CROSS-REFERENCE TO RELATED APPLICATIONS

[001] This application claims the benefit of 63/088,632, filed on October 7, 2020, the content of which is herein incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

[002] The isolation of biological targets, such as circulating tumor cells (CTCs), pathogenic bacteria, circulating microvesicles, or exosomes, from easily accessible biological fluids is of great importance for disease monitoring and diagnostics. Detection platforms that utilize micro- and nanoscale structures, where dimensions can be designed to match those of the biological target, have been utilized for highly efficient and selective sorting.

[003] One method that has been particularly successful for isolating rare cells from clinical samples is magnetophoresis, in which immunomagnetically labeled targets are isolated from suspensions using strong and highly localized magnetic forces. Due to the lack of magnetic susceptibility of biological materials, magnetic sorting can be performed directly on unprocessed clinical samples (e.g., blood) and environmental samples (e.g., drinking water). Furthermore, strong forces can be applied without the need for a power supply or moving parts, making these devices well suited for use in practical settings outside of the laboratory.

[004] Much work has been done to develop and improve magnetic isolation using microfabrication techniques. Micropatterned magnetic field profiles have been engineered using lithographically defined current carrying wires and paramagnetic materials. Additionally, a number of bottom-up fabrication strategies have been developed to create strong magnetic forces. Microfluidic channels have been used in conjunction with patterned magnetic fields to bring targeted cells close to the high magnetic field gradients, to provide predictable flow velocities, and to minimize nonmagnetic retention.

[005] While magnetic separation devices can be useful in many applications, the current manufacturing process can limit the high throughput production of these devices. There is a need for magnetic separation devices that have improved sorting efficiencies, greater throughput, and/or easier manufacturing process.

SUMMARY OF THE INVENTION

[006] Disclosed herein is a magnetic separation device, comprising a magnetic separation filter encapsulated in an enclosed laminated structure, wherein the magnetic separation filter comprises a layer of magnetically soft material having a plurality of pores. In some cases, the magnetically soft material comprises a nickel-iron alloy. In some cases, the magnetically soft material comprises Ni2oFeso. In some cases, the magnetic separation device further comprises a passivation layer adjacent the layer of magnetically soft material. In some cases, the passivation layer comprises nickel or gold. In some cases, the magnetic separation device comprises two or more magnetic separation filters. In some cases, the two or more magnetic separation filters are stacked together in the magnetic separation device. In some cases, the enclosed laminated structure is connected to a reservoir via one or more inlet ports. In some cases, the reservoir is configured to receive a suspension comprising a biological sample. In some cases, the reservoir is a syringe or microwell plate. In some cases, the reservoir is a 6, 12, 24, 48, 96, 384, or 1536 microwell plate. In some cases, each well in the microwell plate is connected to the magnetic separation filter. In some cases, the enclosed laminated structure is configured to prevent exposure of the magnetic separation filter to air when the inlet and outlet ports are closed. In some cases, the enclosed laminated structure is configured to prevent formation of a meniscus on the magnetic separation filter. In some cases, the enclosed laminated structure is configured to prevent oxidation of the magnetically soft material. In some cases, the magnetic separation device further comprises one or more inlet and outlet ports. In some cases, the one or more inlet and outlet ports are injection molded ports. In some cases, the one or more inlet and outlet ports are poly (methyl methacrylate) injection molded Luer lock ports.

[007] In another aspect, disclosed is a method for making the magnetic separation device disclosed herein, comprising laminating a membrane roll onto a carrier substrate to form the magnetic separation filter encapsulated in the enclosed laminated structure, and wherein the magnetic separation filter comprises the layer of magnetically soft material having the plurality of pores. Also disclosed is a method of making a magnetic separation device, comprising laminating a membrane roll onto a carrier substrate to form a magnetic separation filter encapsulated in an enclosed laminated membrane structure, and wherein said magnetic separation filter comprises a layer of magnetically soft material having a plurality of pores. In some cases, the membrane roll is a track etched membrane roll. In some cases, the method further comprises magnetron sputtering of the magnetically soft material.

[008] In another aspect, disclosed is a method for using the magnetic separation device disclosed herein, comprising: a) exposing the magnetic separation device to an external magnetic field; b) flowing a suspension comprising the magnetically tagged particles through an inlet port of the magnetic separation device; and c) capturing the magnetically tagged particles in the magnetic separation device. Also disclosed is a method for using a magnetic separation device, comprising: a) exposing the magnetic separation device to an external magnetic field, wherein the magnetic separation device comprises a magnetic separation filter encapsulated in an enclosed laminated structure, wherein the magnetic separation filter comprises a layer of magnetically soft material having a plurality of pores; b) flowing a suspension comprising a magnetically tagged particles through an inlet port of the magnetic separation device; and c) capturing the magnetically tagged particles in the magnetic separation device. In some cases, the method further comprises flowing a lysis reagent to the magnetic separation device, thereby contacting the captured magnetically tagged particles and releasing contents of the captured magnetically tagged particles. In some cases, the method further comprises removing the external magnetic field, thereby releasing the captured magnetically tagged particles. In some cases, the magnetically tagged particles comprises microorganisms, extracellular vesicles, cell-free DNAs or combinations thereof. In some cases, the microorganisms are selected from the group consisting of bacteria, viruses, or cells. In some cases, the cells comprise circulating tumor cells (CTCs). In some cases, the extracellular vesicles are selected from the group consisting of ectosomes, microvesicles, microparticles, exosomes, oncosomes, apoptotic bodies, exomeres, and bacterial outer membrane vesicles (OMVs). In some cases, the contents of the captured magnetically tagged particles are selected from the group consisting of proteins, nucleic acids, lipids, metabolites, and organelles.

INCORPORATION BY REFERENCE

[009] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

[010] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which: [Oil] FIGs. 1A and IB show a diagram representation (1 A) and a picture representation (IB) of an exemplary open system of the magnetic separation device.

[012] FIGs. 2A and 2B show a diagram representation (2A) and a picture representation (2B) of an exemplary closed system of the magnetic separation device presented herein.

[013] FIGs. 3A and 3B show conditions of the membrane for an exemplary open system (3 A) and closed system (3B).

[014] FIG. 4 shows an exemplary material and assembly breakdown of the closed system magnetic separation device. DETAILED DESCRIPTION OF THE INVENTION

Magnetic separation device

[015] One aspect of the present invention relates to a magnetic separation device. As used herein, the phrase “magnetic separation device” is used to refer to a device through which material flows through a magnetic separation filter, and which magnetically captures targeted objects. The targeted objects may be magnetically tagged objects, such as, for example, cells, molecules, nucleic acids, proteins, etc.

[016] According to at least one case, the magnetic separation filter comprises a membrane having a plurality of pores, a layer comprising a magnetically soft material, and a passivation layer. In at least one case, a magnetic separation filter comprises a magnetically soft material comprising a plurality of holes through which material may pass. When a magnetic field is applied to the magnetic separation filter, magnetically tagged objects may be captured as they pass through the pores of the magnetic separation filter. As used herein, the terms “pore” and “micropore” are used interchangeably to refer to channels that pass completely through the magnetic separation filter, i.e., continuous channels that pass from one surface of the filter to the opposite surface of the filter. The layer of magnetically soft material in the magnetic separation device may comprise a material selected based on its magnetic properties.

[017] As used herein, the phrase “magnetically soft material” refers to a material which can become magnetized by a relatively low-strength, external magnetic field, e.g., by a magnet placed in close proximity to the material, that returns to a state of relatively low residual magnetism when the external magnetic field is removed.

[018] In at least one case, the magnetically soft material is capable of having an induced magnetic field when an external magnetic field is applied. The magnetically soft material may also be selected based on the magnetic remanence, i.e., the material’s ability to return to a nonmagnetic state when the external magnetic field is removed. In at least one case, the magnetically soft material is selected from permalloys, which include alloys of nickel and iron. In accordance with at least one case, the magnetically soft material is Ni2oFeso, an alloy which comprises 20% nickel and 80% iron (w/w).

[019] The magnetic separation filter may comprise a passivation layer to protect the magnetically soft material from undesired interaction or reaction with fluids that the magnetic separation filter may come in contact with. For example, the passivation layer may protect the magnetically soft material from oxidation or prevent non-specific adsorption of biological substances to surfaces of the filter. In at least one case, the passivation layer is comprised of a material chosen from minimally biologically active materials, such as, for example, gold or nickel. In some cases, the minimally biologically active material can be oxidation resistant. Other materials known to those skilled in the art capable of protecting the magnetically soft material from oxidation may be used.

