BACKGROUND OF THE INVENTION

[0001] The invention relates to a method for treating pulp useful for papermaking. In particular, it relates to a method for treating pulp with a specific protein. The invention also relates to use of this protein for enhancing refining/beating of pulp suitable for papermaking and for improving the end- product properties of paper. The invention further relates to pulp produced by the process and paper manufactured thereof.

[0002] Wood fibres are mainly composed of cellulose, hemicellu- lose, lignin and extractives. The purpose of a pulping process is to separate fibres from wood into a form that with suitable further treatments can be used for papermaking. Fibre separation may be performed by two different methods, i.e. by chemical pulping and mechanical pulping. In chemical pulping, the substance that binds the fibres together, i.e. lignin, is removed by means of specific chemicals and heat. Pulps obtained by this process are called chemical pulps. In mechanical pulping the fibres are defibrated by means of mechanical stress. Grinding or refining is mainly used. Pulps produced by these processes are called mechanical pulps. Additionally, between the chemical and the mechanical processes there are a number of processes which employ both chemical and mechanical treatments. Different pulps give the paper different technical properties, and to obtain desired end product properties the paper- maker makes use of fibre raw materials having different properties by mixing them in suitable proportions.

[0003] In mechanical pulping, no major chemical changes take place in fibre components, but the chemical composition of the fibres remains practically the same as that of wood. However, in chemical pulping about 90% of the lignin in the fibre and some of the hemicellulose dissolve. Hence, the chemical composition and structure of the mechanical pulp and those of the chemical pulp differ considerably from each other, as can be seen in Table 1 below.

Table 1. Chemical composition of various fibres

[0004] Advantages of mechanical pulping include, for instance, high pulp yield, low cost as compared with chemical pulp and excellent printing properties of paper made thereof, and good opacity. Drawbacks include poor strength properties and tendency to yellowing as well as high consumption of electric energy in processing. Advantages of chemical pulps include good strength properties and good bleachability, drawbacks include low pulp yield.

[0005] It is possible to obtain paper both from chemical and mechanical pulp by feeding stock onto a paper machine that presses the stock into paper. The final paper technical properties of paper may be affected in a variety of ways. As stated above, raw material choice is one factor that affects the properties. One significant factor that affects the paper technical properties is pulp refining/beating, which has a strong effect on all properties of paper. Refining/beating is of importance both to the properties of mechanical pulp as to those of chemical pulp. Refining/beating also affects the runnability of stock on the paper machine. Refining/beating refers to mechanical treatment of fibres, in which pulp fibres fibrillate both externally and internally. In external fibrillation, the outer surface of the fibre becomes larger and bonding between fibres becomes easier. Internal fibrillation makes pulp fibres flexible and contributes to fibre adaptation in sheet forming step. Both external and internal fibrillations are needed for accomplishing good smoothness and good end- product properties for paper. It is not possible, however, to make paper from paper pulp refined/beaten in a specific manner having all desired product properties at the same time, but in most cases while one property improves, another property becomes poorer. In practice the aim of refining/beating is to achieve a compromise that would be as advantageous as possible. For instance, refining/beating improves the tensile strength of a paper web and re-

duces roughness of paper. By contrast, the tear resistance of paper reduces as the refining/beating progresses. A drawback with the refining/beating is high energy consumption.

[0006] Enzyme applications in pulp and paper industry have been studied for decades, and enzymes have been found to have favourable effect in various stages of pulping and papermaking, starting from modification of raw wood material up to deinking of recycled pulp. Thus, enzymes may be used practically at any process phase, and it can be stated that due to complex chemistry the number of various enzymes improving the processes is large. Enzymes useful in both mechanical and chemical pulping include native and modified cellulases, hemicellulases, lignin-modifying enzymes and enzymes degrading extractives. In chemical pulping, enzymes, such as cellulases, hemicellulases and pectinases, have been used for reducing cooking liquor consumption by improving diffusion and porosity in wood. By means of enzymes it has been shown to provide improvements in bleachability of kraft pulps, paper drainability, pulp yield, strength properties and deinking. In mechanical pulps enzymatic treatment has been found to reduce energy consumption of defibra- tion and problems caused by pitch during pulping.

