Examples of viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like. [0643] In some aspects, the vector is an expression vector. The term "expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide. [0644] In some aspects, the vector is a viral vector, a mammalian vector, or bacterial vector. In some aspects, the vector is selected from the group consisting of an adenoviral vector, a lentivirus, a Sendai virus vector, a baculoviral vector, an Epstein Barr viral vector, a papovaviral vector, a vaccinia viral vector, a herpes simplex viral vector, a hybrid vector, and an adeno associated virus (AAV) vector. [0645] In some aspects, the adenoviral vector is a third generation adenoviral vector. ADEASY™ is by far the most popular method for creating adenoviral vector constructs. The system consists of two types of plasmids: shuttle (or transfer) vectors and adenoviral vectors. The transgene of interest is cloned into the shuttle vector, verified, and linearized with the restriction enzyme PmeI. This construct is then transformed into ADEASIER-1 cells, which are BJ5183 E. coli cells containing PADEASY™. PADEASY™ is a ∼33Kb adenoviral plasmid containing the adenoviral genes necessary for virus production. The shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid. One can also co-transform standard BJ5183 with supercoiled PADEASY™ and the shuttle vector, but this method results in a higher background of non-recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then verified for size and proper restriction digest patterns to determine that the transgene has been inserted into the adenoviral plasmid, and that other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized with PacI to create a linear dsDNA construct flanked by ITRs. 293 or 911 cells are transfected with the linearized construct, and virus can be harvested about 7-10 days later. In addition to this method, other methods for creating adenoviral vector constructs known in the art at the time the present application was filed can be used to practice the methods disclosed herein. [0646] In some aspects, the viral vector is a retroviral vector, e.g., a lentiviral vector (e.g., a third or fourth generation lentiviral vector). The term "lentivirus" refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses. The term "lentiviral vector" refers to a vector derived from at least a portion of a lentivirus genome, including especially a self-inactivating lentiviral vector as provided in Milone et al., Mol. Ther. 17(8): 1453- 1464 (2009). Other examples of lentivirus vectors that can be used in the clinic, include but are not limited to, e.g., the LENTIVECTOR® gene delivery technology from Oxford BioMedica, the LENTIMAX™ vector system from Lentigen and the like. Nonclinical types of lentiviral vectors are also available and would be known to one skilled in the art. [0647] Lentiviral vectors are usually created in a transient transfection system in which a cell line is transfected with three separate plasmid expression systems. These include the transfer vector plasmid (portions of the HIV provirus), the packaging plasmid or construct, and a plasmid with the heterologous envelope gene (env) of a different virus. The three plasmid components of the vector are put into a packaging cell which is then inserted into the HIV shell. The virus portions of the vector contain insert sequences so that the virus cannot replicate inside the cell system. Current third generation lentiviral vectors encode only three of the nine HIV-1 proteins (Gag, Pol, Rev), which are expressed from separate plasmids to avoid recombination-mediated generation of a replication-competent virus. In fourth generation lentiviral vectors, the retroviral genome has been further reduced (see, e.g., TAKARA® LENTI-X™ fourth-generation packaging systems). [0648] In some aspects, non-viral methods can be used to deliver a polynucleotide described herein (e.g., a gene editing tool described herein, e.g., a gRNA targeting one or more members of the NR4A family) into an immune cell. In some aspects, the non-viral method includes the use of a transposon. In some aspects, use of a non-viral method of delivery permits reprogramming of cells, e.g., T or NK cells, and direct infusion of the cells into the subject. In some aspects, the polynucleotide can be inserted into the genome of a target cell (e.g., a T cell) or a host cell (e.g., a cell for recombinant expression of the encoded proteins) by using CRISPR/Cas systems and genome edition alternatives such as zinc- finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and meganucleases (MNs). Non-viral delivery systems also include electroporation, cell squeezing, nanoparticles including lipid nanoparticles, gold nanoparticles, polymer nanoparticles. Illustrative non-viral delivery systems include and are described for example in EbioMedicine 2021 May; 67:103354. [0649] In some aspects, the polynucleotides disclosed herein are DNA (e.g., a DNA molecule or a combination thereof), RNA (e.g., a RNA molecule or a combination thereof), or any combination thereof. In some aspects, the polynucleotides are single stranded or double stranded RNA or DNA (e.g., ssDNA or dsDNA) in genomic or cDNA form, or DNA-RNA hybrids, each of which can include chemically or biochemically modified, non- natural, or derivatized nucleotide bases. As described herein, such nucleic acid sequences can comprise additional sequences useful for promoting expression and/or purification of the encoded polypeptide, including but not limited to polyA sequences, modified Kozak sequences, and sequences encoding epitope tags, export signals, and secretory signals, nuclear localization signals, and plasma membrane localization signals. It will be apparent to those of skill in the art, based on the teachings herein, what nucleotide sequences will encode the different polypeptides described herein (e.g., chimeric binding protein and/or EGFRt). Compositions of the Disclosure [0650] Certain aspects of the present disclosure are directed to a composition comprising a population of immune cells (e.g., T cell and/or NK cell) modified and cultured according to the methods disclosed herein (e.g., contacted with PCS in a medium comprising potassium ion at a concentration higher than 5 mM and edited to exhibit reduced expression of a NR4A family member). Cell populations cultured according to the methods and/or in a metabolic reprogramming medium disclosed herein have an increased number of less- differentiated cells as compared to comparable cells cultured according to conventional methods, e.g., contacted with PCS in media containing less than 5 mM K ⁺ and modified to exhibit a reduced expression of a NR4A family member. In some aspects, the cells cultured according to the methods disclosed herein exhibit increased expression of one or more marker typical of a stem-like phenotype. In some aspects, cell populations cultured according to the methods and/or in a metabolic reprogramming medium disclosed herein have an increased number of effector-like cells as compared to comparable cells cultured according to conventional methods, e.g., in media containing less than 5 mM K ⁺ and/or not comprising PCS. In some aspects, cell populations cultured according to the methods and/or in a metabolic reprogramming medium disclosed herein have both an increased number of stem-like and effector-like cells as compared to comparable cells cultured according to conventional methods, e.g., in media containing less than 5 mM K ⁺ and/or not comprising PCS. In some aspects, the cells cultured according to the methods disclosed herein exhibit greater proliferative potential compared to cells cultured according to conventional methods. In some aspects, the cells cultured according to the methods disclosed herein exhibit increased transduction efficiency. In some aspects, the cells cultured according to the methods disclosed herein exhibit increased in vivo viability upon transplantation in a subject. In some aspects, the cells cultured according to the methods disclosed herein exhibit increased cell potency. In some aspects, the cells cultured according to the methods disclosed herein exhibit decreased cell exhaustion. In some aspects, the cells cultured according to the methods disclosed herein exhibit increased in vivo persistence upon transplantation in a subject. In some aspects, the cells cultured according to the methods disclosed herein exhibit increased in vivo activity upon transplantation in a subject. In some aspects, the cells cultured according to the methods disclosed herein exhibit a more durable in vivo response upon transplantation in a subject. In some aspects, the subject is a human. [0651] In some aspects, at least about 5% of the cells in the cell composition have a stem- like phenotype. In some aspects, at least about 10% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 15% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 20% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 25% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 30% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 35% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 40% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 45% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 50% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 55% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 60% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 65% of the cells in the cell composition have a stem-like phenotype. In some aspects, at least about 70% of the cells in the cell composition have a stem-like phenotype. [0652] In some aspects, following culture of T cells according to the methods disclosed herein, stem-like T cells constitute at least about 10% to at least about 70% of the total number of T cells in the culture. In some aspects, following culture of T cells according to the methods disclosed herein, stem-like T cells constitute at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, or at least about 70% of the total number of CD8 ⁺ T cells in the culture. In some aspects, following culture of T cells according to the methods disclosed herein, stem-like T cells constitute at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, or at least about 70% of the total number of CD4 ⁺ T cells in the culture. [0653] In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 1.5-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem- like phenotype in the cell composition is increased at least about 2.0-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 2.5- fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 3.0-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 3.5-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 4.0-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 4.5-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 5.0-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem- like phenotype in the cell composition is increased at least about 5.5-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 6.0- fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 6.5-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 7.0-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 7.5-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 8.0-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 9.0-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem- like phenotype in the cell composition is increased at least about 10-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 15- fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 20-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 30-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 40-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 50-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 75-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 100-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 500-fold as compared to the number of cells in the cell composition prior to the culture. In some aspects, the number of cells having a stem-like phenotype in the cell composition is increased at least about 1000-fold as compared to the number of cells in the cell composition prior to the culture. [0654] In some aspects, following culture of T cells according to the methods disclosed herein, at least about 10% to at least about 70% of the total number of T cells in the culture are CD39-/TCF7 ⁺ T cells. In some aspects, following culture of T cells according to the methods disclosed herein, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, or at least about 40% of the total number of T cells in the culture are CD39-/TCF7 ⁺ T cells. In some aspects the T cells are CD4 ⁺ T cells. In some aspects the T cells are CD8 ⁺ T cells. [0655] In some aspects, the cell composition comprises immune cells, e.g., T cells and/or NK cells. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD95. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which do not express CD45RO. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD45RA. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CCR7. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD62L. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express TCF7. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD3. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD27. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD95 and CD45RA. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD45RA and CCR7. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD95, CD45RA, and CCR7. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD45RA, CCR7, and CD62L. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD95, CD45RA, CCR7, and CD62L. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD45RA, CCR7, CD62L, and TCF7. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD95, CD45RA, CCR7, CD62L, and TCF7. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD45RA, CCR7, CD62L, TCF7, and CD27. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD95, CD45RA, CCR7, CD62L, TCF7, and CD27. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express, CD45RA, CCR7, CD62L, TCF7, and CD27, and which do not express CD45RO or which are CD45RO ^low . In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD95, CD45RA, CCR7, CD62L, TCF7, and CD27, and which do not express CD45RO or which are CD45RO ^low . [0656] In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which do not express CD39 and CD69. In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, which express CD8, and which do not express CD39 and CD69. In some aspects, following culture of T cells according to the methods disclosed herein, at least about 10% to at least about 40% of the total number of T cells in the culture are CD39- /CD69- T cells. In some aspects, following culture of T cells according to the methods disclosed herein, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, or at least about 40% of the total number of T cells in the culture are CD39-/CD69- T cells. [0657] In some aspects, the cell composition comprises an increased percentage of immune cells, e.g., T cells and/or NK cells, which express both (i) one or more stem-like markers and (ii) one or more effector-like markers. In some aspects, the cell composition comprises an increased percentage of immune cells, e.g., T cells and/or NK cells, which express at least two stem-like markers and one or more effector-like markers. In some aspects, the cell composition comprises an increase percent of immune cells, e.g., T cells and/or NK cells, which express at least three stem-like markers and one or more effector-like markers. In some aspects, the cell composition comprises an increased percentage of immune cells, e.g., T cells and/or NK cells, which express at least four stem-like markers and one or more effector-like markers. In some aspects, the cell composition comprises an increased percentage of immune cells, e.g., T cells and/or NK cells, which express one or more stem- like markers and at least two effector-like markers. [0658] In some aspects, the stem-like markers are selected from CD45RA ⁺ , CD62L ⁺ , CCR7 ⁺ , CD27 ⁺ , CD28 ⁺ , BACH2 ⁺ , LEF1 ⁺ , TCF7 ⁺ , and any combination thereof. In some aspects the stem-like markers comprise CD45RA ⁺ , CD62L ⁺ , CCR7 ⁺ , and TCF7 ⁺ , or any combination thereof. In some aspects, the cell expresses CD45RO ^low . In some aspects, the stem-like markers comprise one or more genes listed herein as part of a gene-signature (see supra; see, e.g., Gattinoni, L., et al., Nat Med 17(10): 1290-97 (2011) or Galletti et al. Nat Immunol 21, 1552-62 (2020)). [0659] In some aspects, the stem-like markers comprise a gene expressed in the WNT signaling pathway. In some aspects, the stem-like markers comprise one or more genes selected from GNG2, PSMC3, PSMB10, PSMC5, PSMB8, PSMB9, AKT1, MYC, CLTB, PSME1, DVL2, PFN1, H2AFJ, LEF1, CTBP1, MOV10, HIST1H2BD, FZD3, ITPR3, PARD6A, LRP5, HIST2H4A, HIST2H3C, HIST1H2AD, HIST2H2BE, HIST3H2BB, DACT1, and any combination thereof. In some aspects, the stem-like markers comprise one or more genes selected from MYC, AKT1, LEF1, and any combination thereof. [0660] In some aspects, the effector-like markers are selected from pSTAT5 ⁺ , STAT5 ⁺ , pSTAT3 ⁺ , STAT3 ⁺ , and any combination thereof. In some aspects, the effector-like marker comprises a STAT target selected from the group consisting of AKT1, AKT2, AKT3, BCL2L1, CBL, CBLB, CBLC, CCND1, CCND2, CCND3, CISH, CLCF1, CNTF, CNTFR, CREBBP, CRLF2, CSF2, CSF2RA, CSF2RB, CSF3, CSF3R, CSH1, CTF1, EP300, EPO, EPOR, GH1, GH2, GHR, GRB2, IFNA1, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, IFNA2, IFNA21, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNAR1, IFNAR2, IFNB1, IFNE, IFNG, IFNGR1, IFNGR2, IFNK, IFNL1, IFNL2, IFNL3, IFNLR1, IFNW1, IL10, IL10RA, IL10RB, IL11, IL11RA, IL12A, IL12B, IL12RB1, IL12RB2, IL13, IL13RA1, IL13RA2, IL15, IL15RA, IL19, IL2, IL20, IL20RA, IL20RB, IL21, IL21R, IL22, IL22RA1, IL22RA2, IL23A, IL23R, IL24, IL26, IL2RA, IL2RB, IL2RG, IL3, IL3RA, IL4, IL4R, IL5, IL5RA, IL6, IL6R, IL6ST, IL7, IL7R, IL9, IL9R, IRF9, JAK1, JAK2, JAK3, LEP, LEPR, LIF, LIFR, MPL, MYC, OSM, OSMR, PIAS1, PIAS2, PIAS3, PIAS4, PIK3CA, PIK3CB, PIK3CD, PIK3CG, PIK3R1, PIK3R2, PIK3R3, PIK3R5, PIM1, PRL, PRLR, PTPN11, PTPN6, SOCS1, SOCS2, SOCS3, SOCS4, SOCS5, SOCS7, SOS1, SOS2, SPRED1, SPRED2, SPRY1, SPRY2, SPRY3, SPRY4, STAM, STAM2, STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6, TPO, TSLP, TYK2, and any combination thereof. [0661] In some aspects, the effector-like markers are effector memory-associated genes that comprise one or more genes selected from TBCD, ARL4C, KLF6, LPGAT1, LPIN2, WDFY1, PCBP4, PIK343, FAS, LLGL2, PPP2R2B, TTC39C, GGA2, LRP8, PMAIP1, MVD, IL15RA, FHOD1, EML4, PEA15, PLEKHA5, WSB2, PAM, CD68, MSC, TLR3, S1PR5, KLRB1, CYTH3, RAB27B, SCD5, and any combination thereof. In some aspects, the effector-like markers comprise one or more genes selected from KLF6, FAS, KLRB1, TLR3, and any combination thereof. [0662] In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, that are CD45RA ⁺ , STAT5 ⁺ , and STAT3 ⁺ . In some aspects, the cell composition comprises an increase in the percent of immune cells e.g., T cells and/or NK cells, that are CD62L ⁺ , STAT5 ⁺ , and STAT3 ⁺ . In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, that are TCF7 ⁺ , STAT5 ⁺ , and STAT3 ⁺ . In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, that are CD45RA ⁺ , CD62L ⁺ , CCR7 ⁺ , CD27 ⁺ , CD28 ⁺ , BACH2 ⁺ , LEF1 ⁺ , TCF7 ⁺ , STAT5 ⁺ , and STAT3 ⁺ . In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, that are CD45RA ⁺ , CD62L ⁺ , CCR7 ⁺ , CD27 ⁺ , CD28 ⁺ , BACH2 ⁺ , LEF1 ⁺ , TCF7 ⁺ , pSTAT5 ⁺ , STAT5 ⁺ , pSTAT3 ⁺ , and STAT3 ⁺ . In some aspects, the cell composition comprises an increase in the percent of immune cells, e.g., T cells and/or NK cells, that are CD45RA ⁺ , CD45RO-, CD62L ⁺ , CCR7 ⁺ , CD27 ⁺ , CD28 ⁺ , BACH2 ⁺ , LEF1 ⁺ , TCF7 ⁺ , pSTAT5 ⁺ , STAT5 ⁺ , pSTAT3 ⁺ , and STAT3 ⁺ . [0663] In some aspects, an immune cell, e.g., T cells and/or NK cells, comprises one or more markers selected from CD45RA ⁺ , CD62L ⁺ , CCR7 ⁺ , CD27 ⁺ , CD28 ⁺ , BACH2 ⁺ , LEF1 ⁺ , TCF7 ⁺ , and any combination thereof and one or more markers selected from pSTAT5 ⁺ , STAT5 ⁺ , pSTAT3 ⁺ , STAT3 ⁺ , and any combination thereof. In some aspects, the immune cell, e.g., T cells and/or NK cells, expresses CD45RO ^low . In some aspects, an immune cell, e.g., T cells and/or NK cells, comprises one or more markers selected from CD45RA ⁺ , CD62L ⁺ , CCR7 ⁺ , CD27 ⁺ , CD28 ⁺ , BACH2 ⁺ , LEF1 ⁺ , TCF7 ⁺ , and any combination thereof and one or more effector-like markers. In some aspects, an immune cell, e.g., T cells and/or NK cells, comprises one or more stem-like markers and one or more markers selected from pSTAT5 ⁺ , STAT5 ⁺ , pSTAT3 ⁺ , STAT3 ⁺ , and any combination thereof. In some aspects, the immune cell, e.g., T cells and/or NK cells, expresses CD45RO ^low . [0664] Some aspects of the present disclosure are directed to a cell composition comprising a population of immune cells, wherein the population of immune cells comprises (i) a first sub-population of immune cells expressing one or more stem-like markers (e.g., stem-like immune cells) and (ii) a second sub-population of immune cells expressing one or more effector-like marker (e.g., effector-like immune cells), wherein the population of immune cells comprises a higher percentage (i.e., the number of stem-like immune cells/the total number of immune cells) of the first sub-population of immune cells expressing one or more stem-like markers, as compared to a population of immune cells cultured using conventional methods, e.g., in a medium having less than 5 mM potassium ion. In some aspects, the immune cells are T cells. In some aspects, the immune cells are NK cells. In some aspects, the immune cells, e.g., T cells and/or NK cells, cultured according to the methods disclosed herein result in these cell compositions. [0665] In some aspects, immune cells, e.g., T cells and/or NK cells, cultured according to the methods disclosed herein have increased expression, e.g., a higher percentage of immune cells, e.g., T cells and/or NK cells, that express, GZMB, MHC-II, LAG3, TIGIT, and/or NKG7, and decreased expression, e.g., a lower percentage of immune cells, e.g., T cells and/or NK cells, that express, IL-32. Cells highest for NKG7 have been shown to be better killers (Malarkannan et al.2020 Nat. Immuno.), whereas cells higher in IL-32 have been shown to have activation-induced cell death (Goda et al., 2006 Int. Immunol). In some aspects the immune cells, e.g., T cells and/or NK cells, with higher expression of GZMB, MHC-II, LAG3, TIGIT, and/or NKG7 are CD8 ⁺ T cells expressing effector-like markers. In some aspects the immune cells, e.g., T cells and/or NK cells, with lower expression of IL-32 are CD8 ⁺ T cells expressing effector-like markers. [0666] In some aspects, the cell composition, obtained by any method