[020] In at least one case, the membrane is a material chosen from cellulosic, polymers, and metal oxide films. Examples of materials that may be used include, but are not limited to, paper, polycarbonate, polyester, nylon, and aluminum oxide. In at least one case, the membrane is polycarbonate.

[021] According to at least one case, the membrane is composed of a material capable of being ion track etched. Ion track-etching can be used to provide uniform pore sizes in the membrane material. Pores formed by ion track-etching are generally circular in shape and are typically randomly arranged in the film. A magnetic separation filter comprising ion track-etched pores greater than 1 pm in diameter is referred to herein as a Track-Etched magnetic Micro-POre (TEMPO) filter, which are used in various cases and examples used throughout the present disclosure. Similarly, nanoscale magnetic separation filters comprising ion track-etched pores less than 1 pm in diameter are referred to as a Track-Etched magnetic Nano-POre (TENPO) filter. TEMPO and TENPO filters differ only in the size of the pores, and, unless specifically stated, the description of TEMPO filters herein can be equally applied to TENPO filters. Likewise, the terms “microfluidic” and “nanofluidic,” as used herein, differ only in scale and all references to microfluidic are applicable to nanofluidic devices, unless stated otherwise. Other methods of forming pores within membranes known in the art can also be used. The magnetic separation devices of the present invention, however, are not intended to be limited to ion track- etched devices and one skilled in the art will recognize that unless otherwise specified, cases which refer to TEMPO or TENPO filters may include membrane-based magnetic separation filters formed by other methods. In at least one case, the membrane is ion track-etched polycarbonate.

[022] In accordance with at least one case, the magnetically soft material is formed on the membrane by thermal evaporation, sputtering, chemical vapor deposition. The layer of magnetically soft material formed on the membrane may have a thickness ranging from about 50 nm to about 1 pm, such as from about 50 nm to about 200 nm. In some cases, the layer of magnetically soft material may have a thickness of about 20 nm to about 2,000 nm. In some cases, the layer of magnetically soft material may have a thickness of at least about 20 nm. In some cases, the layer of magnetically soft material may have a thickness of at most about 2,000 nm. In some cases, the layer of magnetically soft material may have a thickness of about 20 nm to about 50 nm, about 20 nm to about 100 nm, about 20 nm to about 200 nm, about 20 nm to about 500 nm, about 20 nm to about 1,000 nm, about 20 nm to about 1,500 nm, about 20 nm to about 2,000 nm, about 50 nm to about 100 nm, about 50 nm to about 200 nm, about 50 nm to about 500 nm, about 50 nm to about 1,000 nm, about 50 nm to about 1,500 nm, about 50 nm to about 2,000 nm, about 100 nm to about 200 nm, about 100 nm to about 500 nm, about 100 nm to about 1,000 nm, about 100 nm to about 1,500 nm, about 100 nm to about 2,000 nm, about 200 nm to about 500 nm, about 200 nm to about 1,000 nm, about 200 nm to about 1,500 nm, about 200 nm to about 2,000 nm, about 500 nm to about 1,000 nm, about 500 nm to about 1,500 nm, about 500 nm to about 2,000 nm, about 1,000 nm to about 1,500 nm, about 1,000 nm to about 2,000 nm, or about 1,500 nm to about 2,000 nm. In some cases, the layer of magnetically soft material may have a thickness of about 20 nm, about 50 nm, about 100 nm, about 200 nm, about 500 nm, about 1,000 nm, about 1,500 nm, or about 2,000 nm. In at least one case, the layer of magnetically soft material is evaporated on the membrane to form a layer having a thickness of 200 nm. In some cases, the thickness of the magnetically soft material formed on the membrane may be limited by the technique used to deposit the material. The thickness should be sufficient to generate a magnetic field strong enough to capture the desired particles.

[023] In at least one case, the membrane comprises a commercially available ion track-etched polycarbonate membrane. The membrane is coated with a thin layer of magnetically soft material (e.g., permalloy) and a passivation layer of gold.

[024] Polycarbonate membranes can be track-etched with pore sizes ranging from 15 nm to 100 pm over large areas (A > 10 cm ² ) for little cost (<$.05/cm ² ). The membranes are flexible and can be integrated into laminate sheet microfluidics patterned with laser micromachining. Due to the large size of the membranes (A > 1 cm ² ), highly efficient isolation (S, > 10 ⁴ ) can be achieved at extremely high flow rates ( > 10 mL/hr).

[025] Without wishing to be limited by theory, it is believed that there are three main elements of the magnetic separation filter which maximize the magnetic force Fm and minimize the drag force Fa on targeted particles or objects (e.g., cells or exosomes), and thus optimize the sorting efficiency of the filter.

[026] Strong magnetic field with high field gradient (Bj ¹ , VB . The magnetic force Fm~(B» )B can be maximized by increasing the strength of the applied field B and its spatial changes B. The magnetic separation filter generates strong fields (e.g., |B| = 0.2 T or more) due to the external magnet and strong, highly localized magnetic field gradients due to the pore geometry, to create strong magnetic trapping forces.

[027] In an example of the magnetic fields in an Exosome sorting Track-Etched magnetic NanoPOre (ExoTENPO) filter. In this example large fields B ~ 0.4 T are produced by the neodymium iron boron (NdFeB) magnet. Large field gradients B are created by the NiFe coated nanopores (d= 600 nm), which generate nanoscale field gradients at the pore's edge, where there is a transition from the highly magnetically susceptible NiFe to water. The close proximity of the exosomes to the regions of large magnetic force is controlled by the d= 600 nm nanopores, which require each exosome to come within r = 300 nm of the magnetic traps that are located at the pore's edge. Fundamentally, it is believed that these nanoscale traps can be created because there is no inherent length-scale in Maxwell's Equations for magnetostatics, in contrast to optical trapping where the size of a trap is limited by the wavelength of light.

[028] The hydrodynamic drag force Fd=67tpav, where p is the viscosity and v is the fluidic velocity, can be minimized by using columnar flow instead of flow that is in-plane with a 1 in ³ NdFeB magnet. The cross sectional area of a vertical flow channel grows quadratically with the dimensions of the chip L ² , rather than linearly as with lateral flow. This feature may allow large flow rates <I> to be obtained, while keeping the flow velocity v small and the chip compact. Utilizing this approach, efficient sorting can be achieved at very high flow rates (<E> > 10 mL/hr). Close proximity of each particle (e.g., cells or exosomes) to the regions of strong magnetic force (4). Because each particle must pass through a pore, each particle comes within r = d/2 of the edge of the pore, where d is the pore diameter and the pore has a circular cross-section. By choosing the pore size to be on the same size-scale as the object being trapped, it can be ensured that each particle comes within close proximity of the high-force trapping region.

[029] In one example for isolating an exosome, the magnetic trapping force F _m must overcome the drag force Fd. The drag force is proportional to the flow velocity of the fluid Fd oc v. In our design, the ExoTENPO chip consists of an Adev = 15.2 cm ² sized membrane densely covered (p > 10 ⁶ /cm ² ) with magnetic nanopores. Thus, even at the high volumetric flow rates desired to process clinical samples > 10 mL/hr, the flow velocity v, and thus the drag force Fd, within each pore v _z = /(AdevpA _pore ) can be kept small, where A _pO re is the cross sectional area of an individual pore.

[030] A finite element model was developed to simulate the magnetic trapping capability of a TENPO according to the present disclosure using Matlab and Ansoft. The field strength B drops rapidly in distance from the edge of the nanopore, creating field gradients B that lead to strong magnetic forces Fm. The nanopore was modeled as a disc, with a diameter d= 600 nm and height h = 200 nm, with boundary conditions of zero field at large distances. The magnetophoretic force Fm on an exosome as it passes through a nanopore is calculated by combining the results from the simulation from with a simplified model for the exosome. The magnetic moment of the exosome is proportional to the number of magnetic nanoparticles (MNPs) n and the moment m _P of the particle (m = n * m ). The model assumes that the magnetic particles are fully magnetized by the externally applied field B _o ~ 0.4 T z. It was assumed m _P = 9.27xl0' ³ mA* pm ² and that each targeted exosome has n > 5 MNPs. The number of MNPs per exosome was calculated based on the limit imposed by steric hinderance on the smallest possible exosome, d= 30 nm, assuming 50% maximum loading.