[0007] It is known that cellulases are capable of modifying fibre properties of paper pulp. Cellulases affect on the main carbohydrate of wood fibres, i.e. cellulose, which is a linear homopolymer consisting of glucose anhydride units being linked together with β-glycocidic 1 ,4-bonds. The cellulases are generally classified into two types: endoglucanases and exoglucanases (cellobiohydrolases). The effect of cellobiohydrolases I and Il (CBH I and CBH II) and endoglucanases I and Il (EG I and II) obtained from the fungus Tricho- derma reesei on the strength properties of unbleached pine kraft pulp has been studied in the publication by J. Pere, M. Siika-aho, J. Buchert and L. Vii- kari, " Effects of purified Trichoderma reesei cellulases on the fibre properties of kraft pulp", Tappi Journal, Vol. 78, No. 6, June 1995. It was found that all four cellulase types exhibite significant differencies in their mode of action on pulp cellulose. The endoglucanases were found to decrease the strength properties of the fibres more than the cellobiohydrolases. A clear correlation between pulp viscosity and hydrolysis of cellulose was found such that the pulp viscosity reduced the more cellulose was hydrolyzed.

[0008] A common feature to cellulases is that they always degrade or hydrolyze cellulose to some extent thus forming sugars. This is an undesir-

able property in view of pulping, because it leads to yield losses. Therefore, in pulping, hydrolysis of cellulose is avoided as much as possible.

[0009] Enzymes, such as cellulases, are generally characterized by specificity. The cellulases are a variegated group of different enzymes, each having a different way of action. Fibre accessibility, i.e. how susceptible a fibre is to enzyme effect, also contributes to efficacy of enzymes on the fibre. Hence, due to their more open structure, fibres of chemical pulp have higher accessibility than fibres of mechanical pulp, and consequently, chemical pulp fibres are more suitable for enzyme treatment. Specificity of enzymes and different fibre structures of pulps constitute a challenging task of determining at which point of pulping the enzyme treatment is to be performed to obtain the desired results.

[0010] Finnish patent publication 92500 discloses a process for the preparation of mechanical pulp, in which material to be defibrated is treated with an enzyme having cellobiohydrolase activity at some phase of the pulping process. The enzyme modifies crystalline parts of cellulose and thereby reduces specific energy consumption of mechanical pulping and improves fibre technical properties.

[0011] The above-described solutions have a problem either that hydrolysis of cellulose of some degree is unavoidable resulting in yield losses in pulping or that the desired end-product properties will not be achieved for paper manufactured of such pulp.

[0012] Now, it has been invented a process, by which the above- described drawbacks can be avoided. The process is based on utilization of a recently discovered protein in a pulp treating process. The protein named swol- lenin and its production is described in US patent application 2003/0104546 Al The effect of swollenin on cellulose structure was also studied by dipping filtering paper in swollenin solution and it was found that swollenin has a weakening effect on the filtering paper. The publication proposes that swollenin could be used for altering the properties of cellulose substrates, such as wood pulp and derivatives thereof, but the publication does not give any description or proposition how swollenin could be utilized in that.

BRIEF DESCRIPTION OF THE INVENTION

[0013] The object of the invention is to provide a method by which refining/beating may be enhanced and end-product properties of paper be im-

proved. This is achieved with a method that is characterized in that pulp is treated with a swollenin protein in connection with a mechanical treatment in pulping and/or papermaking processes. The preferred embodiments of the invention are disclosed in the dependent claims.

[0014] The invention is based on the surprising observation that as pulp useful for papermaking is treated with a swollenin protein in connection with at least one mechanical treatment of pulping and/or papermaking process, refining/beating of pulp may be enhanced and/or the end-product properties be improved. The swollenin protein is characterized by having very low hydrolytic activity. Hence, the swollenin employed in accordance with the invention does not hydrolyse cellulose and does not cause undesired breakage of cellulose or losses in pulp yield. The non-hydrolytic activity of swollenin is noted later on in the text such that protein treatment does not form sugars.

