Biopesticides Field The present invention relates to biopesticides and their use in crop protection. Background Burkholderia is a phylogenetically diverse genus of Gram-negative bacteria that thrive in a variety of environments, ranging from the rhizosphere to the cystic fibrosis lung (Eberl and Vandamme 2016). Certain Burkholderia species such Burkholderia glumae are plant pathogens causing rot of rice grains (Jeong et al., 2003), while others like Burkholderia ambifaria form beneficial interactions with their plant hosts and protect them from fungal and bacterial pathogens (Mullins et al., 2019). Members of the Burkholderia cepacia complex (Bcc) found in the rhizosphere of wheat, maize and legumes have been shown to be useful as biocontrol agents, protecting the crops from damping-off disease caused by fungal pathogens including Pythium and Fusarium species (Bowers & Parke, 1993; Mao et al., 1998). A key component of Burkholderia’s biocontrol properties is the presence of biosynthetic gene clusters (BGC) encoding the production of diverse antimicrobial specialised metabolites, including alkaloids, polyenes, polyynes, macrolides, terpenes and quinolone derivatives (Masschelein et al., 2017; Kunakom & Eustaquio, 2019). Recently, by using comparative genomic approaches, the BGC encoding cepacin was identified, and demonstrated to be a key mediator in B. ambifaria supressing damping-off disease caused by the oomycete Globisporangium (formerly Pythium) ultimum in Pisum sativum (Mullins et al., 2019). Cepacin was first isolated from “Pseudomonas cepacia” (now known to be a strain of the species Burkholderia diffusa) and was shown to have good activity against Staphylococcus aureus but minimal activity against Gram-negative organisms (Parker et al., 1984). Cepacin belongs to a group of compounds called polyynes, characterised by alternating single and triple carbon-carbon bonds. From bioinformatics analysis, the core B. ambifaria cepacin BGC is approximately 13 kb and consists of 13 biosynthetic genes organised in a single operon with luxRI regulatory genes located upstream (Mullins et al., 2019). Another characterised Burkholderia polyyne is caryoynencin, first discovered in Burkholderia caryophylli (Kusumi et al., 1987) and further characterised in Burkholderia gladioli (Ross et al., 2014). Caryoynencin has activity against Gram- positive and Gram-negative bacteria (Kusumi et al., 1987), and fungi (Florez et al., 2017). Fungal and bacterial plant pathogens lead to major crop and economic losses and there is an urgent need to develop new pesticides for use in agriculture (Savary et al., 2012). Cepacin and caryoynencin are potent antimicrobial molecules but are unstable and challenging to purify (Ross et al., 2014; Mullins et al., 2019; Mullins et al., 2021), making them difficult for a development into a direct- application commercial product. However, a proven way to harvest the beneficial properties of polyynes and other bioactive metabolites associated with beneficial BGCs has been to employ the producer strains directly as crop seed coats, enabling them to act as biopesticides (Mullins et al., 2019). Products containing live Burkholderia spp. were registered with the US Environmental Protection Agency (EPA) under the trade names Deny®, Blue Circle®, Intercept® (Parke & Gurian- Sherman, 2001). However, concerns over the opportunistic pathogenicity of the Bcc species in CF and immunocompromised patients, coupled with an inability to distinguish between pathogenic and environmental strains, led to US Environmental Protection Agency (EPA) placing a moratorium on Burkholderia-based biopesticides (Parke & Gurian-Sherman, 2001). Consequently, given the concerns about safety (Parke & Gurian Sherman, 2001), the exploitation of Burkholderia as biocontrol agents has been limited in the last 20 years (Mullins et al.2019). Summary The present inventors have recognised that safe and effective biopesticides for use on plants may be generated by expressing complex Burkholderia biosynthetic gene clusters for antimicrobial compounds in Paraburkholderia spp. The present inventors have further recognised that such modified Paraburkholderia spp. provide an additional benefit of improving plant growth, especially root growth. Furthermore, the inventors have found that some Paraburkholderia spp. are able to endophytically colonise the roots of plants, whilst providing the pesticidal effects and/or promotion of growth to the plant. Therefore the effects of the modified Paraburkholderia spp. are provided internally and directly to the plant. A first aspect of the invention provides a Paraburkholderia cell that produces or biosynthesises at least one heterologous antimicrobial compound. In a further aspect there is provided a population of Paraburkholderia cells that produces or biosynthesises at least one heterologous antimicrobial