[031] To interpret the finite element simulation, the process of capturing an exosome on ExoTENPO was separated into two steps. To be trapped, first an exosome is translated radially by magnetopheretic forces Fr to the trap at the edge of the pore. The radial force Fr drops off quickly in distance from the pore's edge. Therefore, in accordance with at least one case, the pore diameter d is minimized to bring the target object (e.g., exosome) into close proximity to the regions where the field is the strongest. Once the exosome is translated to the pore's edge, then the magnetophoretic trapping force F _z = 412 pN must overcome the drag force Fa to successfully trap the exosome. The Stoke's drag on the trapped exosome F = 6npav is calculated, where p is the viscosity of serum or plasma, and we find that even for extremely high flow rates »100 mL/hr) the magnetic force greatly exceeds the drag force F _m » Fa. Thus, for the flow rates used in this example, the capture of an exosome is determined solely by its translation to the pore's edge, which is a function of its initial radial position r, the radial magnetophoretic force Fr, and its flow velocity v _z oc From this analysis, the following observations were made: 1. The capture rate generally decreases as flow rate increases, 2. The capture rate generally increases as the pore's diameter d decreases, and 3. Because the probability of capturing an exosome is a function of its initial radial position in the pore, the capture rate can be increased by placing multiple filters in series, allowing the target object multiple, independent chances to be captured.

[032] In accordance with another aspect of the present invention, the magnetic separation filter may comprise an unsupported layer of magnetically soft material. As used herein, the term “unsupported layer of magnetically soft material” refers to a self-supporting layer of magnetically soft material, i.e., the layer of magnetically soft material does not need to be formed on another layer to provide support. The layer of magnetically soft material may have a thickness sufficient to provide the necessary strength to support itself within a magnetic separation device and to endure the pressure generated by flow through the device. The unsupported layer of magnetically soft material is not formed on a membrane.

[033] In at least one case, the magnetic separation filter comprises pores at a pore density of at least 1000 pores/mm ² , such as, for example, at least 1500 pores/mm ² , at least 2000 pores/mm ² , or more. In some cases, the magnetic separation filter comprises pores at a pore density of at least 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 pores/mm ² .

[034] In TEMPO/TENPO filters, due to the random nature of ion track-etching, increasing the pore density may increase the probability of pore overlap, which occur when one pore overlaps at least a portion of another pore. Pore overlap can increase the effective size of the overlapped pores, and thus negatively affect the ability of the TEMPO/TENPO filter to trap the target particles. Therefore, in at least one case, the pore density may be selected to reduce the potential for overlap. In MagNET filters, pore density may be increased without overlap of the pores. [035] The pores may have an average diameter ranging from about 15 nm to about 100 pm, such as, for example, from about 100 nm to about 50 pm, from about 500 nm to about 50 pm, from about 500 nm to about 25 pm, or from about 500 nm to about 10 pm. In some cases, the pores may have an average diameter of about 50 nm to about 50,000 nm. In some cases, the pores may have an average diameter of at least about 50 nm. In some cases, the pores may have an average diameter of at most about 50,000 nm. In some cases, the pores may have an average diameter of about 50 nm to about 100 nm, about 50 nm to about 200 nm, about 50 nm to about 500 nm, about 50 nm to about 1,000 nm, about 50 nm to about 5,000 nm, about 50 nm to about 10,000 nm, about 50 nm to about 25,000 nm, about 50 nm to about 50,000 nm, about 100 nm to about 200 nm, about 100 nm to about 500 nm, about 100 nm to about 1,000 nm, about 100 nm to about 5,000 nm, about 100 nm to about 10,000 nm, about 100 nm to about 25,000 nm, about 100 nm to about 50,000 nm, about 200 nm to about 500 nm, about 200 nm to about 1,000 nm, about 200 nm to about 5,000 nm, about 200 nm to about 10,000 nm, about 200 nm to about 25,000 nm, about 200 nm to about 50,000 nm, about 500 nm to about 1,000 nm, about 500 nm to about 5,000 nm, about 500 nm to about 10,000 nm, about 500 nm to about 25,000 nm, about 500 nm to about 50,000 nm, about 1,000 nm to about 5,000 nm, about 1,000 nm to about 10,000 nm, about 1,000 nm to about 25,000 nm, about 1,000 nm to about 50,000 nm, about 5,000 nm to about 10,000 nm, about 5,000 nm to about 25,000 nm, about 5,000 nm to about 50,000 nm, about 10,000 nm to about 25,000 nm, about 10,000 nm to about 50,000 nm, or about 25,000 nm to about 50,000 nm. In some cases, the pores may have an average diameter of about 50 nm, about 100 nm, about 200 nm, about 500 nm, about 1,000 nm, about 5,000 nm, about 10,000 nm, about 25,000 nm, or about 50,000 nm. In at least one case, the pores have an average diameter less than about 50 pm, such as, for example, less than about 25 pm, less than 10 pm, less than about 5 pm, less than about 2 pm, or less than about 1 pm. As one skilled in the art would recognize, the size of the pores may be selected based on the size of the objects being separated. In at least one case, the size of the pores is selected such that the pores are large enough not to trap the targeted objects, or nonspecifically trap nontargeted objects based on size, but small enough to expose the objects to the greatest magnetic field gradient possible. For example, when a suspension comprises particles that are 1 pm in diameter, the pore size may be 4 pm in diameter. In at least one case, the pore size is about 2 to 5 times the size of the target object. For example, when trapping exosomes, which generally range in size from 30 nm to 200 nm, the pore size can range from about 50 nm to 1 pm. Larger pore sizes may also be used depending on the size of the target particles or to prevent co-purification of other particles present in the sample caused by trapping due to particle size. For example, a pore size of 500 nm could trap particles in a sample greater than 500 nm based on the inability of those particles to pass through the pores. To reduce trapping of unwanted particles, it may be desirable to use a larger pore size. To counter the reduction in trapping the desired particles, additional filters can be used in series.

[036] Due to the different manner in which the pores are formed, the pore sizes of TEMPO/TENPO filters can be significantly smaller than the pore sizes of MagNET filters. Iontrack etching currently allows for the formation of pore sizes as small as 15 nm, whereas currently electroforming technology allows for the formation of pore sizes on the scale of a few micrometers. The pores within the membrane may have any cross-sectional shape, such as, for example, circular, oval, rectangular, square, or other polygonal shape. In TEMPO/TENPO filters, the pores are generally circular in shape. The pore shape influences the magnetic field gradient. In at least one case, the pores have a symmetrical geometry. According to at least one case, the pores have a circular cross-section. Without wishing to be limited by theory, it is believed that a circular cross-section provides the most uniform magnetic field gradient.

[037] The shape of the pores may affect the efficiency of the magnetic separation filter. As discussed below, capture of magnetic particles occurs when the particle enters the magnetic field of the magnetic separation filter, which is strongest at the edge of the filter. An elongated pore, such as an oval or rectangular pore may increase the edge density of the pores in the device by increasing the effective length of the edge for a given number of pores, as compared to circular or square pores. Therefore, in accordance with at least one case, the pore shape may be selected to maximize the edge density of the magnetic separation filter.

[038] The magnetic separation filters according to the present invention may allow for much greater flow rates than other available separation devices, such as microfluidic devices, which run at 1 ml/h. In exemplary devices prepared by the inventors, TEMPO/TENPO filters have been prepared with a throughput up to about 40 ml/h with high enrichment. The inventors have made MagNET filters having a throughput of 180 ml/h with an enrichment greater than 10 ³ .

[039] The magnetic separation devices according to cases of the present invention may be flexible. Flexibility of the magnetic separation device can be beneficial in the construction of microfluidic devices, for example in high throughput roll-to-roll fabrication processes. Rigid devices, such as those constructed of silicon, may be difficult to manipulate within the confines of small structures, such as those found in microfluidic devices.

[040] Another aspect of the present disclosure relates to a microfluidic or nanofluidic device comprising a magnetic separation device. In at least one case, the microfluidic/nanofluidic device comprises at least one lateral flow channel and at least one vertical flow magnetic separation filter. The vertical flow magnetic separation filter, such as, for example, a TEMPO/TENPO filter or MagNET filter, which comprises a membrane having a plurality of pores, a layer of magnetically soft material disposed on the membrane, and a passivation layer disposed on the layer of magnetically soft material.

[041] The microfluidic/nanofluidic device may comprise any known structural or functional element. In at least one case, the microfluidic/nanofluidic device can be modular, including the vertical flow magnetic separation filter.

[042] In at least one case, the microfluidic/nanofluidic device comprises a plurality of vertical flow magnetic separation filters. Because each additional vertical flow magnetic separation filter increases the enrichment, one of ordinary skill in the art would recognize that the number of vertical flow magnetic separation filters can be selected to achieve the desired level of enrichment. In at least one case, the microfluidic/nanofluidic device comprises from 2 to 10 vertical flow magnetic separation filters, such as, for example, from 2 to 5. In other cases, the microfluidic/nanofluidic device could contain more than 10 vertical flow magnetic separation filters.