[0015] The method of the invention has an advantage, i.a., that the need for refining/beating of pulp is reduced without deteriorating product properties of paper. Surprisingly it was found that due to the swollenin treatment tensile strength of paper made of chemical pulp could be increased without beating of the chemical pulp, for instance, just by wet pressing. In the most preferred case, beating of chemical pulp may be omitted totally. Energy saving is thus considerable, particularly as regards energy-intensive mechanical pulping, but it is of importance to chemical pulping as well.

[0016] The invention further relates to pulp prepared by the described method and to paper made thereof. In addition, the invention relates to use of swollenin for enhancing the refining/beating of pulp useful for papermaking and for improving the properties of paper.

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 shows a swollenin production plasmid pMS171 ;

Figure 2 shows SDS PAGE and Western blot analysis of cultivation filtrate and IMAC-purified T. reesei swollenin;

Figure 3 shows density as a function of tensile strength for a hand- sheet made of ECF softwood pulp;

Figure 4 shows density as a function of tensile strength for a hand- sheet made of ECF hardwood pulp; and

Figure 5 shows some examples of mechanical treatments performed in pulp and paper making processes.

DETAILED DESCRIPTION OF THE INVENTION

[0018] The invention relates to a method for treating pulp useful for papermaking such that the pulp is treated with a swollenin protein in connection with at least one mechanical treatment in a pulping and/or papermaking process. Pulp treatment refers to a situation where the pulp is contacted with a swollenin protein, whereafter the pulp is treated in suitable conditions for a desired time period.

[0019] In the present invention, a mechanical treatment means any treatment of pulp suitable for papermaking, in which the pulp is subjected to mechanical strain during pulping and/or papermaking. It is obvious that there may be several such events in the course of the whole production process, whereby pulp is transferred, for instance, from one place to another by pumping or pulp is mixed in a container or a storage tower. These treatments have in common that they involve modification of the fibre structure. Some examples of mechanical treatments performed in the production process are given in Figure 5, which illustrates a general description of the papermaking process starting from pulping. The figure shows process phases involving mechanical treatment (marked "Mech"). The arrows may represent, for instance, pulp mixing, pulp pumping, wet pressing or refining/beating. In addition to the above- described mechanical treatments, the arrows may represent other mechanical treatments that may be carried out during the process. Between these treatments there may be phases where no mechanical treatment is taking place. Moreover, alternative points for adding an enzyme preparation into the process are also indicated in the figure (marked "Enz"). For instance, swollenin may be fed while pulp is pumped, into the suction side of the pump, whereby the swollenin will be thoroughly mixed and the pulp treatment will take place in connection with pulp transfer and/or in a subsequent intermediate tank.

[0020] The swollenin treatment may be performed prior to a mechanical treatment, simultaneously therewith or immediately thereafter. The expression "in connection with mechanical treatment" used in this application encompasses a concept "prior to a mechanical treatment, simultaneously therewith or immediately thereafter". The expression "prior to a mechanical treatment" means in this application to a point of time prior to the beginning of the actual mechanical treatment. Said point of time may vary temporally depending on which mechanical treatment is concerned. Addition of swollenin during mixing or pumping may be given as an example of adding swollenin

simultaneously with a mechanical treatment. The expression "immediately after a mechanical treatment" means a point of time that comes immediately after the actual mechanical treatment is accomplished. Preferably, the swollenin treatment is performed prior to a mechanical treatment, in particular prior to refining/beating of pulp.

[0021] In this invention, refining/beating means conventional pulp refining/beating subsequent to the actual defibering process prior to feeding the stock onto a paper machine. Wet pressing of pulp means a phase in the papermaking process, where a pulp web provided on a wire is conveyed through presses, whereby the web becomes more condensed and water is removed therefrom. As regards mechanical pulp, refining and defibring take place simultaneously. Reject means a coarse pulp fraction that requires additional refining, in a so-called reject refining.