described herein (e.g., the yield of the final cell product for use as a therapy), comprises at least about 1 x 10 ⁵ , 5 x 10 ⁵ , 1 x 10 ⁶ , 5 x 10 ⁶ , 1 x 10 ⁷ , 5 x 10 ⁷ , 1 x 10 ⁸ , 5 x 10 ⁸ , 1 x 10 ⁹ , or 5 x 10 ⁹ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 1 x 10 ³ , 5 x 10 ³ , 1 x 10 ⁴ , 5 x 10 ⁴ , 1 x 10 ⁵ , 5 x 10 ⁵ , 1 x 10 ⁶ , 5 x 10 ⁶ , 1 x 10 ⁷ , 5 x 10 ⁷ , 1 x 10 ⁸ , 5 x 10 ⁸ , 1 x 10 ⁹ , or 5 x 10 ⁹ stem-like cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 5 x 10 ⁹ , 6 x 10 ⁹ , 7 x 10 ⁹ , 8 x 10 ⁹ , 9 x 10 ⁹ , 1 x 10 ¹⁰ , 2 x 10 ¹⁰ , 3 x 10 ¹⁰ , 4 x 10 ¹⁰ , 5 x 10 ¹⁰ , 6 x 10 ¹⁰ , 7 x 10 ¹⁰ , 8 x 10 ¹⁰ , 9 x 10 ¹⁰ , 10 x 10 ¹⁰ , 11 x 10 ¹⁰ , 12 x 10 ¹⁰ , 13 x 10 ¹⁰ , 14 x 10 ¹⁰ , or 15 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 1 x 10 ⁶ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 1 x 10 ⁶ stem-like cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 1 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 2 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 3 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 4 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 5 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 6 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 7 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 8 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 9 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 10 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 11 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 12 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 13 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 14 x 10 ¹⁰ cells. In some aspects, the cell composition, obtained by any method described herein, comprises at least about 15 x 10 ¹⁰ cells. In some aspects, cell yield represents the total number of CD3 ⁺ cells. [0667] In some aspects, the methods disclosed herein yield a composition comprising at least about 1 x 10 ¹⁰ , at least about 1.1 x 10 ¹⁰ , at least about 1.2 x 10 ¹⁰ , at least about 1.3 x 10 ¹⁰ , at least about 1.4 x 10 ¹⁰ , at least about 1.5 x 10 ¹⁰ , at least about 1.6 x 10 ¹⁰ , at least about 1.7 x 10 ¹⁰ , at least about 1.8 x 10 ¹⁰ , at least about 1.9 x 10 ¹⁰ , or at least about 2.0 x 10 ¹⁰ cells by at least about day 10 of culturing in the presently disclosed medium. In some aspects, the methods disclosed herein yield a composition comprising at least about 1.8 x 10 ¹⁰ cells by at least about day 10 of culturing in the presently disclosed medium. [0668] In some aspects, the cell composition comprises at least about 1 x 10 ¹⁰ , at least about 1.1 x 10 ¹⁰ , at least about 1.2 x 10 ¹⁰ , at least about 1.3 x 10 ¹⁰ , at least about 1.4 x 10 ¹⁰ , at least about 1.5 x 10 ¹⁰ , at least about 1.6 x 10 ¹⁰ , at least about 1.7 x 10 ¹⁰ , at least about 1.8 x 10 ¹⁰ , at least about 1.9 x 10 ¹⁰ , or at least about 2.0 x 10 ¹⁰ stem-like cells. In some aspects, the methods disclosed herein yield a composition comprising at least about 1 x 10 ¹⁰ , at least about 1.1 x 10 ¹⁰ , at least about 1.2 x 10 ¹⁰ , at least about 1.3 x 10 ¹⁰ , at least about 1.4 x 10 ¹⁰ , at least about 1.5 x 10 ¹⁰ , at least about 1.6 x 10 ¹⁰ , at least about 1.7 x 10 ¹⁰ , at least about 1.8 x 10 ¹⁰ , at least about 1.9 x 10 ¹⁰ , or at least about 2.0 x 10 ¹⁰ stem-like cells by at least about day 10 of culture. In some aspects, the methods disclosed herein yield a composition comprising at least about 1.8 x 10 ¹⁰ stem-like cells by at least about day 10 of culturing in the presently disclosed medium. [0669] In some aspects, the methods disclosed herein yield a composition comprising immune cells that are at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% viable. In some aspects, the methods disclosed herein yield a composition comprising at least about 1.8 x 10 ¹⁰ stem-like cells with at least about 94% cell viability. Methods of Treatment [0670] Some aspects of the present disclosure are directed to methods of administering an immune cell described herein (e.g., contacted with PCS in MRM and modified to express a ligand-binding protein, a reduced level of a member of the NR4A family, and cultured using the methods provided herein). Some aspects of the present disclosure are directed to methods of treating a disease or disorder in a subject in need thereof, comprising administering to the subject an immune cell described herein. For instance, in some aspects, disclosed herein is a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject an immune cell (e.g., T cell and/or NK cell) that has been modified to express a ligand-binding protein (e.g., CAR or engineered TCR) and exhibit a reduced expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3). In some aspects, disclosed herein is a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject an immune cell (e.g., T cell and/or NK cell) that has been modified to express a ligand-binding protein (e.g., CAR or engineered TCR) and exhibit a reduced expression of a member of the NR4A family (e.g., NR4A1, NR4A2, and/or NR4A3) and an increased expression of a c-Jun. In some aspects, the disease or condition comprises a tumor, i.e., a cancer. In some aspects, the method comprises stimulating a T cell-mediated immune response to a target cell population or tissue in a subject, comprising administering an immune cell described herein. In some aspects, the target cell population comprises a tumor. In some aspects, the tumor is a solid tumor. [0671] In some aspects, administering an immune cell described herein (e.g., modified to express a ligand-binding protein, a reduced level of a NR4A family member, and cultured using the methods provided herein) reduces a tumor volume in the subject compared to a reference tumor volume. In some aspects, the reference tumor volume is the tumor volume in the subject prior to the administration. In some aspects, the reference tumor volume is the tumor volume in a corresponding subject that did not receive the administration. In some aspects, the tumor volume in the subject is reduced by at least about 5%, at least about 10%, at least about 15%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% after the administration compared to the reference tumor volume. [0672] In some aspects, treating a tumor comprises reducing a tumor weight in the subject. In some aspects, administering an immune cell described herein (e.g., modified to express a ligand-binding protein, a reduced level of a NR4A family member, and cultured using the methods provided herein) can reduce the tumor weight in a subject when administered to the subject. In some aspects, the tumor weight is reduced by at least about 5%, at least about 10%, at least about 15%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% after the administration compared to a reference tumor weight. In some aspects, the reference tumor weight is the tumor weight in the subject prior to the administration. In some aspects, the reference tumor weight is the tumor weight in a corresponding subject that did not receive the administration. [0673] In some aspects, administering an immune cell described herein (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member and cultured using the methods provided herein) to a subject, e.g., suffering from a tumor, can increase the number and/or percentage of T cells (e.g., CD4 ⁺ or CD8 ⁺ ) in the blood of the subject. In some aspects, the T cells are the modified immune cells. In some aspects, the number and/or percentage of the T cells (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member and cultured using the methods provided herein) in the blood is increased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, at least about 200%, at least about 210%, at least 220%, at least about 230%, at least about 240%, at least about 250%, at least about 260%, at least about 270%, at least about 280%, at least about 290%, or at least about 300% or more compared to a reference (e.g., corresponding value in a subject that did not receive the administration or the same subject prior to the administration). In some aspects, the number and/or percentage of T cells in the blood is increased by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750- fold, or at least about 1000-fold, or more compared to a reference (e.g., corresponding subject that did not receive the administration). [0674] In some aspects, administering an immune cell described herein (e.g., modified to express a ligand-binding protein and have reduced level of a NR4A family member, and cultured using the methods provided herein) to a subject, e.g., suffering from a tumor, can increase the number and/or percentage of T cells (e.g., CD4 ⁺ or CD8 ⁺ ) in a tumor and/or a tumor microenvironment (TME) of the subject. In some aspects, the T cells are the modified immune cells. In some aspects, the number and/or percentage of the T cells (e.g., modified to express a ligand-binding protein and have reduced level of a NR4A family member) in a tumor and/or TME is increased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, at least about 200%, at least about 210%, at least 220%, at least about 230%, at least about 240%, at least about 250%, at least about 260%, at least about 270%, at least about 280%, at least about 290%, or at least about 300% or more compared to a reference (e.g., corresponding value in a subject that did not receive the administration or the same subject prior to the administration). In some aspects, the number and/or percentage of T cells in a tumor and/or TME is increased by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1000-fold or more compared to a reference (e.g., corresponding subject that did not receive the administration). [0675] In some aspects, administering an immune cell described herein (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) to a subject, e.g., suffering from a tumor, can increase the duration of an immune response in a subject relative to the duration of an immune response in a corresponding subject that did not receive the administration. In some aspects, the duration of the immune response is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100%, at least about 150%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, or at least about 1000% or more compared to a reference (e.g., corresponding subject that did not receive the administration). In some aspects, the duration of the immune response is increased by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1000-fold or more compared to a reference (e.g., corresponding subject that did not receive the administration). In some aspects, the duration of an immune response is increased by at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, or at least about 5 years, as compared to a reference (e.g., corresponding subject that did not receive the administration). [0676] As described herein, an immune cell described herein (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) can be used to treat variety of cancers. Non-limiting examples of cancers that can be treated include adrenal cortical cancer, advanced cancer, anal cancer, aplastic anemia, bile duct cancer, bladder cancer, bone cancer, bone metastasis, brain tumors, brain cancer, breast cancer, childhood cancer, cancer of unknown primary origin, Castleman disease, cervical cancer, colon/rectal cancer, endometrial cancer, esophagus cancer, Ewing family of tumors, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gestational trophoblastic disease, Hodgkin disease, Kaposi