[043] The plurality of vertical flow magnetic separation filters can be arranged in series. In at least one case, each of the plurality of vertical flow magnetic separation filters has a membrane containing pores and a pore density that are similar. In other cases, each of the vertical flow magnetic separation filters may have different pore sizes and/or pore densities. In at least one case, the microfluidic/nanofluidic device may comprise a plurality of TEMPO/TENPO filters or a plurality of MagNET filters. In other cases, the microfluidic/nanofluidic device may combine at least one TEMPO/TENPO filter and at least one MagNET filter. According to at least one case, the microfluidic/nanofluidic device may comprise a flow converter for redirecting the lateral flow in the at least one lateral flow channel to vertical flow in the at least one vertical flow magnetic separation filter. The flow converter may comprise, for example, a plurality of pathways through which fluid can pass from the lateral flow channel to the vertical flow magnetic separation filter. Each of the plurality of pathways, for example, may be of similar length, such that fluid passing through the microfluidic/nanofluidic device will have the same residence time regardless of the path through which the fluid flows. In at least one case, the flow converter comprises a symmetric branched geometry.

[044] One example of the microfluidic/fluidic device can comprise an acrylic substrate, a lower 200 pm mylar layer, a TEMPO/TENPO filter, a flow converter comprising a layer of 50 pm mylar film having 16 regularly spaced holes and a layer of 200 pm mylar film having a symmetric branched geometry in fluidic communication with the 16 regularly spaced holes and fed by a lateral flow channel, and a top layer of 50 pm mylar film. Another aspect of the present disclosure relates to a method for separating magnetically tagged particles in a microfluidic/nanofluidic device.

[045] In at least one case, the method comprises exposing a vertical flow magnetic separation filter to an external magnetic field to induce a magnetic field gradient within pores of a membrane in the vertical flow magnetic separation filter, flowing a suspension comprising magnetically tagged particles through a lateral flow channel in a microfluidic/nanofluidic device, capturing the magnetically tagged particles in the pores of the vertical flow magnetic separation filter, removing the external magnetic field, and releasing the captured magnetically tagged particles. In another example, disclosed herein is a method for using the magnetic separation device, comprising: exposing the magnetic separation device to an external magnetic field, wherein the magnetic separation device comprises a magnetic separation filter encapsulated in an enclosed laminated structure, wherein the magnetic separation filter comprises a layer of magnetically soft material having a plurality of pores; flowing a suspension comprising the magnetically tagged particles through an inlet port of the magnetic separation device; capturing the magnetically tagged particles in the magnetic separation device; and flowing a lysis reagent through the inlet port of the magnetic separation device, thereby contacting the captured magnetically tagged particles and releasing contents of the captured magnetically tagged particles. In some cases, the magnetically tagged particles can be microorganisms (e.g., bacteria, viruses, cells such as circulating tumor cells (CTCs)) or extracellular vesicles (e.g., exosomes, bacterial outer membrane vesicles (OMVs)). In some cases, the contents of the captured magnetically tagged particles can be proteins, nucleic acids (e.g., DNAs or RNAs), lipids, metabolites, or organelles from the captured magnetically tagged particles.

Methods of Manufacturing the Device

[046] The magnetically soft material and the passivation layer, if present, can be formed on the membrane using any technique known in the art. For example, the materials may be deposited by thermal evaporation, sputtering, chemical vapor deposition, electroplating, etc.

[047] In accordance with at least one case, the unsupported layer of magnetically soft material is produced by electroforming the magnetically soft material. An electroformed nickel-iron alloy filter is referred to herein as a MAgnetic Nickel-iron Electroformed Trap (MagNET) filter. It is understood that methods and materials other than electroforming and nickel-iron alloys may be used to prepare magnetic separation filters comprising an unsupported layer of magnetically soft material. Therefore, embodiments which refer to MagNET filters may include magnetic separation filters having an unsupported layer of magnetically soft material formed by other methods. In accordance with at least one case, the layer of magnetically soft material in a MagNET filter is formed by electroforming the layer on a mold. The mold may comprise any material on which the magnetically soft material may be electroformed and separated. For example, the layer of magnetically soft material may be electroformed and mechanically removed from the mold, such as by peeling the layer from the mold. Alternatively, the layer of magnetically soft material may be removed by etching the mold away from the electroformed layer.

[048] In accordance with at least one case, the layer of magnetically soft material is electroformed on a mold and mechanically removed, enabling the mold to be reused to form additional layers. According to at least one case, the mold is made of copper. The mold may comprise a release layer to improve the release properties of the electroformed layer from the mold. A non-limiting example of a release layer formed on a copper mold is titanium.

[049] The mold may comprise pillars or protrusions that correspond to the pores when the layer of magnetically soft material is electroformed on the mold. The pillars or protrusions may be made of the same or different material as the mold. In at least one case, the pillars or protrusions are formed of a photoresist. The photoresist may be patterned using photolithography, for example. In at least one case, the photoresist is a positive photoresist. The sides of the pillars or protrusions may be tapered to improve release of the electroformed layer from the mold.

Tapering the pillars or protrusions may prevent breaking the pillars or protrusions during removal and allow the reuse of the mold. According to at least one case, the degree of taper is selected based on the desired thickness of the electroformed layer, the shape of the pores, and/or the size of the size of the pores. According to at least one case, the layer of magnetically soft material in the MagNET filter has a thickness ranging from about 3 pm to about 40 pm, such as, for example from about 5 pm to about 25 pm. Thicker or thinner layers may also be used. The thickness may be limited by the manner in which the layer of magnetically soft material is formed. For example, a layer that is too thin may not be able to be removed from a mold, whereas a layer that is too thick may damage pillars or protrusions on the mold when it is removed. The thickness may also depend on the desired properties of the MagNET filter. Without wishing to be bound by theory, it is believed that MagNET can capture magnetic particles at the top and bottom of each pore. [050] The magnetically soft material in the MagNET filters may have a surface passivation layer, such as an inert material like gold or nickel. In at least one case, the pores of the MagNET filters may be selected from any desired shape. Because the molds can be made using techniques such as photolithography, there is no limit to the shape that may be created. For example, the pores may have circular, square, triangular, oval, or rectangular shapes. Other, more complex shapes are also possible. For example, the shape of the pore may be tailored to match the shape of the desired target particles. If the target particles are cell clusters, the pores may have a clover shape, for example, or another shape to maximize the potential for trapping the particles in the magnetic separation filter.

Methods of Using the Device

[051] The magnetic separation device can be used for the diagnosis of or risk-profiling for conditions or diseases, such as cancer or brain injury, by capturing magnetically tagged particles, such as extracellular vesicles (e.g., exosomes). Extracellular vesicles (e.g., exosomes) can contain protein biomarkers as well as fragments of mRNA, miRNA, and DNA from their mother cells. [052] These biomarkers can be used to determine whether a subject has a specific condition. For example, a TEMPO/TENPO filter as described above may be used to isolate one or more exosomes. Because most cells secrete extracellular vesicles (e.g., exosomes), the method according to the present disclosure may be used to detect more than one condition simultaneously. Exosomal biomarkers may be tagged with magnetic nanoparticles (MNPs), such as iron oxide nanoparticles or any other magnetic material known in the art, and trapped by a magnetic separation filter according to an example disclosed herein (e.g., a TEMPO/TENPO filter). For example, the extracellular vesicles (e.g., exosomes) may be incubated with a cocktail of biotinylated antibodies and subsequently incubated with anti -biotin MNPs.

[053] Extracellular vesicles (e.g., exosomes) trapped by the magnetic separation filter may be evaluated by analyzing the nucleic acids or proteins extracted from the extracellular vesicles (e.g., exosomes), e.g., by using qPCR.

[054] According to at least one case, multiple biomarkers may be used to enable the method to detect more than one condition or disease.

[055] Conditions or diseases that may detected include any condition or disease which can be detected by biomarkers contained in an exosome, such as cancer (e.g., pancreatic cancer, lung cancer, prostate cancer, breast cancer, bladder cancer, liver cancer, glioblastomas), addiction, tuberculosis, brain injuries (including ischemic brain injury and traumatic brain injury), or infectious disease (e.g., tuberculosis, HIV, COVID-19). For example, brain-derived exosomes have been found in the bloodstream after brain injury. The method according to the present invention can be used to isolate and identify these exosomes. According to at least one case, the exosomes may be isolated from samples including blood/serum samples or other fluids, such as, urine.