[0022] The method of the invention is not restricted to a specific raw wood material, but it may be applied to any material of plant origin useful in pulping. Thus, the method of the invention is generally applicable to both softwood and hardwood. Various agrofibre pulps, such as annual plants, grasses, straws, flax, kenaf and other rest material from agricultural production that may be used for papermaking, are also suitable for swollenin treatment. The invention also applies to all pulp types, i.e. mechanical, semi-mechanical and chemical pulps, such as groundwood pulp (e.g. GW and PGW), thermome- chanical pulp (TMP) and chemithermomechanical pulp (CTMP) and the mixtures thereof. The invention also applies to recycled pulp and mixtures thereof with the above-mentioned pulps. The method may be used, for instance, for "coarse pulp" of mechanical pulping. In connection with the present invention this term means lignocellulose-based material, from which the mechanical pulp is to be prepared and on which defibration of some degree has already been performed during the pulping process, for instance, by grinding. "Coarse pulp" thus comprises, for instance, once ground pulp, fibre reject and a long-fibre fraction and the combinations thereof, which have been produced by refining (e.g. TMP) or grinding (e.g. GW and PGW). Freeness of the mechnical pulps is generally from 30 to 1000 ml CSF. For mechanical pulps the swollenin treatment is preferably performed before the last mechanical defibration phase.

[0023] The pulp to be used in the method of the invention may be either bleached or unbleached. In particular, the invention is applicable to the treatment of chemical pulp made from softwood.

[0024] In a preferred embodiment of the invention, chemical pulp is treated with swollenin in connection with beating and wet-pressing. As stated above, beating improves the tensile strength of paper. Because various paper qualities require different strengths, in some cases it is possible that no beating of pulp is needed at all in order to provide paper with particular strength properties, but the swollenin treatment is only carried out, for instance, in connection with wet pressing. In a more preferable embodiment of the invention, the swollenin treatment is performed on chemical pulp in connection with wet pressing. Thus, it can be stated that beating is replaced, partly or even completely, by the swollenin treatment. Examples given below indicate that the tensile strength may be improved by swollenin by as much as 40% as compared with the untreated pulp.

[0025] Beating also increases the density of paper, which is of importance to the optical properties of paper. Figures 3 and 4 show that the swollenin treatment improves paper technical properties also in that density of paper increases.

[0026] "Swollenin" means a protein of microbial origin, which has the ability to weaken a filter paper and swell cotton fibres without having cellu- lolytic activity, i.e. without breakage of individual cellulose fibres into mono- or oligosaccharides. More precisely, swollenin is a protein that is capable of degrading the structure of cotton fibres without forming detectable amounts of reducing sugars. The swollenin also has the ability to open the cell wall of Va- lonia alga, which consists of highly crystalline cellulose.

[0027] The sequence of swollenin partly resembles plant expansins, which are thought to break hydrogen bonds between polysaccharides in a cell wall. Unlike expansins, swollenin, however, generally comprises at its N- terminus a cellulose-binding domain (CBD), typical for moulds, that is linked via a linker region to an expansin-like domain. A CBD of this kind also occurs in well-known T. reesei cellulases, such as CBH I and EG II. Unlike swollenin, however, said cellulases are always hydrolytic to some extent.

[0028] The N-terminus of swollenin may further contain a signal sequence preceding the CDB, which sequence probably is a string of 18 amino acids, which is cleaved off in front of two glutamins preceding the CBD. The signal sequence enables production of extracellular protein.

[0029] The swollenin may be derived from bacterial, yeast or mould origin. According to one embodiment, it is derived from a filamentous fungus,

preferably Trichoderma spp., and particularly from T. reesei. Other possible microbial sources are revealed in US patent 6,458,928. Swollenin may be isolated from a microbial strain that produces it naturally, but preferably it is produced by a genetically modified strain. Thus, a gene coding swollenin or an active fragment thereof is operatively linked to a strong promoter for overex- pressing the protein. The resultant gene construction including at least part of the gene coding swollenin, is used for transforming a heterologous or homologous host cell, which is subsequently cultivated under conditions, where the desired protein is expressed. Methods of gene technology are commonly known in the art. Suitable host cells include, for instance, filamentous fungi, such as Trichoderma sp. or Aspergillus sp. It is also possible to produce swollenin, e.g., in yeast.