sarcoma, renal cell carcinoma, laryngeal and hypopharyngeal cancer, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myelomonocytic leukemia, liver cancer, non- small cell lung cancer, small cell lung cancer, lung carcinoid tumor, lymphoma of the skin, malignant mesothelioma, multiple myeloma, myelodysplastic syndrome, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary tumors, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma in adult soft tissue, basal and squamous cell skin cancer, melanoma, small intestine cancer, stomach cancer, testicular cancer, throat cancer, thymus cancer, thyroid cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macroglobulinemia, Wilms tumor, secondary cancers caused by cancer treatment, and combinations thereof. In some aspects, the cancer is associated with a solid tumor. [0677] In some aspects, an immune cell described herein (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) is used in combination with other therapeutic agents (e.g., anti-cancer agents and/or immunomodulating agents). Accordingly, in some aspects, a method of treating a disease or disorder (e.g., tumor) disclosed herein comprises administering an immune cell described herein (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) in combination with one or more additional therapeutic agents. Such agents can include, for example, chemotherapeutic drug, targeted anti-cancer therapy, oncolytic drug, cytotoxic agent, immune-based therapy, cytokine, surgery, radiotherapy, activator of a costimulatory molecule, immune checkpoint inhibitor, a vaccine, a cellular immunotherapy, or any combination thereof. [0678] In some aspects, an immune cell described herein (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) is administered to the subject prior to or after the administration of the additional therapeutic agent. In some aspects, an immune cell described herein (modified to express a ligand-binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) is administered to the subject concurrently with the additional therapeutic agent. In some aspects, an immune cell described herein (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) and the additional therapeutic agent can be administered concurrently as a single composition in a pharmaceutically acceptable carrier. In some aspects, an immune cell described herein and the additional therapeutic agent are administered concurrently as separate compositions. [0679] In some aspects, an immune cell described herein (e.g., modified to express a ligand-binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) is used in combination with a standard of care treatment (e.g., surgery, radiation, and chemotherapy). Methods described herein can also be used as a maintenance therapy, e.g., a therapy that is intended to prevent the occurrence or recurrence of tumors. [0680] In some aspects, an immune cell provided herein (e.g., modified to express a ligand- binding protein and have a reduced level of a NR4A family member, and cultured using the methods provided herein) is used in combination with one or more anti-cancer agents, such that multiple elements of the immune pathway can be targeted. Non-limiting examples of such combinations include: a therapy that enhances tumor antigen presentation (e.g., dendritic cell vaccine, GM-CSF secreting cellular vaccines, CpG oligonucleotides, imiquimod); a therapy that inhibits negative immune regulation e.g., by inhibiting CTLA- 4 and/or PD1/PD-L1/PD-L2 pathway and/or depleting or blocking Tregs or other immune suppressing cells (e.g., myeloid-derived suppressor cells); a therapy that stimulates positive immune regulation, e.g., with agonists that stimulate the CD-137, OX-40, and/or CD40 or GITR pathway and/or stimulate T cell effector function; a therapy that increases systemically the frequency of anti-tumor T cells; a therapy that depletes or inhibits Tregs, such as Tregs in the tumor, e.g., using an antagonist of CD25 (e.g., daclizumab) or by ex vivo anti-CD25 bead depletion; a therapy that impacts the function of suppressor myeloid cells in the tumor; a therapy that enhances immunogenicity of tumor cells (e.g., anthracyclines); adoptive T cell or NK cell transfer including genetically engineered cells, e.g., cells engineered to express a chimeric antigen receptor (CAR-T therapy); a therapy that inhibits a metabolic enzyme such as indoleamine dioxigenase (IDO), dioxigenase, arginase, or nitric oxide synthetase; a therapy that reverses/prevents T cell anergy or exhaustion; a therapy that triggers an innate immune activation and/or inflammation at a tumor site; administration of immune stimulatory cytokines; blocking of immuno repressive cytokines; or any combination thereof. [0681] In some aspects, an anti-cancer agent comprises an immune checkpoint inhibitor (i.e., blocks signaling through the particular immune checkpoint pathway). Non-limiting examples of immune checkpoint inhibitors that can be used in the present methods comprise a CTLA-4 antagonist (e.g., anti-CTLA-4 antibody), PD-1 antagonist (e.g., anti- PD-1 antibody, anti-PD-L1 antibody), TIM-3 antagonist (e.g., anti-TIM-3 antibody), or combinations thereof. Non-limiting examples of such immune checkpoint inhibitors include the following: anti-PD1 antibody (e.g., nivolumab (OPDIVO ^® ), pembrolizumab (KEYTRUDA ^® ; MK-3475), pidilizumab (CT-011), PDR001, MEDI0680 (AMP-514), TSR-042, REGN2810, JS001, AMP-224 (GSK-2661380), PF-06801591, BGB-A317, BI 754091, SHR-1210, and combinations thereof); anti-PD-L1 antibody (e.g., atezolizumab (TECENTRIQ ^® ; RG7446; MPDL3280A; RO5541267), durvalumab (MEDI4736, IMFINZI ^® ), BMS-936559, avelumab (BAVENCIO ^® ), LY3300054, CX-072 (Proclaim- CX-072), FAZ053, KN035, MDX-1105, and combinations thereof); and anti-CTLA-4 antibody (e.g., ipilimumab (YERVOY ^® ), tremelimumab (ticilimumab; CP-675,206), AGEN-1884, ATOR-1015, and combinations thereof). [0682] In some aspects, an anti-cancer agent comprises an immune checkpoint activator (i.e., promotes signaling through the particular immune checkpoint pathway). In some aspects, immune checkpoint activator comprises OX40 agonist (e.g., anti-OX40 antibody), LAG-3 agonist (e.g. anti-LAG-3 antibody), 4-1BB (CD137) agonist (e.g., anti-CD137 antibody), GITR agonist (e.g., anti-GITR antibody), TIM3 agonist (e.g., anti-TIM3 antibody), or combinations thereof. [0683] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press); Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); D. N. Glover ed., (1985) DNA Cloning, Volumes I and II; Gait, ed. (1984) Oligonucleotide Synthesis; Mullis et al. U.S. Pat. No.4,683,195; Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation; Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.); Immobilized Cells And Enzymes (IRL Press) (1986); Perbal (1984) A Practical Guide To Molecular Cloning; the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Miller and Calos eds. (1987) Gene Transfer Vectors For Mammalian Cells, (Cold Spring Harbor Laboratory); Wu et al., eds., Methods In Enzymology, Vols.154 and 155; Mayer and Walker, eds. (1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London); Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); ); Crooks, Antisense drug Technology: Principles, strategies and applications, 2 ^nd Ed. CRC Press (2007) and in Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.). [0684] All of the references cited above, as well as all references cited herein and the amino acid or nucleotide sequences (e.g., GenBank numbers and/or Uniprot numbers), are incorporated herein by reference in their entireties. [0685] The following examples are offered by way of illustration and not by way of limitation. EXAMPLES Example 1: Methods of Culturing and Modifying [0686] To assess the therapeutic potential of the methods provided herein, T cells (e.g., isolated from a healthy donor) were modified and cultured as shown in FIG.1. [0687] Specifically, in the "control process," T cells were first activated by contacting the cells with a control substrate platform (e.g., TRANSACT ^™ ) in a medium, e.g., metabolic reprogramming medium (MRM), comprising potassium ion at a concentration higher than 5 mM. Then, about 24 hours later, the activated T cells were transduced with an anti-ROR1 CAR construct. In some aspects, T cells were transduced with an anti-ROR1 CAR construct comprising the following components: (i) anti-ROR1 CAR (derived from the R12 antibody) (referred to herein as "R12 CAR") (SEQ ID NO: 83), (ii) truncated EGFR ("EGFRt") (SEQ ID NO: 24), and (iii) wild-type c-Jun protein (SEQ ID NO: 13) (referred to herein as the "c-Jun-R12 CAR"; SEQ ID NO: 86). In some aspects, T cells were transduced with an anti-ROR1 CAR construct that comprised a truncated CD19 ("CD19t") instead of c-Jun (referred to herein as the "CD19t-R12 CAR"). After the transduction (about 24 hours later), the T cells were then electroporated with a NR4A-targeting gene editing tool (e.g., NR4A3-targeting guide RNA described herein), such that the gene editing tool was introduced into the immune cells and thereby, reduce the expression of the NR4A family member in the immune cells. Next, the now modified immune cells were further cultured (e.g., in MRM) and subsequently analyzed. [0688] With the exemplary processes provided herein ("PCS process A" and "PCS process B"), two or more of the activating, transducing, and editing occurred concurrently (e.g., within a single day). For instance, with PCS process A, T cells were electroporated with a NR4A-targeting gene editing tool (e.g., NR4A3-targeting guide RNA described herein), activated with a programmable cell-signaling scaffold (“PCS”; described in more detail above) in MRM, and transduced with an anti-ROR1 CAR construct (e.g., c-Jun-R12 CAR). Exemplary PCS for illustrative processes described herein can contain a base layer of mesoporous silica microrods (MSR), a fluid-supported lipid bilayer (SLB) layered on the MSR base layer, with surface cues (e.g., functional molecule such as anti-CD3 and/or anti- CD28 antibodies) loaded on the PCS and/or MSR. The PCS can be optionally combined with soluble cytokines such as IL-2, IL-7, and IL-15. As described herein, in some instances, the MRM used in activating the immune cells with PCS comprised IL-2, IL-7, and IL-15. In some instances, the MRM used in activating the immune cells with PCS did not comprise IL-2, IL-7, and IL-15. In some experiments, after the electroporation, the T cells were allowed to rest (between about 0-3 hours) before activating. Then, after the modifying (i.e., editing), activating, and transducing, the T cells were further cultured (e.g., in MRM) and then subsequently analyzed. With PCS process B, T cells were activated with PCS in MRM (with or without IL-2, IL-7, and IL-15) and then transduced with an anti- ROR1 CAR construct (e.g., c-Jun-R12 CAR) on the same day. However, the T cells were not modified to exhibit reduced expression of NR4A3 (e.g., by electroporating the cells with a NR4A3-targeting gRNA) until about two days after the activating and transducing. After the editing, the modified T cells were further cultured (e.g., in MRM) and then subsequently analyzed. Example 2: Effect on NR4A Editing [0689] As described herein, immune cells provided herein (e.g., T cells and/or NK cells) are modified such that the cells exhibit reduced expression of a NR4A family member (e.g., NR4A1, NR4A2, and/or NR4A3) as compared to corresponding non-modified cells. Therefore, to assess what effect