The Closed System

[056] The magnetic separation device can comprise a closed system. The comparison of the original open system (FIGs. 1A and IB) and an exemplary closed system (FIGs. 2A and 2B) is shown here. Traditionally, similar magnetic separation devices feature a larger, open reservoir, which has several negative impacts. First, the open system 100 comprises an open reservoir 110, which receives the sample and/or reagents, and can expose the sample and reagents to air, thereby leading to a high potential for evaporation and/or contamination. Second, the open reservoir 110 can cause the formation of a meniscus 120 on the magnetic capture filter membrane, which can allow air to enter the middle of the reservoir area before the fluid in the meniscus 120 (around the edges of the reservoir) is pulled through, and requires a larger sample volume. Third, the open reservoir 110 can have a higher run-to-run variability, which may require manual intervention during operation. Fourth, membrane damage (e.g., flaking of the metal) and clogging of the system during the lysis step can reduce the efficacy of the open system 100.

[057] The use of a closed system 200 can overcome the above potential deficiencies of the open system 100. The closed system 200 can comprise an inlet port 210, fed by a reservoir 230 (e.g., syringe can be used as the reservoir, as shown in FIG. 2B), and two outlet ports 220. The top of the magnetic capture zone can be fed by a fluidic manifold similar to the design used on the bottom of the membranes. The protocol can be automated such that the reservoir 230 is not allowed to run empty, thereby preventing air from entering the system. The closed system 200 can also allow compatibility with automation, improving reliability and/or reproducibility. Accordingly, the meniscus can be limited to a smaller reservoir that is not allowed to run dry. The use of a smaller surface area and a taller column or a cap with a one-way valve can reduce rate of evaporation.

[058] Further, switching from the open system 100 to a closed system 200 can eliminate the membrane damage and/or clogging during the lysis step. As shown in FIG. 3A, the open system sustained membrane damage during lysis, which can be caused by oxidation and/or NiFe exposure through gold passivation layer. Such membrane damage of the open system can cause oxidation and/or pore damage that can clog the device. Also, membrane damage can be caused by oxidation and/or NiFe exposure through gold passivation layer. In contrast, the closed system in FIG. 3B survived the lysis step without membrane damage, potentially due to oxygen exclusion and/or improved membrane integrity. Accordingly, the closed system can provide optimized lysis and/or increased yield, and thus simplifying the purification steps (e.g., for miRNA purification).

[059] In another aspect, the magnetic separation device can have an improved fluid interface. The open system 100 included a punched polydimethylsiloxane (PDMS) outlet port 130 that required PDMS casting, punching, and plasma bonding, which can increase the difficulty/complexity of the manufacturing process. The closed system 200 can comprise injection-molded inlet port 210 and outlet ports 220 (e.g., poly(methyl methacrylate) (PMMA) Luer lock ports) and/or the same adhesive (3M 444 adhesive) that is in the laminated structure of the chip. The closed system can also improve reproducibility. A detailed material and assembly breakdown of the closed system magnetic separation device 200 can be found in FIG. 4, including an inlet port 210, two outlet ports 220, port adhesive 410, inlet cover 420, inlet distribution channels 430, inlet distribution ports 440, coated membranes 450, membrane separators 460, outlet collection ports 470, outlet collection channels 480, and outlet cover 490. [060] The magnetic separation device can be manufactured by raster printing a polymer sheet carrier with low-tack adhesive using a non-adhesive pattern to reduce bonding strength and/or prevent tearing of the membrane when it is removed later in the process. Track etched membrane rolls (e.g., Cytiva Nuclepore) can be laminated onto the carrier, and the assembly cut into squares, and mounted to a fixture for magnetron sputtering of nickel-iron alloy followed by a gold passivation layer. After metal coating, a circular kiss-cut die cutter can cut through the membrane portion of the laminate, and the waste membrane can be removed. Layers of the chip can be held in place using a vacuum plated alignment system for assembly.

[061] The magnetic separation filter membrane can be manufactured, for example, coated with magnetic material and subsequently assembled into a laminated device, in a roll format or disc format. In some cases, the magnetic device manufactured with a roll format can be advantageous in comparison to the disk format, because it can enable the assembly of multiple (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, or 10) chips simultaneously and/or it can be compatible with roll-to-roll processes for further scaling of the manufacturing process.

[062] Membranes of the high-throughput TENPO in a roll format can be processed and mounted into a fixture. Membranes can be cut into rectangular sections to cover the bottom of a 96-well plate. A 96-well plate can be prepared with a hole protruding through the bottom of each well. Metal coated membranes and double-sided adhesives can be stacked to create independent capture regions for each well. After the capture region, fluidic channels composed of doublesided adhesives and plastic sheets can connect the outlet of each capture region to a common two fluidic ports (“outlet 1” and “outlet 2”).

[063] Moreover, the manufacturing process can be adapted to produce a multiplexed version of the magnetic device, which can be used to process multiple samples simultaneously, i.e., can handle more than one pulldown on more than one sample at a time. This could be used in conjunction with established high-throughput clinical lab infrastructure in a variety of ways. For example, the multiplexed version of the magnetic device can process multiple patient samples with established targeted assays such as pancreatic cancer, traumatic brain injury, or lung cancer. In another example, the multiplexed version of the magnetic device can isolate extracellular vesicles (EVs) originating from multiple organs from a single patient blood sample (e.g., multiorgan scan). The improved manufacturing process can decrease the footprint of the device, add alignment features, and make layer size uniform to improve manufacturability. For example, the multiplexed version can provide multi-well compatibility.

[064] The magnetic separation device (e.g., TENPO) can be manufactured to enable an automated sample analysis workflow. The high-throughput TENPO device can be used in a multi-step process: 1) magnetic labeling: samples can be incubated with antibodies and/or magnetic nanoparticles to magnetically tag biological objects of interest (e.g., extracellular vesicle or EV); 2) magnetically tagged samples can run through the multiplexed TENPO device by extracting from “outlet 1”, while a magnetic field is applied to the device. Targeted biological objects (e.g., EV subpopulations) can be captured in each well and rinsed as needed; 3) buffer can be added to “outlet 2” and extracted from “outlet 1”, clearing the outlet channels of any remaining sample; 4) lysis reagent can be added to “outlet 2” and extracted from “outlet 1”, loading the outlet channel network with lysis reagent; 5) backpressure can be applied to both “outlet 1” and “outlet 2”, causing lysis reagent flow back into each capture reagent, and causing captured EVs to lyse and the contents of each well’s capture region to backflow into the well into which the sample was added; 6) lysate can be removed from each individual well and analyzed.

NUMBERED EMBODIMENTS OF THE INVENTION

[065] Notwithstanding the appended claims, the disclosure sets forth the following numbered embodiments:

Embodiment E A magnetic separation device, comprising a magnetic separation filter encapsulated in an enclosed laminated structure, wherein the magnetic separation filter comprises a layer of magnetically soft material having a plurality of pores.

Embodiment 2. The magnetic separation device of embodiment 1, wherein the magnetically soft material comprises a nickel-iron alloy.

Embodiment 3. The magnetic separation device of embodiment 1 or 2, wherein the magnetically soft material comprises Ni2oFeso.

Embodiment 4. The magnetic separation device of any one of embodiments 1-3, further comprising a passivation layer adjacent the layer of magnetically soft material.

Embodiment 5. The magnetic separation device of embodiment 4, wherein the passivation layer comprises nickel or gold.

Embodiment 6. The magnetic separation device of any one of embodiments 1-5, comprising two or more magnetic separation filters. Embodiment 7. The magnetic separation device of embodiment 6, wherein the two or more magnetic separation filters are stacked together in the magnetic separation device.

Embodiment 8. The magnetic separation device of any one of embodiments 1-7, wherein the enclosed laminated structure is connected to a reservoir via one or more inlet ports.

Embodiment 9. The magnetic separation device of embodiment 8, wherein the reservoir is configured to receive a suspension comprising a biological sample.

Embodiment 10. The magnetic separation device of embodiment 8 or 9, wherein the reservoir is a syringe or microwell plate.

Embodiment 11. The magnetic separation device of embodiment 10, wherein the reservoir is a 6, 12, 24, 48, 96, 384, or 1536 microwell plate.

Embodiment 12. The magnetic separation device of embodiment 10 or 11, wherein each well in the microwell plate is connected to the magnetic separation filter.

Embodiment 13. The magnetic separation device of any one of embodiments 1-12, wherein the enclosed laminated structure is configured to prevent exposure of the magnetic separation filter to air when the inlet and outlet ports are closed.