[0030] The swollenin is preferably produced as an extracellular protein that is secreted into the culture medium which may be used as such or from which the protein may be readily further isolated and/or purified using methods known in the protein art. Alternatively, the cells are disrupted, whereafter the intracellular swollenin is isolated and/or purified.

[0031] A swollenin-coding gene swo1 has been identified from the fungus Trichoderma reesei (longibrachiatum), whose sequence was deposited in EMBL sequence database under deposit number AJ245918. This gene and the swollenin encoded thereby have been described in detail in publications Saloheimo M. et a/., 2002, Eur. J. Biochem. 269, 4204-4211, US 6,458,928 and US 2003/0104546, which are incorporated herein by references. These publications also describe how the swollenin used in the present invention may be produced, isolated and purified. According to Saloheimo et al., 2002, there is an indication that moulds have a plurality of genes encoding swollenin-like proteins. Thus, the present invention is not restricted to the use of said one identified swollenin alone, but it encompasses all proteins and protein domains having swollenin activity. Preferably, there is used swollenin having an amino acid sequence which is at least 70% identical with the sequence deposited in the sequence database, or with a fragment thereof having activity of enhancing beating of paper pulp.

[0032] The swollenin isolated from Trichoderma reesei displays only slight or non-existent activity towards β-glucan, mannan, xylan and hy- droxyethylcellulose (HEC). As compared with endoglucanases EGI and EGII of the mould T. reesei the specific activity of swollenin towards β-glucan is 30 to

100 times lower. However, other minor activities found may result from impurities in the protein preparation.

[0033] The amount of swollenin may vary in accordance with the pulp to be treated, but typically it is about 0.001 to 10 mg/g of dry pulp. Preferably, the amount is 0.01 mg/g to 1 mg/g of dry pulp. The swollenin treatment is carried out at 20 to 80 °C, preferably at 30 to 50 ⁰ C, at pH range of 3 to 10, preferably about 4 to 6, for 0.1 to 24 hours, preferably 2 to 6 hours, at pulp consistency of 1 to 50%, preferably 2 to 15%.

[0034] As stated above, pulp refining/beating plays an important role in papermaking. In refining/beating, the fibres are treated mechanically and their suitability for papermaking is affected. Due to the swollenin treatment the fibre properties of paper pulp are preferably modified such that the need for refining/beating decreases.

[0035] The following examples illustrate the invention.

Example 1. Production of swollenin

[0036] Swollenin protein was produced in T. reesei by means of a strong cbh1 promotor in order to achieve a higher yield level than that obtained with genetically unmodified strains, in which swollenin is produced with its own promoter. For this purpose, a production plasmid was constructed for swollenin. A protein-coding section of a swollenin gene was amplified by PCR such that at the beginning of the gene there were added identification sequences of Xbal and Ncol restriction enzymes and at the end there were added six his- tidine amino acid codons, a stop codon and recognition sites of Ncol and Xbal restriction enzymes. Oligonucleotide primers were used in PRC as follows: forward 5' GTCATCTAGACCATGGCTGGTAAGCTTATCCTC 3", reverse 5' GCTCTAGACCATGGTCCAGTGGTGGTGGTGGTGGTGATTCTGGC- TAAACTGCACACC 3'. PCR reaction was performed by known methods using genomic swollenin gene of T. reesei as a template, and the resultant DNA fragment was digested with Xbal restriction enzyme and ligated by known methods to pBluescript cloning vector (Stratagene), which was opened with Xbal restriction enzyme. The obtained plasmid pMAP21 was sequenced for the whole swollenin gene, by which it was made sure that no mutations were produced therein in the PCR reaction. The swollenin fragment was detached from pMAP21 vector with Xbal digestion and ligated by known methods to pTPLadO expression vector, which had been opened with Sacll and Xhol re-

striction enzymes. In this vector Sacll and Xhol recognition sites are located between the cbh1 promotor and terminator. The final swollenin production plasmid obtained from this ligation is called pMS171 and it is depicted in Figure 1.