compound. The heterologous antimicrobial compound may be a compound biosynthesised or produced by a Burkholderia spp. The Paraburkholderia cell may contain or be transformed with a heterologous nucleic acid which comprises a plurality of nucleotide sequences each of which encodes a polypeptide which in combination have the activity of producing or biosynthesising the antimicrobial compound. The expression of the heterologous nucleic acid may impart on the Paraburkholderia cell the ability to carry out the biosynthesis of the antimicrobial compound. In one embodiment therefore, the cell is a modified Paraburkholderia cell. Preferably, the Paraburkholderia cell comprises a heterologous biosynthetic gene cluster (BGC) for the antimicrobial compound, suitably for synthesising the antimicrobial compound. For example, the Paraburkholderia cell may comprise a Burkholderia biosynthetic gene cluster (BGC) for the antimicrobial compound, suitably for synthesising the antimicrobial compound. Suitably therefore the BGC is derived from a Burkholderia species. The Paraburkholderia cell may have improved growth at 30 ^o C relative to 37 ^o C. For example, Paraburkholderia cells may grow at 30 ^o C and display little growth or no growth at 37 ^o C. A second aspect of the invention provides a biopesticide composition comprising a Paraburkholderia cell according to the first aspect and a horticulturally acceptable excipient. In some embodiments, the Paraburkholderia cell may colonise plants, suitable endophytically. Suitably therefore the Paraburkholderia cell may be an endophyte. Suitably the Paraburkholderia cell is capable of endophytic root colonisation. Suitably therefore the Paraburkholderia cell may be a root endophyte. Suitably as a means of protection against pests. Suitable Paraburkholderia strains which are capable of endophytic colonisation, and which may be regarded as endophytes, may be selected from: P. phytofirmans PsJN, P. bannensis BCC1915, P. tropica BCC1950 and Paraburkholderia BCC1909. In some embodiments, therefore, there is provided a biopesticide composition comprising a Paraburkholderia cell according to the first aspect, wherein the Paraburkholderia cell is an endophyte, suitably which is capable of colonising plants endophytically, suitably roots, and a horticulturally acceptable excipient. In some embodiments, therefore, there is provided an endophytic biopesticide composition comprising a Paraburkholderia cell according to the first aspect, suitably wherein the cell is an endophyte, and a horticulturally acceptable excipient. Suitably wherein the Paraburkholderia cell is capable of colonising plants endophytically, suitably colonising plant roots endophytically. As is further described herein, the Paraburkholderia cells of the first aspect not only act as biopesticides but also promote plant growth. Suitably the Paraburkholderia cells of the first aspect promote root growth, preferably lateral root growth. In an alternative second aspect of the invention, therefore, there is also provided a plant growth composition comprising a Paraburkholderia cell according to the first aspect and a horticulturally acceptable excipient. Preferably wherein the Paraburkholderia cell is selected from: Paraburkholderia strains BCC1909, BCC01910, BCC 1914 , BCC01915, BCC 1950 and P. phytofirmans strain PsJN. Optionally the Paraburkholderia cells may provide such an effect endophytically, preferably by colonising plant roots endophytically. Suitably therefore the Paraburkholderia cell may be an endophyte. Suitably therefore the Paraburkholderia cell may be a root endophyte. Suitably therefore the composition may be an endophytic plant growth composition. In one embodiment of the second aspects of the invention there is provided a dual biopesticide and plant growth composition comprising a Paraburkholderia cell according to the first aspect and a horticulturally acceptable excipient. Suitably wherein the cell provides both a biopesticide effect and a plant growth effect. Preferably wherein the Paraburkholderia cell is selected from: Paraburkholderia strains BCC1909, BCC01910, BCC 1914 , BCC01915, BCC 1950 and P. phytofirmans strain PsJN. Optionally the composition may be an endophytic composition, suitably wherein the cell is capable of colonising a plant endophytically, preferably wherein the cell is capable of colonising plant roots endophytically. Suitably therefore the Paraburkholderia cell may be an endophyte. Suitably therefore the Paraburkholderia cell may be a root endophyte. Preferably wherein the Paraburkholderia cell is selected from: P. phytofirmans PsJN, P. bannensis BCC1915, P. tropica BCC1950 and Paraburkholderia sp. BCC1909. In one embodiment of the second aspect the biopesticide and/or plant growth composition may comprise more than one Paraburkholderia cell, suitably a plurality of Paraburkholderia cells. Suitably of different Paraburkholderia species or strains. Suitable therefore, there is provided a biopesticide composition comprising more than one Paraburkholderia cell according to the first aspect, wherein the cells are different Paraburkholderia species or strains, and a horticulturally acceptable excipient. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains. Optionally the composition may comprise further multiple Paraburkholderia cells according to the first aspect, for example a third, fourth, fifth or sixth Paraburkholderia cell according to the first aspect, optionally each of which may be a different Paraburkholderia species or strain. Suitable Paraburkholderia species or strains are described herein below. Suitably in some embodiments the Paraburkholderia species or strains included in the compositions of the invention may be selected to provide different effects, suitably to provide complementary effects. In one embodiment the composition may further comprise a Paraburkholderia cell according to the first aspect which is endophytic, suitably an endophyte, preferably which is capable of endophytically colonising plant roots, suitably a root endophyte. In one embodiment, therefore, there is provided a composition comprising a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein at least one of the cells is an endophyte, suitably which is capable of colonising a plant endophytically. Suitably of colonising a plant root endophytically. In one embodiment the composition may further comprise a Paraburkholderia cell according to the first aspect which improves plant growth. Suitably which improves root growth. Suitably which improves lateral root growth. Suitably improving root growth may encompass root stimulation. In one embodiment, therefore, there is provided a composition comprising a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein at least one of the cells is capable of improving plant growth. Suitably of improving root growth, suitably lateral root growth. In another embodiment, therefore, there is provided a composition comprising a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein at least one of the cells is capable of improving plant growth and at least one of the cells is an endophyte, suitably which is capable of colonising plants endophytically. Suitably the ability to colonise plants, preferably roots, endophytically and the ability to improve plant growth may be provided by the same or by different Paraburkholderia cells, of the same or different strain/species. In one embodiment, there is provided a composition comprising a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell, wherein the first and second cells are different Paraburkholderia species or strains, and a horticulturally acceptable excipient. Suitably in such an embodiment, the second cell may not produce a heterologous antimicrobial compound, and may suitably be non-modified. Suitably the second cell may be a wild type Paraburkholderia cell. However suitably the second cell may still provide an improvement in plant growth and/or be an endophytic cell. Suitably therefore the second cell may be selected from any Paraburkholderia species or strain described herein, preferably from those strains that provide improved growth. In one embodiment, there is provided a composition comprising a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, and a horticulturally acceptable excipient. Suitably such compositions may be a biopesticide composition and/or a plant growth composition. Optionally wherein at least one of the cells has biopesticide activity. Optionally wherein at least one of the cells is capable of improving plant growth, preferably of improving root growth, more preferably of improving lateral root growth. Optionally wherein at least one of the cells is an endophyte suitably capable of colonising plants endophytically, preferably capable of colonising roots endophytically. Optionally wherein the composition may contain further Paraburkholderia cells, such as a third, fourth or fifth cell, which may also be different Paraburkholderia species or strains, and which may also have different properties such as being a biopesticide, improving plant growth and/or being an endophyte. In some case the further Paraburkholderia cells may not be modified, and may be wild type cells. In a further alternative second aspect, there is provided a biopesticide and plant growth composition comprising a first Paraburkholderia cell according to the first aspect which acts as a biopesticide, and a second Paraburkholderia cell according to the first aspect which improves plant growth, wherein the first and second cells are different Paraburkholderia species or strains, and a horticulturally acceptable excipient. Optionally wherein the first and/or second cell is an endophyte, suitably capable of colonising