the methods provided herein have on NR4A-editing, T cells were again cultured and modified using one of the methods described in Example 1. Then, the resulting population of cells were analyzed for NR4A3-editing. [0690] As shown in FIG.2A, with PCS process A, there was consistently higher percentage of T cells expressing reduced level of NR4A3 ("NR4A3 KO") as compared to with the control process. For instance, with T cells isolated from two different donors, the percentage of NR4A3 KO T cells present in the resulting population of cells was about 70% using the control process. In contrast, with process A, the percentage of T cells with reduced expression of NR4A3 in the resulting population of cells was about 80%. And, as shown in Table 16 (below), with process A, there was generally improved on-target editing of the NR4A3 gene as compared to the control process. With PCS process B, the percentage of NR4A3-edited T cells were comparable to those T cells cultured using the control process (FIG. 2B). Similar results were generally observed when the activating step (i.e., contacting immune cells with PCS) occurred in MRM with and without cytokines (IL-2, IL-7, and IL-15). Table 16. NR4A3 gene on-target editing profile Example 3: Effect on T Cell Phenotype and Function [0691] Next, to assess any effect that the methods provided herein have on T cell function, T cells (isolated from three different donors) were cultured and modified using the methods described in Example 1. As further comparison, some of the T cells were activated with either a control substrate platform (e.g., TRANSACT ^™ ) in MRM or PCS in MRM, but not modified to exhibit reduced expression of a NR4A family member (e.g., not electroporated with a NR4A3-targeting guide RNA). Where the T cells were activated with PCS, PCS was used at one of three different concentrations: 1X (200 µg PCS per 1 x 10 ⁶ cells), 0.8X (160 µg PCS per 1 x 10 ⁶ cells), and 0.6X (120 µg PCS per 1 x 10 ⁶ cells). Where the T cells were edited to exhibit reduced expression of NR4A3, the NR4A3-targeting gRNA was used either at 0.6 µM or at 2 µM concentration. Then, the resulting modified T cells were analyzed functionally e.g., IFN- ^^, IL-2, and TNF-α production and in vitro killing after primary and/or repeat antigen stimulation) as described below. All of the T cells were modified to express an anti-ROR1 CAR. Some of the T cells were also modified to exhibit increased expression of a c-Jun protein. Cytotoxicity and Cytokine Secretion [0692] The cytolytic activity of the resulting modified T cells (i.e., expressing anti-ROR1 CAR and with or without reduced expression of NR4A3 and with or without c-Jun overexpression) was measured using an in vitro sequential killing assay. Briefly, the resulting modified T cells from the different groups were cultured with NucLightRed (NLR) A549 or H1975 tumor cells (“target”) at a 1:1 E:T ratio in triplicates in flat 96 well assay plates (Eppendorf). After 3 or 4 days of co-culture, wells were resuspended, and 25% of the culture was transferred onto new plates with the same initial number of fresh tumor cells per well. This was repeated until there was no further T cell killing observed (e.g., for a total of 7-9 stimulations). Cytotoxicity was measured continuously in the Incucyte at 4x magnification every 3 hours during the assay. Lysis of NLR target cells was quantified by measuring total NLR intensity. NLR intensity was normalized relative to the starting intensity after replating for each round of stimulation. Supernatants were collected from plates for supernatant collection and frozen at -80ºC 24 hours after setting up each new stimulation. The culture plates containing the cells remained in the IncuCyte for continued periodic scanning, such that the plates were not touched during data collection. [0693] For cytokine secretion analysis, the previously frozen supernatant was thawed and cytokine levels were measured using Meso Scale Discovery V-Plex proinflammatory panel 1 human kits or custom human IFN- ^^, IL-2, and TNF-α cytokine kits following the manufacturer’s instructions. Cells were also analyzed for the expression of certain memory markers (CD45RA and CCDR7) and activation markers (PD1 and CD25) using flow cytometry. Cytotoxicity and Cytokine Secretion [0694] In the sequential stimulation assay, the resulting modified T cells from the different groups (i.e., expressing anti-ROR1 CAR and with or without reduced expression of NR4A3 and with or without c-Jun overexpression) were subjected to stimulation with the H1975 NSCLC ROR1-expressing tumor cell line. Briefly, the T cells were cultured at a 1:1 E:T ratio with H1975-NLR tumor cells in RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) + 1% penicillin/streptomycin in triplicates in flat 24 well assay plates (Eppendorf). After 3 or 4 days of co-culture, wells were resuspended, and 25% of the culture was transferred onto new plates with the same initial number of fresh tumor cells per well. This was repeated until no further T cell killing was observed (e.g., for a total of 7-9 stimulations). Cytotoxicity was measured continuously in the Incucyte during the assay and supernatants were collected 24 hours after setting up each new stimulation to measure cytokine levels. Separate plates were set up for supernatant collecting and for IncuCyte. Remaining cells from the triplicate co-culture wells were combined for phenotypic flow analyses as described above. Results [0695] As shown in FIGs. 3A and 3B, no clear difference in memory markers were observed among CD8 ⁺ T cells from the different groups. For CD4 ⁺ T cells, those cells that were activated with PCS (see "PCS no EP" and "PCS D0 EP" groups) were memory-like as compared to the control cells that were not activated with PCS. As between "PCS no EP" and "PCS D0 EP" (i.e., process A), no clear differences were observed. As shown in FIGs.4A and 4B, as to activation markers, clear differences were observed between those cells that were activated with PCS and those that were not activated with PCS during the modifying. As between the two PCS activated groups, again, no clear differences were observed. [0696] As shown in FIGs.5A and 5B, T cells cultured and modified using PCS process A (in which T cells are activated with PCS in MRM, transduced with an anti-ROR1 construct, and edited to exhibit reduced expression of a NR4A family member all on the same day) remained more cytotoxic against both H1975 and A549 tumor cells, as compared to those T cells cultured and modified using the control process. The sustained cytotoxic activity was observed in both T cells that were transduced with the CD19t-R12 CAR construct (i.e., not overexpressing c-Jun) and T cells that were transduced with the c-Jun-R12 CAR construct (i.e., overexpression c-Jun) (FIG.6). Similarly, the T cells cultured and modified using process A also produced higher levels of IFN-γ, TNF-α, and IL-2, as compared to those T cells from the control process group (see FIGs.8A-8C). As between PCS process B and the control process, similar improved activity (e.g., increased cytotoxicity and improved cytokine production in response to repeated antigen stimulation) was observed (see FIGs. 7A, 7B, and 9A-9C). As between PCS process A and PCS process B, more enhanced activity was observed with PCS process A. In agreement with the functional data, And, as shown in FIGs.3A, 3B, 4A, and 4B, the above-described effects were not related to electroporation itself. Again, as observed in Example 2, similar results were observed when the activating step (i.e., contacting immune cells with PCS) occurred in MRM with and without cytokines (IL-2, IL-7, and IL-15). [0697] Collectively, the above results demonstrate that the methods provided herein (e.g., PCS process A and PCS process B) are particularly useful in producing T cells that are stem-like (e.g., expressed higher memory markers) and exhibiting improved properties (see FIG.10 for a summary of the improved properties). Example 4: Activation with Cytokine-Free PCS [0698] As described in the present disclosure, the culturing and modifying methods provided herein comprise an activation step during which the T cells being modified are activated with PCS. To further assess the role of cytokines during this activation step, T cells (e.g., isolated from a healthy donor) were modified and cultured as shown in FIG.11. Briefly, T cells were electroporated with a NR4A-targeting gene editing tool (e.g., NR4A3- targeting guide RNA described herein) and then cultured overnight in MRM (see day -1). Then, the following day, the NR4A-edited T cells were activated with PCS that lacked IL- 2, IL-7, and IL-17 cytokines ("cytokine-free PCS") and subsequently transduced with an anti-ROR1 CAR construct (e.g., c-Jun-R12 CAR) (see day 0). Afterwards, the T cells were cultured in MRM and allowed to expand until day 7, when the T cells were harvested and analyzed. [0699] As shown in FIGs.12A-12F, activating the NR4A-edited T cells with cytokine-free PCS did not appear to have any noticeable effects as to the different production parameters assessed. At day 7 post-initial modification, the total T cell yield, CD8% percentage, and the transduction efficiency were comparable for all cytokine-free PCS lots used and also as compared to those T cells that were modified with the control process (which involved activating with TRANSACT). The overall phenotypic profile (e.g., memory, stemness, and activation state) were comparable among T cells activated with different lots of the cytokine-free PCS during the modifying methods provided herein. In agreement with the data provided above in Example 3 (where PCS activation occurred in the presence of IL-2, IL-7 and IL-15), the NR4A3-edited anti-ROR1 CAR T cells that were activated with cytokine-free PCS during the modifying steps showed improved memory, stemness, and activation state, as compared to the control T cells that were activated with TRANSACT. Similar results were observed functionally (e.g., showed improved anti-tumor activity in vitro). See FIGs.13A, 13B, and 14. [0700] The above results demonstrate that cytokine-free PCS is useful in the culturing and modifying methods provided herein. Example 5: Antitumor Efficacy [0701] An in vivo H1975 xenograft tumor model was used to the antitumor activity of T cells edited with two different NR4A3-specific guide RNAs (i.e., g4 and g47) and transduced to comprise an anti-ROR1 CAR and overexpress c-Jun. The T cells were modified and cultured as shown in FIG.11 and described in Example 4. [0702] Briefly, H1975 tumor cells were cultured in RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) for three passages before implantation into 17-week-old NSG HLA double- knockout mice (Jackson Labs). Cells were trypsinized with TrypLE Express enzyme, resuspended in HBSS (Gibco), and mixed with Matrigel (Corning) at a 1:1 ratio. Five million H1975 tumor cells were implanted into the flank of each mouse. The NR4A3-edited T cells were adoptively transferred into randomized tumor-bearing mice when tumors reached 80-120 mm ³ in size. The NR4A3-edited T cells were administered to the animals at a low dose (0.4 x 10 ⁶ cells/mouse) or a high dose (2 x 10 ⁶ cells/mouse). CD19-edited anti-ROR1 CAR T cells (also activated with cytokine-free PCS during the modification steps) were used as control. Tumor volumes and body weight were measured twice weekly until the endpoint when tumors reached > 2000 mm ³ , > 20% body weight loss, ulceration, labored