Embodiment 14. The magnetic separation device of any one of embodiments 1-13, wherein the enclosed laminated structure is configured to prevent formation of a meniscus on the magnetic separation filter.

Embodiment 15. The magnetic separation device of any one of embodiments 1-14, wherein the enclosed laminated structure is configured to prevent oxidation of the magnetically soft material.

Embodiment 16. The magnetic separation device of any one of embodiments 1-15, further comprising one or more inlet and outlet ports.

Embodiment 17. The magnetic separation device of embodiment 16, wherein the one or more inlet and outlet ports are injection molded ports.

Embodiment 18. The magnetic separation device of embodiment 16 or 17, wherein the one or more inlet and outlet ports are poly(m ethyl methacrylate) injection molded Luer lock ports.

Embodiment 19. A method for making the magnetic separation device of any one of embodiments 1-18, comprising laminating a membrane roll onto a carrier substrate to form the magnetic separation filter encapsulated in the enclosed laminated structure, and wherein the magnetic separation filter comprises the layer of magnetically soft material having the plurality of pores.

Embodiment 20. A method of making a magnetic separation device, comprising laminating a membrane roll onto a carrier substrate to form a magnetic separation filter encapsulated in an enclosed laminated membrane structure, and wherein said magnetic separation filter comprises a layer of magnetically soft material having a plurality of pores.

Embodiment 21. The method of embodiment 19 or 20, wherein the membrane roll is a track etched membrane roll.

Embodiment 22. The method of any one of embodiments 19-21, further comprising magnetron sputtering of the magnetically soft material.

Embodiment 23. A method for using the magnetic separation device of any one of embodiments 1-18, comprising: a) exposing the magnetic separation device to an external magnetic field; b) flowing a suspension comprising the magnetically tagged particles through an inlet port of the magnetic separation device; and c) capturing the magnetically tagged particles in the magnetic separation device.

Embodiment 24. A method for using a magnetic separation device, comprising: a) exposing the magnetic separation device to an external magnetic field, wherein the magnetic separation device comprises a magnetic separation filter encapsulated in an enclosed laminated structure, wherein the magnetic separation filter comprises a layer of magnetically soft material having a plurality of pores; b) flowing a suspension comprising a magnetically tagged particles through an inlet port of the magnetic separation device; and c) capturing the magnetically tagged particles in the magnetic separation device.

Embodiment 25. The method of embodiment 23 or 24, further comprising flowing a lysis reagent to the magnetic separation device, thereby contacting the captured magnetically tagged particles and releasing contents of the captured magnetically tagged particles.

Embodiment 26. The method of any one of embodiments 23-25, further comprising removing the external magnetic field, thereby releasing the captured magnetically tagged particles.

Embodiment 27. The method of any one of embodiments 23-26, wherein the magnetically tagged particles comprises microorganisms, extracellular vesicles, cell-free DNAs or a combination thereof.

Embodiment 28. The method of embodiment 27, wherein the microorganisms are selected from the group consisting of bacteria, viruses, or cells.

Embodiment 29. The method of embodiment 28, wherein the cells comprise circulating tumor cells (CTCs).

Embodiment 30. The method of embodiment 27, wherein the extracellular vesicles are selected from the group consisting of ectosomes, microvesicles, microparticles, exosomes, oncosomes, apoptotic bodies, exomeres, and bacterial outer membrane vesicles (OMVs). Embodiment 31. The method of any one of embodiments 25-30, wherein the contents of the captured magnetically tagged particles are selected from the group consisting of proteins, nucleic acids, lipids, metabolites, and organelles.

EXAMPLES

Example 1 - Magnetic Exosome Isolation for Prognosis of Pancreatic Cancer

[066] Early detection of cancers can significantly reduce mortality. Pancreatic cancer is the fourth most common cause of cancer related death in the United States, with a five year survival rate of only 8%. Because pancreatic tumor cells are localized in difficult to access parts of the body, molecular measurements currently rely on invasive procedures (i.e., biopsy) which severely limit their practical diagnostic use. Nano-scale vesicles that originate from tumor/injured cells and which can be found circulating in the blood (e.g., exosomes) have been discovered to contain a wealth of proteomic and genetic information to monitor cancer progression, metastasis, and drug efficacy.

[067] However, the use of exosomes as biomarkers to improve patient care has been limited by fundamental technical challenges that stem from extreme scarcity and the small size of tumor- derived exosomes (30 nm-200 nm) and the extensive sample preparation (>24 hr) required prior to measurement.

[068] To address these challenges, exosomes were detected using a TEMPO filters in accordance with embodiments of the present invention, which combined the benefits of nanoscale sorting with extremely fast flow rates (<1 hr assay time). The unbiased exosome detection achieved >5x yield compared to the conventional technique (ultracentrifugation). Using linear discriminant analysis (LDA), different groups of mice were classified (cancer vs. healthy). And more importantly, it was possible to distinguish pre-cancer mice from healthy mice.

[069] Serum was magnetically labeled with anti-biotin magnetic nanoparticles and isolated using a TEMPO filter according to an embodiment of the present invention. The RNA was extracted from the exosomes and amplified using qPCR. The cells and exosomes were positively correlated and it was possible to distinguish pre-cancer mice from healthy mice.

[070] Characterization and Validation of Exosome Isolation Using ExoTENPO

[071] Next, the capability of our chip to isolate exosomes was tested using exosomes derived from a human pancreatic cancer cell line. Exosomes were labeled in media from MiaPaCa2 cells with 50 nm iron oxide magnetic nanoparticles (Miltenyi Biotec) using a cocktail of the pan- exosome markers, CD81, CD9, and CD63. A two-step magnetic labeling process was used, wherein the exosomes were first incubated with the cocktail of biotinylated antibodies and subsequently incubated with anti-biotin MNPs. All testing was carried out at a volumetric flow rate of =10 mL/hr. To validate that the ExoTENPO filter was capturing exosomes, the input and the output using dynamic light scattering (DLS) was measured. In the unprocessed cell culture media there was a distinct peak at d= 50.7 nm, consistent with the size of exosomes and a larger population of smaller particles d = 10.1 nm that were likely debris. The exosomes captured by the device were analyzed by eluting the exosomes captured on the ExoTENPO for off-chip analysis. Measuring this elution using DLS, it was found that the majority of particles (90% purity) captured by the chip were d= 105.7 nm, consistent with that of exosomes. Moreover, the exosomes were also fixed directly on the ExoTENPO nanopores after capture, and imaged using scanning electron microscopy (SEM) (University of Pennsylvania School of Medicine, Electron Microscopy Resource Laboratory). Objects were observed with a morphology consistent with exosomes.

[072] Clinical Diagnostic of Pancreatic Cancer with ExoTENPO

[073] To evaluate the ExoTENPO's capability to diagnose pancreatic cancer in clinical specimens, the performance of the chip isolating exosomes from human blood samples was characterized. The recovery of exosomal RNA and DNA using the ExoTENPO in healthy human plasma samples, using pan exosome isolation (CD63, CD9, CD81) was first compared to a conventional ultracentrifugal method (Total Exosome Isolation Kit, Life Technologies) and found a 1.6x improvement in recovery. To optimize the ExoTENPO for practical clinical use, the recovery of exosomal RNA was compared in a variety of common clinical sample types, including fresh plasma, fresh serum, frozen plasma, and frozen serum using pan exosome isolation. It was found that there was not a significant difference in the RNA recovery from the various sample types. Next, pairwise comparisons of the relative abundance of mRNA targets (CK18, CD63, Erbb3, KRAS) was performed and it was found that similar exosomal RNA cargo profiles (R ² > 0.77) were obtained from the different sample preparations. Thus, it was concluded that the ExoTENPO platform can be used on any of these available sample types and provide comparable information. To identify the affinity ligand to use for the clinical measurements, the ability to specifically isolate tumor derived exosomes from serum using pan exosome isolation versus cancer epitopes was compared. A model system, which consisted of 12 ml of media from a cultured pancreatic cancer cell line (BxPC3) spiked into 3 ml of healthy human plasma was used. From this model system exosomes were isolated using a cocktail of pan exosome markers (CD63, CD9, CD81) as well as a tumor-specific markers, including EpCAM and Intpi.

Compared to pan exosome marker based capture, positive capture using EpCAM showed the greatest mRNA expression level difference a = Ct, spiked -Ct, healthy between cancer exosome spiked plasma Ct, spiked and healthy plasma Ct, healthy.