[0037] The swollenin production plasmid pMS171 was transformed to Trichoderma reesei strain VTT-D-00775 as cotransformation together with a pBluekan7-1.Notl plasmid, which contains an E.coli hygromycin resistance gene under gpdA promoter of Aspergillus nidulans. The transformation was carried out in accordance with a published process (Penttila et al., 1987. Gene, 61 ,155-164), and the transformants were selected on plates containing 150 mg/l hygromycin B. The transformants were streaked on selection plates (150 mg/l hygromycin B) and transferred twice onto new selection plates. The trans- formant clones were purified by making spore suspensions thereof using known methods, by plating spore suspension on selection substrate and by taking for further testing growth colonies from one spore.

[0038] Purified transformants were cultivated in shake bottles in Trichoderma minimal medium (Penttila et al., 1987 supra) containing 30g/l lactose and 15 g/l dried draff. Cultivation took seven days and it was carried out at a temperature of 28 °C employing shaking at velocity of 200 rpm. Mould mycelium was separated from the growth medium by filtration and on growth medium samples there was performed a Western immuno-detection analysis using Histag antibody, which binds to six histidine amino acids added to the C terminus of swollenin, as well as using polyclonal antibody made against swollenin (Saloheimo et al., 2002 supra). In this analysis, 20 gave a positive reaction of 53 analysised transformants. Transformant number 24 that gave the strongest reaction was selected for fermentor cultivation. It was carried out as batch fermentation, the volume being 20 litres, in Braun Biostat C fermentor in Trichoderma minimal medium (Penttila et al., 1987 supra), to which were added 40 g/l lactose and 20 g/l dried draff. The pH of culture was adjusted within the range of 5.0 to 6.0 and for the first 18 hours the temperature was 28 ⁰ C and thereafter 24 °C. The cultivation took 91 hours altogether. After the cultivation mould mycelium was separated from the growth medium by centrifuga- tion and the growth medium was concentrated by ultrafiltration using Mini-PCI filter.

Example 2. Purification of swollenin

[0039] The concentrated culture filtrate was maintained frozen and thawed just before purification. Completely EDTA-free protease tablets (Roche) were added to the culture filtrate during melting. The total volume of the sample used was about 850 ml per purification. Salt concentration was adjusted to 0.5 M, pH to 7.2 and imidazole concentration to 2 mM, whereafter the sample was filtered to remove precipitates formed and applied to a chelating Sepharose FF (Pharmacia Biotech) column (5 x 15 cm) charged with 300 ml of 0.1 M NiSO ₄ . A stepwise elution profile was chosen and swollenin was eluted with 200 mM imidazole. The fractions were analyzed for the swollenin by SDS PAGE and Western blotting as described below. The fractions containing swollenin were combined, concentrated 3-fold in an Amicon ultrafiltration unit (Ami- con, Millipore) and desalted and buffered by Biogel P-6 (Bio-Rad). The buffered sample was applied to a DEAE Sepharose FF (Pharmacia) anion exchange column for further polishing of the sample.

Example 3. Characterizing of swollenin

[0040] Enzyme activities of the above purified swollenin preparation were analyzed. The protein content of the preparation was 5.9 mg/ml.

Table 2. Enzyme activities

* degrading effect on hydroxyethylcellulose

[0041] The results in Table 2 show that cellulase and hemicellulase activities measured for swollenin are very low and they may also result from an impure preparation. It should be noted that for EG-type cellulase the HEC activity is typically in the order of 800 to 1000.

[0042] The purified swollenin showed one major band at about 75 kDa and some minor bands in SDS-PAGE gel. (The difference between calculated and observed molecular masses has already been detected by SaIo- heimo et a/., 2002 supra. Even after endoglucanase H treatment the molecular weight is higher than the calculated value.) The molecular mass of T. reesei swollenin produced in a strain of A.niger var awamori and included in the gel run as reference was close to 75 kDa. Western blot analysis was also performed on the purified swollenin purified in an IMAC (Immobilised metal affinity chromatography) column with anti-swollenin antibodies.