breathing, severely restricted mobility or inability to upright, or up to 90 days after T cell transfer. [0703] At the low and high CAR T cell doses, all ROR1 CAR T cells tested had potent activity and significantly improved antitumor efficacy compared to mock untransduced T cells. At later time points, NR4A3-edited + c-Jun ROR1 CAR T cells at low dose were able to maintain better long-term tumor control compared to control-edited + c-Jun ROR1 CAR T cells (NR4A3 KO g47 was statistically significant while NR4A3 KO g4 was trending) (FIG. 15A). In addition, mice adoptively transferred with NR4A3 g4-edited or NR4A3- edited g47 + c-Jun ROR1 CAR T cells had significantly higher peripheral blood CD3 ⁺ CAR ⁺ T-cell numbers compared to control-edited + c-Jun ROR1 CAR T cells on day 14 and day 21 post T cell injection. There were no significant differences in CD3 ⁺ CAR ⁺ T cell numbers between NR4A3 g4-edited and g47-edited ROR1 CAR T cells with c-Jun overexpression at either time point (FIG.15B, Tables 17-18). Importantly, the number of NR4A3-edited + c-Jun ROR1 CAR T cells contracted thereafter demonstrating no uncontrolled in vivo expansion. In this H1975 xenograft model, combining NR4A3 KO and c-Jun overexpression in ROR1 CAR T cells reprogrammed with metabolic reprogramming media and Stim-R technologies provided sustained and robust anti-tumor activity in vivo. Table 17. Tukey one-way ANOVA statistical analysis of H1975 xenograft tumor volumes corresponding to FIG.1A. ns – not significant, **** p < 0.0001. Table 18. Unpaired t-test statistical analysis of H1975 xenograft peripheral blood day 14 and day 21 CD3 ⁺ CAR ⁺ T cell numbers corresponding to FIG.1B. * p < 0.05, ** p < 0.005. Example 6: Generation of Modified T cells [0704] To assess whether reduced NR4A3 gene and/or NR4A3 protein expression, c-Jun overexpression, and programmable cell-signaling scaffold (PCS) formulation in MRM are redundant or additive in their effects on reducing exhaustion and dysfunction, ROR1-R12 chimeric antigen receptor (CAR) T cell model was used. A CRISPR-Cas9 guide RNA (gRNA) was identified that specifically reduced protein expression of NR4A3 in human T cells transduced with a ROR1 CAR overexpressing a c-Jun protein. [0705] Specifically, healthy donor CD4 ⁺ and CD8 ⁺ T cells were isolated from leukapheresis (BioIVT) by magnetic separation using Miltenyi’s CliniMACS Prodigy device. CD4 ⁺ and CD8 ⁺ magnetic beads were pre-mixed and used to perform a positive T cell selection. The isolated T cells were cryopreserved for research-scale CAR T cell productions or were used fresh (no cryopreservation) for clinical-scale CAR T cell productions. Cryopreserved isolated T cells from non-small cell lung cancer (NSCLC) patient donors were purchased from Sanguine Biosciences and CAR T cells were generated at research-scale. [0706] For research-scale CAR T cell productions, healthy and NSCLC patient donor T cells were thawed, electroporated with SpyFi ^TM Cas9 (Aldevron) ribonucleoproteins (RNPs) targeting human NR4A3 or control CD19 utilizing modified guide RNAs (Agilent or GenScript; Tables 19 and 20) using the Lonza 4D Nucleofector unit and rested overnight in metabolic reprogramming media (MRM). Non-edited T cells were activated in MRM supplemented with 1% (v/v) TransAct (Miltenyi) for 24 hours. The next day, edited and non-edited T cells were transduced with a tri-cistronic lentiviral vector encoding an anti- ROR1 CAR (containing the R12 scFv, Lyell-developed spacer, CD28tm, and 41BB and CD3Z intracellular signaling domains), a truncated EGFRt transduction marker, and the transcription factor c-Jun. Edited T cells were activated with 160 ug of PCS formulation (as described in Example 1) per 1 x 10 ⁶ viable T cells or 1% (v/v) TransAct in MRM. T cells were transferred into G-Rex culture plates for expansion before cryopreservation in CryoStor media on day 7 for non-edited T cells and day 8 for edited T cells. [0707] For clinical-scale CAR T cell productions, isolated T cells were used fresh from leukapheresis. T cells were electroporated with SpyFi ^TM Cas9 (Aldevron) RNP targeting human NR4A3 utilizing a modified guide RNA (Agilent; Table 19) using the MaxCyte ExPERT GTx electroporator and rested overnight in MRM. Non-edited T cells were activated in MRM supplemented with 1% (v/v) TransAct for 24 hours. The next day, edited and non-edited T cells were transduced with a tri-cistronic lentiviral vector as described above. Edited T cells were activated with PCS formulation as described above. T cells were transferred to a bioreactor for expansion until cryopreservation in CryoStor media on day 7. [0708] CAR T cells generated with PCS at research- and clinical-scales displayed a trend for elevated levels of TCF-7 expression compared to CAR T cells generated with TransAct (FIGs. 16A and 16B). Similar TCF-7 expression levels were observed between NR4A3- edited and control CD19-edited CAR T cells generated with PCS or TransAct (FIG.16A), suggesting that elevated TCF-7 expression was mediated by PCS formulation and not by gene editing. Table 19. sgRNA guide for NR4A3 knockdown NR4A3 sgRNA 47 (SEQ ID NO: 109) AGUGUUGGAAUGGUAAAAGA Table 20. sgRNA guide for CD19 knockdown CD19 (SEQ ID NO: 110) CUAGGUCCGAAACAUUCCAC Example 7: Genomic Editing and Reduced NR4A3 Expression [0709] NR4A3 genomic editing efficiency was assessed in NR4A3-edited ROR1 CAR T cells with c-Jun overexpression generated from healthy donors in MRM with or without PCS formulation by next-generation sequencing (NGS). Cell pellets were collected on day of harvest and stored at -80ºC until shipment to GeneGoCell (San Diego, CA, USA). Genomic DNA was isolated at GeneGoCell and assessment of NR4A3 on-target editing efficiency was done using GeneGoCell’s proprietary GAmp service platform providing polymerase chain reaction-based target enrichment for NGS and accurate sequence variant detection with allele frequency threshold = 0.01% - 0.001% for variant detection. NR4A3 genomic editing efficiency was similar in research-scale NR4A3-edited CAR T cells generated with or without PCS formulation, suggesting that NR4A3 editing was not affected by PCS activation (FIG.17A). NR4A3 editing efficiency in clinical-scale NR4A3- edited CAR T cells was similar to research-scale NR4A3-edited CAR T cells (FIG.17B). Collectively, high NR4A3 on-target editing was observed in NR4A3-edited products generated at research and clinical scales and was not impacted by PCS activation. [0710] Reduction of NR4A3 protein was validated in NR4A3-edited, control CD19-edited, or non-edited ROR1 CAR T cells with c-Jun overexpression generated from healthy donors in MRM with or without PCS by flow cytometry. 3 x 10 ⁵ T cells were stimulated with PMA+ionomycin (BioLegend) for two hours in 200 µL of RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) + 1% penicillin/streptomycin in 96 well round bottom plates (Corning) at 37ºC to induce maximum NR4A3 expression. After stimulation, cells were stained with a live dead dye and surface marker antibodies for 25 minutes at RT. All staining was performed in BioLegend cell staining buffer. The cells were then fixed and permeabilized with the FoxP3 Transcription Factor staining buffer kit (eBiosciences) following manufacturer’s instructions. The cells were blocked with 10% normal mouse serum for 10 minutes at room temperature and then stained with a custom fluorochrome conjugated NR4A3 antibody (R&D Systems). NR4A3 protein expression was significantly reduced in research- and clinical-scale NR4A3-edited ROR1 CD3 ⁺ CAR T cells compared to CD19-edited and non-edited controls irrespective of PCS formulation (FIGs. 18A and 18B). Example 8: Sustained Cytotoxicity and Cytokine Production in Sequential Stimulation [0711] The function of research- and clinical-scale NR4A3-edited ROR1 CAR T cells with c-Jun overexpression generated from healthy donors in MRM with or without PCS were evaluated in an in vitro exhaustion assay in which CAR T cells are sequentially exposed to antigen. Before setting up the assays, ROR1 ⁺ tumor cell lines A549-NucLight Red (NLR), H1975-NLR, BxPC3-NLR, H2452-NLR, MDA-MB-231-NLR, SW620-NLR, and SK- OV-3-NLR were cultured in RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) + 1% penicillin/streptomycin for 2-3 passages. Cells were trypsinized with TrypLE Express enzyme (Gibco). [0712] In the sequential stimulation assay, NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression generated from healthy donors were subjected to 3-7 successive stimulations with ROR1-expressing tumor cell lines. In particular, cryopreserved ROR1 CAR T cells were thawed and immediately cultured at a 1:10 E:T ratio of cParp-CD3 ⁺ EGFR ⁺ R12 ⁺ CAR T cells with A549-NLR, H1975-NLR, BxPC3-NLR, or H2452-NLR tumor cells or at a 1:1 E:T ratio of cParp- CD3 ⁺ EGFR ⁺ R12 ⁺ CAR T cells with MDA-MB-231-NLR, SW620-NLR, and SK-OV-3- NLR tumor cells in RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) + 1% penicillin/streptomycin in triplicates in flat 96 well assay plates (Corning). NR4A3-edited and control non-edited ROR1 CAR T cells with c-Jun overexpression generated from NSCLC patient donors were subjected to 8 successive rounds of stimulation with H1975- NLR tumor cells at a 1:25 E:T ratio. After 3-4 days of co-culture, wells were resuspended, and 25% of the culture was transferred onto new plates with the same initial number of fresh tumor cells per well. This was repeated for the duration of the assay. Cytotoxicity was measured continuously in the Incucyte during the assay and supernatants were collected 24 hours after setting up each new stimulation to measure cytokine levels. [0713] For phenotypic flow analyses after sequential stimulation, NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression were subjected to successive stimulations with H1975-NLR tumor cells at a 1:1 E:T ratio in RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) + 1% penicillin/streptomycin in triplicates in flat 24 well assay plates (Corning). The sequential stimulation assay was performed as described above. Remaining cells from the triplicate co-culture wells were combined for phenotypic flow analyses. CAR T cells were surface stained, fixed, and permeabilized as above. The cells were blocked with 10% normal mouse and rabbit serum for 10 minutes at room temperature and then stained with antibodies to detect cParp, c-Jun, and TCF-7. [0714] NR4A3-edited CAR T cells generated at research-scale in MRM with PCS from healthy donors (black-filled circles) remained the most cytotoxic against BxPC3, H2452, MDA-MB-231, and SW620 tumor cells, demonstrating a sustained ability to lyse target cells after multiple rounds of stimulation compared to other CAR T cell conditions in 3 different donors (FIGs. 19C, 19D, 19E, and 19F, top row). NR4A3-edited CAR T cells generated with PCS (black-filled circles) were more cytotoxic against A549 and H975 tumor cells compared to other CAR T cell conditions in 2 out of 3 donors (FIGs.19A and 19B, top row). In the third donor (RG3222), NR4A3-edited CAR T cells generated with PCS (black-filled circles) were slightly more cytotoxic against A549 or H1975 tumor cells compared to control CD19-edited CAR T cells generated with PCS (X symbol) or NR4A3- edited CAR T cells generated with TransAct (black-open circles). Combining NR4A3 KO, c-Jun overexpression, and PCS further enhanced ROR1 CAR T cell cytotoxicity when co- cultured against these tumor cell lines. [0715] Cytotoxicity against SK-OV-3 tumor cells