[074] To explore the performance of the ExoTENPO for cancer diagnostics in patient-derived specimens, a study was conducted on a cohort of patients (7* =10) with advanced pancreatic cancer. As a negative control, A=12 age matched healthy patients were included. The exosomal mRNA signature of patients that were healthy and patients that had cancer were measured, and from these measurements a predictive panel of exosome-based biomarkers for pancreatic cancer was developed and tested using an independent, user blinded cohort of patients. The same panel of 9 candidate exosomal mRNA biomarkers identified using our mouse measurements was used. Exosomes were isolated from approximately 3 mL of plasma from each patient using EpCAM based isolation on the ExoTENPO. The exosomal mRNA profile was measured from a training set of N=5 healthy controls and N=5 patients with cancer. Amongst the panel of mRNA that were measured, several genes were differentially expressed between the groups (e.g., CD63). No single gene was able to classify individual patients into the correct groups due to the variance in expression amongst patients within groups. Therefore, using the training set data, LDA vectors (LDA healthy, LDA cancer) were generated that maximally separated the patients into the correct group. The diagnostic ability of this approach was first evaluated using N-l cross- validation, and every patient was classified into the correct group. To further validate this approach, an independent, operator-blinded test set was created that included plasma samples from A=7 healthy controls and N=5 patients with cancer, and every patient was classified correctly.

[075] Example 2 - Traumatic Brain Injury Diagnostics Using ExoTENPO

[076] Traumatic brain injury (TBI) occurs in approximately 2.5 million people each year. Although it is a very common worldwide incident, the lack of molecular marker based diagnostic tools complicates clinical decision for monitoring and treatment of patients. An accurate assessment of the incident is crucial especially when the TBI patients sustain a secondary injury that can lead to a long-term physical, emotional, and behavioral disability. For diagnostics, imaging technologies such as computerized tomography (CT) scans and magnetic resonance imaging (MRI) can be used for severe TBI, but mild TBI (mTBI) diagnostics, which comprise of 70-90% of the TBI cases, are currently limited to patient reports and clinical symptoms, which do not provide an objective assessment.

[077] Therefore, there is a great need for molecular biomarkers that can help guide monitoring and treatment of mTBI patients. There have been studies on biomarker discovery for mTBI, but the approach is mostly hypothesis-driven, screening for TBI pathophysiology associated biofluid markers. Exosomes have gained a great attention as a potential biomarker for liquid biopsy. As exosomes are circulating nano vesicles (30-200 nm) that have molecular information (mRNA, miRNA, DNA, and protein) of their mother cells, an open-ended approach is possible. For example, the list of proteins and nucleic acids can be obtained using mass spectrometry and sequencing technologies. This enables an unbiased biomarker discovery for multiple diseases. Conventionally, exosomes are isolated using a bulky ultracentrifuge, which causes high loss, low purity, and long assay time. Due to these limitations, downstream analysis of exosomes is not practical and extremely difficult to achieve a reliable, meaningful result. To address these challenges, small RNA sequencing on exosomes isolated using an ExoTENPO chip according to an embodiment of the present disclosure. The ExoTENPO chip achieved >5x yield, high purity (90%), and extremely rapid (>10 ml/hr) assay time. This experiment focused on discovering brain-derived exosomal miRNAs that were differentially expressed after mTBI using blast- induced injured mice. The ExoTENPO chip was used to isolate exosomes based on their glutamate receptor 1/2 (GluRl/2) expression to profile brain-derived exosomes. It was discovered that exosomal miRNAs were differentially expressed after mTBI. A subset of these exosomal miRNAs were used to diagnose mTBI mice, achieving 100% sensitivity and 100% specificity.

[078] Brain-derived exosomes were first isolated using an ExoTENPO chip having a pore diameter d=600 nm. Exosomes of interest were magnetically labeled using biotinylated antibody and anti-biotin magnetic microbead complex. As shown in the finite element simulation magnetic field plot, the edge of the pores had the strongest magnetic field gradient, where the exosomes are attracted and captured. To prove that exosomes were captured based on their sizes, cortical neuron cultured media (input) was run through the chip and the eluted sample (isolate) was measured using dynamic light scattering (DLS). The input showed a major peak at 8.72 nm, which was considered to be small debris. The isolate from the ExoTENPO chip showed a major peak at 141.8 nm, which was in the range of exosome size (30-200 nm). Scanning electron microscopy (SEM) was also performed in order to show that exosomes were captured at the edge of the pores of the chip. It was observed that 150-200 nm exosomes were captured at the edge of the pores. After validation of exosome capture using cell cultured media, mouse plasma was used for biomarker discovery. First, mouse plasma was run through the ExoTENPO chip. The chip allowed for specific enrichment of brain-derived exosomes by targeting the exosomes using an anti-glutamate receptor 1/2 (GluR2) antibody (biotin). The biotinylated antibody was incubated with anti-biotin microbeads, which were magnetic iron oxide nanoparticles. As the plasma flowed through the chip, the labeled brain-derived exosomes were captured on edge of the pores of the chip. After exosome capture, the total exosomal RNA was isolated by lysing on the chip. Then, a small RNA library prep set (BioLabs) was used for RNA sequencing. Using the prepared samples, an RNA sequencer (Illumina) was run and the RNA sequencing data was evaluated using quantitative polymerase chain reaction (qPCR).

[079] RNA sequencing data showed that 565 miRNAs were expressed by brain-derived exosomes from mice. Exosomal miRNAs were sequenced from two groups, control and injured mice. Healthy mice without injury were used as a control, and blast-induced injury was performed to mimic mTBI.

[080] Among 565 express miRNAs, there were 128 miRNAs that had raw counts more than 50. As expected, there were some miRNAs that were differentially expressed from the two groups and some that were similar to each other. The composition of brain-derived exosomal miRNAs expressed by control mice and those expressed by injured mice was also observed. The top 3 most abundant miRNAs were the same (miR-486b-5p, miR-486a-5p, let-7i-5p) between two the groups.

However, brain-derived exosomes from injured mice showed a greater percentage for miR- 486a/b-5p while let-7i-5p was not that different. Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis was performed to find a statistically significant pathways that are related to brain. Here, 8 different pathways were found with related miRNAs and their target genes, including Axon guidance, long-term potentiation, glutamatergic synapse, oxytocin signaling pathway, GABAergic synapse, dopaminergic synapse, neurotrophin signaling pathway, and cholinergic synapse.

[081] The raw read counts from both control and injured groups were normalized using DESeq. Then, the ratio of injured to control DESeq normalized values was observed. For biomarker selection, top 10 upregulated and downregulated brain-derived exosomal miRNAs that had more than 50 raw read counts were examined. From the list, 2 upregulated miRNAs (miR-129-5p, miR-9-5p) and 2 downregulated miRNAs (miR-374b-5p, miR-664-3p) were selected to validate using qPCR. miR-212-5p was chosen as a potential to be a reference due to similar DESeq normalized values from both control and injured groups. miR-21a-5p was chosen as the last marker based on the findings that showed it alleviates secondary blood-brain barrier damage after TBI and apoptosis of cortical neurons. Using qPCR, expression level of individual miRNA markers was obtained. There was a positive correlation between the expression level from qPCR and the normalized read count from RNA sequencing, with some variance. Then, heat maps were generated to observe a pattern for the expression level of the selected miRNA panel from different groups (injured, control). The patterns were different, but there were no miRNAs that were upregulated or downregulated in each individual mouse from one group. [082] mTBI diagnosis was performed on mice using the panel of miRNA markers that were validated using qPCR. Using the whole panel of miRNA markers, we were able to achieve 100% sensitivity and 100% specificity. In order to analyze the pattern for diagnosis, linear discriminant analysis (LDA) was used.

[083] NEBNext Small RNA Library Prep Set for Illumina (BioLabs) was used to make a library. RNA was isolated on chip using Total Exosomal RNA Isolation Kit (Life Technologies). [084] Then, the RNA amount was measured using Qubit (Life Technologies) and as recommended by the protocol, the samples with more than 100 ng of RNA were selected for usage. Then, quality control check was performed on a BioAnalyzer using a DNA 1000 chip. For size selection, AMPure XP beads were used (Beckman Coulter). 140-150 bp sizes were selected using the beads and the sizes were confirmed by the BioAnalyzer using High Sensitivity Chip. A NextSeq 500/550 kit (FC-404-2005, Illumina) was used for RNA sequencing.

[085] Sample Collection (Mice)

[086] All mouse work was performed in compliance with institutional and IACUC guidelines. Blood was obtained by cardiac puncture from the right ventricle of tumor-bearing KPCY mice and collected in sodium citrate coated blood collection tubes (BD Vacutainer™). Plasma was isolated by centrifuging the blood at 1600g for 10 min, followed by a second spin at 3000g for 10 min to remove cellular contamination.