[0043] Figure 2 shows the results of the SDS PAGE and Western blot analysis of the culture filtrate and IMAC purified T. reesei swollenin. (A) represents SDS PAGE run and (B) represents Western blot against swollenin antibody. LMW represents a molecular mass standard, lane 1 represents concentrated cultivation filtrate (10 μg), lanes 2 and 3 represent IMAC purified swollenin (30 μg and 5 μg) lane 4 represents CBHI (5 μg) and lane 5 represents T. reesei swollenin expressed in Aspergillus niger var. awamori (5 μg).

Example 4. Pulp treatment with swollenin and sugar formation

[0044] The example illustrates hydrolyzing activity of the swollenin protein produced and purified in accordance with examples 1 and 2 on ECF (elementary chlorine free) bleached softwood and hardwood pulps for forming soluble cello-oligosaccharides. Swollenin was dosed in amounts of 0.01 mg and 0.1 mg protein/g of pulp (oven dry). Purified cellulases CBH I and EG Il

were used as reference. Pulp treatments were carried out at a consistency of 2% (50 mM Na acetate buffer, pH 5) and at 45 °C for 4 hours, except that incubation times for the swollenin dosage of 0.01 mg/g were 4 hours and 16 hours. The samples were stirred slowly during the treatment. The treatment was terminated by immersing the pulps in a water bath of 100 ⁰ C for 10 minutes. The amount of sugars was analyzed by HPLC. The results are presented in Tables 3 and 4 below. The given percentages indicate the total amount of glucose, cellobiose and cellotriose from cello-oligosaccharides.

Table 3. Formation of sugars in ECF bleached softwood pulp

Table 4. Formation of sugars in ECF bleached hardwood pulp

[0045] The results show that the swollenin protein does not form sugars as cellulases CBH I and EG Il do. It is to be noted that not even a prolongation of incubation time from 4 hours to 16 hours at a dosage of 0.01 mg/g of swollenin led to formation of sugars.

Example 5. Effects of swollenin treatment on fibre and pulp properties

[0046] Fibre length, fibre width, thickness of fibre wall, fibre curl and cross-section area of fibre of ECF bleached birch pulp were measured with Fiberlab apparatus after treatment with swollenin. Prior to the swollenin treatment and analysis the birch pulp was converted to Na and Ca to ensure the reliability of the analysis. The pulp was treated with a swollenin dosage of 2.5

mg/g pulp in 50 mM citrate buffer, at pH 6, for 24 hours. A swollenin dosage of 0.1 mg/g pulp was also used for Na pulp.

Table 5. Effects of swollenin treatment on fibre and pulp properties

[0047] The average fibre width and fibre length of the pulp did not change due to the swollenin treatment with any of the pulp types. However, the thickness of the fibre wall and the cross-section area of the fibre became slightly increased in the swollenin treatment. Swelling of the fibre wall increases fibre flexibility and hence swelling has a favourable effect on the capability of the fibre to bond, which in turn increases strength.

[0048] WRV (water retention value) (g water/ g pulp) indicating fibre swelling and water retention of pulp were measured for ECF softwood pulp treated with swollenin at a temperature of 40 °C for 24 hours. Swollenin was dosed at dosages of 0.1 mg and 1.0 mg protein /g abs. dry pulp. The analysis was carried out in accordance with SCAN-C 62 method. The results are shown in Table 6.

Table 6. WRV values of ECF-softwood pulp, g/g

[0049] It also appears from the results that WRV of the pulp did not change substantially over the reference in consequence of the swollenin treatment and in that respect the treatment has no adverse effect on the pulp.

Example 6. Effect of wet pressing on sheet properties

[0050] ECF softwood and hardwood pulps were treated with swol- lenin at a temperature of 45 ⁰ C for 4 hours. Swollenin was dosed at dosages of 0.01 mg, 0.1 mg and 1.0 mg protein /g pulp (oven dry). After the swollenin treatment handsheets were prepared in accordance with SCAN-CM 26:99 method. The sheets were wet pressed at four different pressures, i.e. in 179, 358, 720 or 1300 kPa. Pressing time was 4.2 min for all the pressures. After pressing the sheets were dried in a drum drier, whereafter the tensile strength and density of the sheets were analyzed in accordance with SCAN methods. The pulp was not beaten prior to sheet formation.