was similar between research-scale NR4A3-edited CAR T cells generated with PCS (black-filled circles) and control CD19- edited CAR T cells generated with PCS (X symbol) or NR4A3-edited CAR T cells generated with TransAct (black-open circles) in all 3 research-scale donors (FIG.19G, top row). Combining NR4A3 KO, c-Jun overexpression, and PCS did not further enhance ROR1 CAR T cell cytotoxicity against SK-OV-3 tumor cells; however, the combination was still more cytotoxic to non-edited and control CD19-edited CAR T cells with c-Jun overexpression generated in MRM. [0716] The functional potency of NR4A3-edited CAR T cells generated in MRM with PCS at clinical-scale was also evaluated in the sequential stimulation assay. NR4A3-edited CAR T cells generated at clinical-scale with PCS from healthy donors (black-filled circles) demonstrated potent cytotoxicity against all tumor cell lines tested compared to non-edited CAR T cells generated with TransAct (grey star) (FIGs.19A-19G, bottom rows). [0717] Furthermore, NR4A3-edited ROR1 CAR T cells with c-Jun overexpression produced in MRM with PCS from NSCLC patient donor T cells also demonstrated potent in vitro cytotoxicity against H1975 tumor cells in the sequential stimulation assay at a 1:25 E:T ratio (FIG. 20). Collectively, ROR1 CAR T cells with NR4A3 KO, c-Jun overexpression, and PCS generated at research- and clinical-scales from healthy and NSCLC patient donors demonstrated potent and sustained in vitro cytotoxicity against ROR1-expressing tumor cell lines after multiple rounds of antigen stimulation. [0718] In addition to sustained cytotoxicity, NR4A3-edited c-Jun overexpressing ROR1 CAR T cells generated in MRM and PCS produced high levels of IFN- ^^ and IL-2 compared to other CAR T cells tested (FIGs. 21A-21G and Tables 21-34) when stimulated with ROR1-expressing tumor cells. Cytokine levels were measured using Meso Scale Discovery V-Plex proinflammatory panel 1 human kits or custom human IFN- ^^ and IL-2 cytokine kits following the manufacturer’s instructions. [0719] NR4A3 knockout, c-Jun overexpression, and PCS appears to contribute to sustained functional activity and/or improved CAR T cell survival following prolonged antigen stimulation. Increased persistence of c-Jun overexpressing NR4A3 KO ROR1 CAR T cell numbers generated with PCS was observed after the fourth round of stimulation against H1975 tumor cells (FIG.22). NR4A3 KO CAR T cells generated with PCS demonstrated an altered cell surface phenotype consistent with reduced exhaustion after the fourth round of stimulation with H1975 tumor cells (FIGs.23A and 23B). The combination of NR4A3 KO, c-Jun overexpression, and PCS led to significantly lower expression of TIM-3 on CD3 ⁺ ROR1 CAR T cells in all research- and clinical-scale healthy donors compared to non-edited ROR1 CAR T cells with c-Jun overexpression. Although CD127 expression was similar at baseline (day 0 of sequential stimulation, data not shown) between CD3 ⁺ CAR T cells produced in PCS and TransAct, CD127 expression trended higher on PCS- generated CAR T cells after antigen stimulation irrespective of NR4A3-editing. CD127 has been shown to be a marker for antigen-specific memory CD8 ⁺ T cells in various viral infections (Huster et al., PNAS, 101, 5610-5615 (2004); Boettler et al., J. Virol.80, 3532- 3540 (2006); Xu et al., Lab. Med. 48, 57-64 (2017)), suggesting PCS-generated CAR T cells maintain a more memory-like T cell state compared to CAR T cells generated using TransAct. [0720] The in vitro sequential stimulation model of T cell exhaustion revealed that NR4A3- edited c-Jun overexpressing ROR1 CAR T cells generated in PCS exhibited enhanced and sustained cytotoxicity and cytokine production against ROR1-expressing tumor cells in both research and clinical scales as well as using healthy and NSCLC patient donors. The increased functional activity at later rounds of stimulation can be due to the maintenance of memory-like T cells and reduced T cell exhaustion throughout the assay. Therefore, the combination of editing NR4A3, c-Jun overexpression, and PCS in MRM during ROR1- R12 CAR T cell production can improve cellular immunotherapy against ROR1-expressing solid tumors. Table 21. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interferon-gamma (IFN- ^^) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the A549 sequential stimulation assay corresponding to FIG. 19A. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001.

Table 22. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interferon-gamma (IFN- ^^) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the H1975 sequential stimulation assay corresponding to FIG. 19B. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001.

Table 23. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interferon-gamma (IFN- ^^) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the BxPC3 sequential stimulation assay corresponding to FIG. 19C. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001.

Table 24. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interferon-gamma (IFN- ^^) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the H2452 sequential stimulation assay corresponding to FIG. 19D. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Non-edited + c-Jun + MRM Table 25. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interferon-gamma (IFN- ^^) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the MDA-MB-231 sequential stimulation assay corresponding to FIG.19E. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 26. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interferon-gamma (IFN- ^^) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the SW620 sequential stimulation assay corresponding to FIG. 19F. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 27. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interferon-gamma (IFN- ^^) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c-Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the SK-OV-3 sequential stimulation assay corresponding to FIG. 19G. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 28. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interleukin-2 (IL-2) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c- Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the A549 sequential stimulation assay corresponding to FIG.19A. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 29. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interleukin-2 (IL-2) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c- Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the H1975 sequential stimulation assay corresponding to FIG.19B. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001.

Table 30. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interleukin-2 (IL-2) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c- Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the BxPC3 sequential stimulation assay corresponding to FIG.19C. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001.

Table 31. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interleukin-2 (IL-2) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c- Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS formulation during the H2452 sequential stimulation assay corresponding to FIG.19D. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 32. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interleukin-2 (IL-2) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c- Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the MDA-MB-231 sequential stimulation assay corresponding to FIG.19E. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 33. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interleukin-2 (IL-2) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c- Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the SW620 sequential stimulation assay corresponding to FIG.19F. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 34. Tukey’s one-way ANOVA statistical analysis (research-scale donors) or unpaired t-test (clinical-scale donors) of secreted interleukin-2 (IL-2) produced from NR4A3-edited, control CD19-edited, and control non-edited ROR1 CAR T cells with c- Jun overexpression generated in metabolic reprogramming media (MRM) with or without PCS during the SK-OV-3 sequential stimulation assay corresponding to FIG. 19G. ns – not significant, *p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Example 9: Reduced Terminal Exhaustion Gene Signatures in Serial Stimulation [0721] To more directly understand the impact of NR4A3 KO in combination with PCS on cell-intrinsic functional capacity to counter exhaustion, the serial stimulation assay was developed to serially expose ROR1 CAR T cells to antigen. The transcriptome and chromatin accessibility landscape of NR4A3 KO + c-Jun + MRM + PCS and non-edited + c-Jun + MRM ROR1 CAR T cells from two donors were profiled simultaneously during the serial stimulation assay to better understand transcriptomic changes and the underlying regulatory mechanisms. [0722] Before setting up the serial stimulation assay, parental A549 tumor cells lines were expanded in RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) + 1% penicillin/streptomycin for 2 passages. Cells were trypsinized with TrypLE Express enzyme (Gibco). Cryopreserved NR4A3 KO + c-Jun + MRM + PCS and non-edited + c- Jun + MRM ROR1 CAR T cells were thawed and cultured at a 1:1 E:T ratio with A549 tumor cells in RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) + 1% penicillin/streptomycin. Surviving CAR T cells were recovered, quantified by flow cytometry for the number of recovered cParp-CD3 ⁺ EGFR ⁺ R12 ⁺ cells, and replated at 1:1 E:T ratio with fresh tumor cells every 3 days for a total of fifteen days. CAR T cells were stained with a live dead dye and surface marker antibodies for 25 minutes at RT. All staining was performed in Biolegend cell staining buffer. The cells were then fixed and permeabilized with the FoxP3 Transcription Factor staining buffer kit (eBiosciences) following manufacturer’s instructions. The cells were blocked with 10% normal mouse and rabbit serum for 10 minutes at room temperature and then stained with cParp and c-Jun. [0723] Single cell Multiome was performed on Live CD45 ⁺ R12 ⁺ EGFR ⁺ T cells sorted from NR4A3 KO + c-Jun + MRM + PCS ROR1 CAR T cells and non-edited + c-Jun + MRM ROR1 CAR T cells collected from 2 donors (Donor #4 and Donor #5) on day 15 of the serial stimulation assay. Samples were processed for Multiome ATAC + Gene Expression assay allowing simultaneous profiling of chromatin accessibility landscape and gene expression in the same single nuclei. For FACS sorting, cells were blocked with 10% Human TruStain FcX blocking reagent for 10 min at 4°C, followed by staining with a mix of fluorochrome-conjugated antibodies against CD45, CD8, CD4, EGFR, R12 and Live/Dead eFluor780 reagent for 30 min at 4°C. Up to 140,000 cells each of Live CD45 ⁺ CD8 ⁺ R12 ⁺ EGFR ⁺ T cells and 60,000 cells of Live CD45 ⁺ CD4 ⁺ R12 ⁺ EGFR ⁺ T cells were FACS sorted together into PBS containing 2% BSA using the BD FACSAria™ Fusion Cell Sorter (BD Biosciences). Nuclei were isolated from sorted cells and subjected to transposition, allowing Transposase to enter the nuclei and preferentially fragment the DNA in open chromatin regions and simultaneously adding adapter sequences to ends of the DNA fragment. Approximately 16,100 nuclei, containing 70% CD8 ⁺ R12 ⁺ EGFR ⁺ T cells nuclei and 30% CD4 ⁺ R12 ⁺ EGFR ⁺ T