[087] Sample Collection (Human)

[088] Peripheral whole blood was obtained from PDA patients with advanced pancreatic cancer and from healthy age- and gender-matched controls at the University of Pennsylvania Health System. All patients and healthy donors provided written informed consent for blood donation on approved institutional protocols. Whole blood was drawn in either EDTA (Fisher Scientific), Streck Cell-Free DNA BCT® (Streck), or gel serum separation tubes (Fisher Scientific). Plasma and serum were isolated using the following procedures. Within 3 hours of blood draw for EDTA and within 12 hours of blood draw for Streck, tubes were centrifuged at 1600g for 10 minutes at room temperature with the break off. Next, plasma was transferred to a fresh 15 ml centrifuge tube without disturbing the cellular layer and centrifuged at 3000g for 10 minutes (EDTA) or 4122g for 15 minutes (Streck) at room temperature with the break off; this step was repeated with a fresh 15 ml centrifuge tube. After the third spin, plasma was transferred to a fresh 15 ml centrifuge tube, gently mixed, and transferred in 1 ml aliquots to centrifuge tubes and either processed fresh for exosomal RNA or stored immediately at -80°C for future use. Gel serum separation tubes were stored at room temperature for 30 minutes after blood draw. Within 2 hours of blood draw, serum tubes were centrifuged at 1000 g for 15 minutes at room temperature. Last, serum was transferred in 1 ml aliquots to cryovials and either processed fresh for exosomal RNA or stored immediately at -80°C for future use.

[089] Cell Culture

[090] Mouse cell lines PD7591, PD483, PD6910 were generated from pancreatic tumor tissue isolated from Pdxl-cre, Kras ^LSL ' ^G12D , p53 ^L/+ , Rosa ^YFP/YFP (KPCY) mice (Rhim et al Cell 2012). They were cultured in pancreatic ductal epithelium media as previously described (Schreiber, F. S. et al. Successful growth and characterization of mouse pancreatic ductal cells: functional properties of the Ki-RASG12V oncogene). All human cell lines were cultured in media recommended by ATCC.

[091] Exosome Isolation (Kit)

[092] Supernatant fractions from confluent cell cultures (48-72 h) were collected and centrifuged at 1500 rpm for 5 minutes to remove dead cells and debris. Total exosome isolation reagents (from serum, plasma, cell culture media) from Life Technologies were used. The protocol was followed as suggested by the company. Isolated exosomes were stored at 4 C for a short term storage or immediately processed for further analysis.

[093] Exosome Isolation (ExoTENPO)

[094] Anti-biotin ultrapure microbeads (Miltenyi Biotec) and biotinylated antibodies were used for magnetic labeling. For mouse, biotin anti-CD9 antibody (BioLegend) and biotin anti-CD81 antibody (BioLegend) were used. For human, biotin anti-human CD9 antibody (eBioscience), biotin anti-human CD63 antibody (BioLegend), and biotin anti-CD81 antibody (custom made from BioLegend) were used. First, biotinylated antibodies were added to the sample and incubated for 20 mins at room temperature with shaking. Then, anti-biotin ultra pure microbes were added to the samples and incubated for 20 mins at room temperature with shaking. Then the samples were added to the reservoir of the ExoTENPO chip and negative pressure was applied by a programmable syringe pump (Braintree). As the samples were pulled through the chip, magnetically labeled exosomes were captured at the edge of the pores of the chip.

[095] Exosomal RNA Isolation

[096] Total exosome RNA & protein isolation kit (Life Technologies) was used for RNA extraction from isolated exosomes. For the exosomes captured on chip, denaturing solution was added to the chip and the chip was incubated for 5 mins on ice. Then, the lysed solution was taken off chip for acid-phenol separation and washing steps using a spin column. The exosomal RNA was eluted in a small volume (~30 pl) and it was stored at -80C or processed immediately for further analysis.

[097] Exosomal DNA Isolation [098] Exosomal DNA was isolated using QUIAamp DNA mini kit (Qiagen). Lysis buffer was directly added on chip and the chip was incubated at 56 C for 10 mins. Then, the lysed solution was taken off chip for the rest of the steps. The exosomal DNA was eluted in a small volume (~30 pl) and it was stored at -20C or -80C until usage.

[099] Polymerase Chain Reaction (PCR)

[100] RT-PCR was first performed using exosomal RNA. PrimeScript RT Reagent Kit (Clontech) was used for RT-PCR. Using the kit, the exosomal RNA was mixed with reagents and the sample was in a T100 Thermal Cycler (Bio Rad) followed by the company's protocol.

[101] qPCR

[102] Master mix that consists of SsoAdvanced Universal SYBR Green Supermix (Bio Rad), primers (Integrated DNA Technologies), and water were made at 5:0.5:3.5 ratio and 9 pl of the master mix was added to each well, followed by 1 pl of cDNA. 40 cycles were run with a default setting using CFX384 Touch Real-Time PCR machine (Bio Rad). Triplicates were done for each sample. The melting curves were first checked before the analysis.

[103] Trp53 PCR

[104] The following primers were used to detect the recombined Trp53 allele in exosomal DNA isolated from KPCY mice (F: 5' CACAAAAACAGGTTAAACCCAG 3' R: 5' GAAGACAGAAAAGGGGAGGG 3'). The expected band for the recombined allele is 612 bp.

[105] Linear Discriminant Analysis (LDA)

[106] Using Matlab (R2015b), multiple features (genes) from multiple groups (healthy, PanIN, tumor) were simplified for classification using LDA. The confusion matrix and the LDA plot were made using results from Matlab. Cross validation (N-l) method was used for data analysis.

[107] NMR Relaxometry

[108] 200 nm microbeads (Chemicell) were used to test the enrichment of the chip. Input was made and it was serially diluted to generate a standard curve (T2 relaxation time vs. bead concentration). Then, the input was run through the chip and flow through solution was collected as an output. All the samples were measured using the minispec (Bruker) for T2 relaxation time.

[109] Dynamic Light Scattering (DLS)

[HO] In order to get the size distribution of the samples, we used DLS (Zetasizer, Malvern). 300-400 pl of samples was loaded each time.

[Hl] RNA and DNA Measurement

[112] The size of the exosomal RNA and DNA was measured using a BioAnalyzer. Exosomal RNA was measured in BioAnalyzer using the Agilent RNA Pico chip at the NAPCore Facility at the Children's Hospital of Philadelphia. Exosomal DNA was measured in BioAnalyzer using the Agilent High Sensitivity DNA chip at the same facility. The amount and concentration of the exosomal RNA and DNA were measured using the Qubit RNA HS Assay Kit (Thermo Fisher Scientific) and the Qubit ddDNA Assay kit (Thermo Fisher Scientific) respectively.

[113] MagNET Filter

[114] Immunomagnetic sorting is a technique to selectively isolate rare magnetically-tagged cells from heterogeneous suspensions— yet current devices fail to provide high enrichment (Q for clinically relevant volumes (>30 mL) and turnaround times (<30 min). Rare cells, such as circulating tumor cells (CTCs), are present in concentrations of 1 - 10 ² in 10 mL of blood, requiring large samples of blood to be processed with high specificity to isolate these cells from the background of 10 ⁵ leukocytes, IO ¹⁰ red blood cells, etc.

[115] To enable high-throughput immunomagnetic sorting, a microfluidic chip with a lithography -based electroformed filter was made to capture magnetically labelled targets at high flow rates (O = 150 ml/h) and enrich pancreatic cancer cells (YFP-7591) >10 ³ times. The filter was fabricated by electroplating permalloy (Ni2oFeso) onto a copper substrate patterned with an array of 15 pm tall, 30 pm diameter photoresist pillars (SPR220-7.0). Once the permalloy was plated to a thickness of 15 pm, the durable film was mechanically peeled from the mold to obtain a metal filter with 30 pm pores. In the presence of an applied magnetic field, the edge of the pore creates a strong magnetic trap to capture magnetically tagged targets. Copper molds can be replated multiple times, and filters can be reused without performance loss— offering a cost- effective fabrication strategy. Unlike conventional filter fabrication methods, lithography allows higher pore density without overlap, design of traps in any shape, and filters with area >25 cm ² . Vertical fluid flow through the porous filter can process 30 mL of blood in 20 min with high capture rate on a compact chip— offering a key breakthrough to enable immunomagnetic sorting to be applied for rare cell detection in clinical diagnoses. The MagNET filters were also reusable.