[0051] It was observed that the density (kg/m ³ ) of the handsheet made of ECF softwood and hardwood pulps increases as a function of the pressure applied in wet pressing. The swollenin treatment increased the density of the handsheet over an untreated reference. The results are shown in Table 7.

Table 7. Effect of pressure in wet pressing on density of ECF softwood and hardwood pulp sheet, kg/m ³

[0052] Figures 3 and 4 show density of a handsheet made of ECF softwood pulp and hardwood pulp, respectively, as a function of tensile strength. The four measurement points of the curves have been measured at four compression pressures mentioned above to indicate how the values of density and tensile strength increase as the pressure values increase. The results show that due to the swollenin treatment the tensile strength of a sheet is

clearly improved over the untreated sheet (ref.). The improvement in tensile strength is up to 25 to 40% at a swollenin dosage of 1.0 mg/g pulp. The effect is slightly less at lower swollenin dosages of 0.1 and 0.01 mg/g pulp, but yet over 20% at a maximum pressure of 1300 kPa. Increase in tensile strength in a given density indicates that as a result of fibre modification provided by the swollenin treatment bonding between fibres has increased without beating generally performed on the pulp.

Example 7. Effect of swollenin treatment on beating of chemical pulp

[0053] ECF-bleached softwood pulp was treated with swollenin as described in Example 4. After the treatment, the pulp was beaten with PF1 refiner in accordance with SCAN 24:95 method. The consistency of pulp in beating was 10% and the pulp was beaten for different revolutions (0, 750, 1500 and 3000 revolutions). The number of refiner revolutions was adjusted such that untreated reference achieved a tensile index of 70 Nm/g. After pulping handsheets were prepared from the pulps in accordance with SCAN 26:99 method and the strength properties of the sheets were analyzed in accordance with the above-mentioned SCAN methods. The results are presented in Table 8 below.

Table 8. Effect of swollenin treatment on beating

[0054] Table shows the degree of beating (as number of revolutions) that was required to provide the paper sheets with the tensile index of 70 Nm/g and the ScottBond index of 330 J/m ² . The ScottBond index indicates sheet strength in z direction.

[0055] The obtained results show that it is possible to reduce considerably (20 to 30%) the degree of beating with the swollenin treatment of pulp so as to achieve the given strength value. Tensile index of 70 Nm/g is

achieved with swollenin treatment (0.1 mg/g) by about 30% lower beating (energy) than in correspondingly treated pulp without swollenin addition.

Example 8. Effect of swollenin treatment on refining of mechanical pulp

[00S6] The effect of swollenin treatment on the energy consumption of refining of mechanical pulp was examined by treating coarse TMP reject prior to reject refining. The treatment conditions were as follows: consistency of pulp 10%, swollenin dosage 0.5 mg/g dry pulp, temperature 60 °C and duration of treatment 6 hours. After the treatment, the pulp was refined with a laboratory refiner. Specific energy consumption (kWh/kg) of the refining was measured and the freeness (CSF) of the pulps was analyzed by standard methods. On the basis of the obtained results it was found that energy consumption of refining was reduced (assessed at freeness of 100 ml) as compared with the correspondingly treated reference sample.

Example 9. Development of sheet properties of softwood pulp by the effect of swollenin

[0057] ECF-bleached softwood pulp was treated with swollenin in accordance with Example 4 using swollenin dosages of 0.01 mg/g and 0.1 mg/g abs. dry pulp. After the treatment the pulp was beaten for 3000 revolutions with PFI refiner as described in Example 8. After beating, handsheets were prepared from the pulp in accordance with SCAN 26:99 method and the sheets were tested in accordance with SCAN methods. The results are shown in Table 9.

Table 9. Effect of swollenin treatment on sheet properties

[0058] According to the results it can be observed that the swollenin treatment improved the strength properties (tensile index, ScottBond) of the handsheets as compared with the reference treatment.

[0059] It is apparent to a person skilled in the art that as technology progresses the basic idea of the invention may be implemented in a variety of ways. Thus, the invention and embodiments thereof are not restricted to the above-described examples but they may vary within the scope of the claims.