cells nuclei were loaded into each channel of the Chromium Next GEM Chip J using the Chromium Next GEM Single Cell Multiome Reagent Kit (10x Genomics). Nuclei samples were processed in parallel according to the Chromium Next GEM Single Cell Multiome ATAC + Gene Expression (CG000338) library construction protocol (10x Genomics). The barcoded transposed DNA (ATAC) and barcoded full-length cDNA from poly-adenylated mRNA (Gene Expression) libraries prepared were quantified, pooled, and sequenced together using the NovaSeq 6000 System (Illumina). [0724] Single cell Multiome data was processed using the 10X Cell Ranger ARC software version 2.0.2 (10X Genomics) with GRCh38 as reference genome and standard parameters. The feature-cell matrices were further processed using Seurat package (Hao et al. 2020) and Signac package (Stuart et al. 2021) in R. In brief, cells were first filtered using thresholds for quality control metrics for both RNA and ATAC data (percent mitochondria, nCount_RNA, nFeature_RNA, nCount_ATAC, percentage of ATAC reads in Cellranger peak regions and TSS regions). ATAC-Seq peak calling was then performed for each donor and condition separately using MACS2 with Signac’s “CallPeaks” function with the “— call-summit” parameter. Peak regions were defined by the 250bp flanking regions of identified peak summits, and overlapping peaks were removed by keeping peak summits with the highest significance to obtain a set of fixed-width peaks without overlaps. After that, CD8 ⁺ and CD4 ⁺ T cells were separated based on joint RNA and ATAC analysis (with cells from both donors combined). For RNA data, UMI count data matrix was transformed and highly variable features were selected using ‘LogNormalize’ pipeline. Mitochondria, ribosome, TCR, and IG complex related genes were excluded from the selected features, and the effects of cell cycle heterogeneity were corrected by (1) calculating cell cycle phase scores by CellCycleScoring function in Seurat and regressing these out of the data by ScaleData function, and (2) excluding genes correlated with either of the two cell cycle phase scores (with absolute Pearson correlation coefficient greater than 0.3) from selected features. Reduction of dimensionality was performed using “runPCA”. For ATAC data, peak regions from both donors and timepoints were combined and overlapping peaks were removed by keeping the most significant peaks to obtain a unified peak set. A peak-cell UMI count matrix was then constructed based on the peak set. Top variable features were selected and the UMI count matrix was transformed using latent semantic indexing (LSI). To combine the RNA and the ATAC data, a joint neighbor graph was constructed by identifying nearest neighbors based on a weighted combination of both modalities. The graph was then used for Uniform Manifold Approximation and Projection (UMAP) (RunUMAP function in Seurat) to map cells to two-dimensional space with each dot representing a single cell. Cells were subjected to clustering analysis using Seurat’s FindClusters function. Post the joint clustering analysis, CD8 ⁺ T cells were defined by the CD8A-hi CD4-low clusters. The day 15 CD8 ⁺ T cells were subject to the same joint RNA and ATAC analysis as described above for each donor separately. Finally, motif enrichment scores were computed and added to each donor respectively using Signac’s “AddMotifs” and “RunChromVAR” functions. Motifs were collected from the 8 ^th release (2020) of JASPAR, as well as chromVar’s curated collection of human motifs from cisBP database. [0725] Single cell transcriptome data was also aggregated for pseudobulk RNA-Seq analysis. Lowly expressed genes with non-zero UMI counts in less than 10 cells were first removed. For the remaining genes, UMI counts were summed up across single cells per donor and condition to create pseudobulk gene expression data. Differential analysis was performed using the DESeq2 (Love et al 2014) package and gene set enrichment analysis was performed using fgsea (Korotkevich et al. 2021) package in R with a priori-defined gene sets from MSigDB (version 7, Subramanian et al. 2005) and literature. Exhaustion- associated gene sets were curated from Oliveira et al.2021, Zhang et al.2018, Yost et al. 2019, Sade-Feldman et al.2018 and Tirosh et al.2016. [0726] In the UMAP generated after joint RNA and ATAC analysis, NR4A3 KO + c-Jun + MRM + PCS and non-edited + c-Jun + MRM CD8 ⁺ ROR1 CAR T cells were globally separated in both donors, suggesting that CD8 ⁺ T cells from the two conditions had distinct transcriptomic and epigenetic profiles (FIG.24A). To assess whether the combination of NR4A3 KO + PCS could further reduce T cell exhaustion, a “terminally exhausted cluster” was identified in each donor based on high expression level of exhaustion-associated gene markers, such as TIGIT, LAG3 and HAVCR2 as well as motif enrichment of exhaustion- associated transcription factors EOMES/T-bet (FIG. 24B. shows the motif enrichment score of EOMES. T-bet and EOMES recognize similar motifs). The proportion of the terminally exhausted cluster was lower in NR4A3 KO + c-Jun + MRM + PCS CD8 ⁺ ROR1 CAR T cells compared to non-edited + c-Jun + MRM CD8 ⁺ ROR1 CAR T cells in both donors (FIG.24C). The reduction of exhaustion in NR4A3 KO + c-Jun + MRM + PCS T cells was furthered confirmed in pseudobulk RNA-Seq analysis, where gene set enrichment analysis revealed that multiple exhaustion-associated gene sets were significantly enriched in genes downregulated in NR4A3 KO + c-Jun + MRM + PCS CD8 ⁺ ROR1 CAR T cells compared to non-edited + c-Jun + MRM CD8 ⁺ ROR1 CAR T cells (FIG.24D). [0727] Interestingly, several exhaustion-related genes including ENTPD1 (Oliveira et al. 2021, Zhang et al.2018, Yost et al.2019), LAYN (Oliveira et al.2021, Yost et al.2019) and LYST (Tirosh et al. 2016) were not unique to the terminally exhausted cluster, but globally down-regulated in NR4A3 KO + c-Jun + MRM + PCS CD8 ⁺ ROR1 CAR T cells compared to non-edited + c-Jun + MRM CD8 ⁺ ROR1 CAR T cells (FIG. 24E). On the other hand, GNLY, a known effector-associated gene marker, and IL7R, a known marker of memory T cells were globally up-regulated in NR4A3 KO + c-Jun + MRM + PCS CD8 ⁺ ROR1 CAR T cells (FIG.24E). Taken together, the data suggested that NR4A3 KO + c- Jun + MRM + PCS CD8 ⁺ ROR1 CAR T cells could reduce terminal exhaustion and potentially enhance memory-like and effector-like cell phenotype after five rounds of antigen stimulation (at day 15). Example 10: Antitumor Efficacy [0728] Lastly, an in vivo H1975 xenograft model was used to determine whether the phenotype and improved function of c-Jun overexpressing NR4A3-edited ROR1 CAR T cells generated with PCS and MRM from the in vitro assays are recapitulated in vivo. Parental H1975 tumor cells were cultured in RPMI-1640 (Gibco) + 10% fetal bovine serum (Gibco) for 3-6 passages before implantation into 5–13-week-old NSG HLA double- knockout mice (Jackson Labs). Cells were trypsinized with TrypLE Express enzyme, resuspended in HBSS (Gibco), and mixed with Matrigel (Corning) at a 1:1 ratio. Five million H1975 tumor cells were implanted into the flank of each mouse. T cells were adoptively transferred into randomized tumor-bearing mice when tumors reached an average 125 mm ³ in size. Tumor volumes and body weight were measured twice weekly until the endpoint when tumors reached > 2000 mm ³ , > 20% body weight loss, ulceration, labored breathing, severely restricted mobility or inability to upright, or up to 100 days after T cell transfer. [0729] To prepare T cells for adoptive transfer, cryopreserved c-Jun overexpressing NR4A3-edited, control CD19-edited, or non-edited ROR1 CAR T cells generated in MRM with and without PCS were thawed and washed with RPMI-1640 (Gibco) + 25mM HEPES (Gibco) prior to adoptive transfer into tumor-bearing mice. Mice were injected i. v. via the tail vein with a single 100 uL dose of 0.1 x 10 ⁶ (low dose), 0.3 x 10 ⁶ (mid dose) or 1 x 10 ⁶ (high dose) cParp-CD3 ⁺ EGFR ⁺ R12 ⁺ T cells. n = 10 mice per treatment group. GraphPad Prism Tukey’s one-way ANOVA and log-rank (Mantel-Cox) test were used for statistical analysis. [0730] NR4A3-edited c-Jun overexpressing ROR1 CAR T cells generated in MRM with PCS showed significantly improved anti-tumor efficacy in both studies at the medium and low dose levels of ROR1 CAR T cells compared to control CD19-edited counterparts (FIG. 25A, Table 35). In one animal study, similar tumor volume was observed between PCS- and TransAct-generated NR4A3-edited c-Jun overexpressing CAR T cells, but both had better anti-tumor activity compared to control CD19-edited c-Jun overexpressing CAR T cells generated with PCS and non-edited c-Jun overexpressing CAR T cells generated with TransAct. Moreover, in one animal study, mice adoptively transferred with the high dose level of c-Jun overexpressing NR4A3-edited ROR1 CAR T cells generated with PCS had significantly higher fold expansion of peripheral blood CD3 ⁺ CAR ⁺ T cell numbers on day 21 after T cell injection compared to non-edited c-Jun overexpressing CAR T cells generated without PCS. Importantly, c-Jun overexpressing NR4A3-edited ROR1 CAR T cells generated with PCS contracted (FIG. 25B, Table 36). In one animal study, PCS- generated NR4A3-edited c-Jun overexpressing CAR T cells significantly improved animal survival at the high dose level compared to other CAR T cell-treated groups. In the same animal study at the medium dose level, PCS and Trans-Act generated NR4A3-edited c-Jun overexpressing CAR T cells both significantly improved animal survival compared to control CD19-edited c-Jun overexpressing CAR T cells generated with PCS. At the low dose level in both animal studies, PCS and Trans-Act generated NR4A3-edited c-Jun overexpressing CAR T cells both significantly improved animal survival compared to control CD19-edited c-Jun overexpressing CAR T cells generated with PCS. Furthermore, PCS-generated NR4A3-edited c-Jun overexpressing CAR T cells significantly improved animal survival compared to non-edited c-Jun overexpressing CAR T cells generated with TransAct (FIG.25C, Table 37). Table 35. Tukey one-way ANOVA statistical analysis of H1975 xenograft tumor volumes corresponding to FIG.25A. ns – not significant, * p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 36. Unpaired t-test statistical analysis of H1975 xenograft peripheral blood fold expansion of day 21 CD3 ⁺ CAR ⁺ T cell numbers corresponding to FIG.25B. Fold expansion was calculated as (day 21 CD3 ⁺ CAR ⁺ T cell numbers / day 1 CD3 ⁺ CAR ⁺ T cell numbers). ns – not significant, * p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. Table 37. Log-rank Mantel-Cox statistical analysis of animal survival corresponding to FIG.25C. ns – not significant, * p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001. [0731] Taken together, NR4A3-edited c-Jun overexpressing ROR1 CAR T cells generated with PCS in MRM exhibited robust cytotoxicity and cytokine production, better persistence, and displayed a phenotype that trended towards enhanced memory-like and reduced exhaustion, as demonstrated in vitro and in the in vivo H1975 xenograft model. This was observed at both research and clinical production scales as well as using healthy and NSCLC patient donor T cells. Therefore, editing NR4A3 in combination with c-Jun overexpression, MRM, and PCS in the context of ROR1-R12 CAR T cells can improve cellular immunotherapy against ROR1-expressing solid tumors. Table 38. c-Jun-anti-ROR1 CAR sequences