plants endophytically, preferably roots endophytically. As noted herein, suitable Paraburkholderia strains may be selected from: P. aspalathi, for example strain LMG 27731; P. caffeinilytica, for example strain LMG 28690; P. gisengisoli, for example strain LMG 24044; P. phytofirmans for example strain PsJN (LMG 22146); P. bannensis, for example strain BCC1915; P. bannensis, for example strain BCC1914; Paraburkholderia sp BCC1909; Paraburkholderia sp BCC1910; P. tropica for example strain BCC1950; P. tropica, for example strain BCC1924; P. tropica, for example strain BCC1925; P. tropica, for example strain BCC1927; and P. tropica, for example strain BCC1933. Suitably any of said strains may be selected as a Paraburkholderia cell for use in the invention. As noted above, suitable Paraburkholderia strains which are endophytes, suitably which provide endophytic colonisation, suitably endophytic root colonisation, may be selected from: P. phytofirmans PsJN, P. bannensis BCC1915, P. tropica BCC1950 and Paraburkholderia BCC1909. Suitably any of said strains may be selected as a Paraburkholderia cell for use in the invention. Suitable Paraburkholderia strains which improve plant growth, suitably root growth, suitably lateral root growth, may be selected from: Paraburkholderia strains BCC1909, BCC01910, BCC 1914 , BCC01915, BCC 1950 and P. phytofirmans strain PsJN. Suitable Paraburkholderia strains which stimulate root growth may be selected from: Paraburkholderia strains BCC1909, BCC01910, BCC 1914, BCC01915, BCC 1950 and P. phytofirmans strain PsJN. Suitably any of said strains may be selected as a Paraburkholderia cell for use in the invention. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, wherein the first Paraburkholderia cell and the second Paraburkholderia cell are independently selected from: P. aspalathi, for example strain LMG 27731; P. caffeinilytica, for example strain LMG 28690; P. gisengisoli, for example strain LMG 24044; P. phytofirmans for example strain PsJN (LMG 22146); P. bannensis, for example strain BCC1915; P. bannensis, for example strain BCC1914; Paraburkholderia sp BCC1909; Paraburkholderia sp BCC1910; P. tropica for example strain BCC1950; P. tropica, for example strain BCC1924; P. tropica, for example strain BCC1925; P. tropica, for example strain BCC1927; and P. tropica, for example strain BCC1933. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, wherein the first Paraburkholderia cell and the second Paraburkholderia cell are independently selected from: P. bannensis, for example strain BCC1915; P. bannensis, for example strain BCC1914; Paraburkholderia sp BCC1909; Paraburkholderia sp BCC1910; P. tropica for example strain BCC1950; P. tropica, for example strain BCC1924; P. tropica, for example strain BCC1925; P. tropica, for example strain BCC1927; and P. tropica, for example strain BCC1933. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, wherein the first Paraburkholderia cell and the second Paraburkholderia cell are independently selected from: P. phytofirmans PsJN, P. bannensis BCC1915, P. tropica BCC1950 and Paraburkholderia BCC1909. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, wherein the first Paraburkholderia cell and the second Paraburkholderia cell are independently selected from: P. bannensis BCC1915, P. tropica BCC1950 and Paraburkholderia BCC1909. Suitably in such an embodiment, the cells are endophytes, and the composition may be endophytic. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, wherein the first Paraburkholderia cell and the second Paraburkholderia cell are independently selected from: Paraburkholderia strains BCC1909, BCC01910, BCC 1914 , BCC01915, BCC 1950 and P. phytofirmans strain PsJN. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, wherein the first Paraburkholderia cell and the second Paraburkholderia cell are independently selected from: Paraburkholderia strains BCC1909, BCC01910, BCC 1914 , BCC01915, and BCC 1950. Suitably in such an embodiment, the cells improve plant growth, and the composition may be a plant growth composition. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, wherein the first Paraburkholderia cell is selected from: P. aspalathi, for example strain LMG 27731; P. caffeinilytica, for example strain LMG 28690; P. gisengisoli, for example strain LMG 24044; P. phytofirmans for example strain PsJN (LMG 22146); P. bannensis, for example strain BCC1915; P. bannensis, for example strain BCC1914; Paraburkholderia sp BCC1909; Paraburkholderia sp BCC1910; P. tropica for example strain BCC1950; P. tropica, for example strain BCC1924; P. tropica, for example strain BCC1925; P. tropica, for example strain BCC1927; and P. tropica, for example strain BCC1933 and wherein the second Paraburkholderia cell is selected from: Paraburkholderia strains BCC1909, BCC01910, BCC 1914 , BCC01915, BCC 1950 and P. phytofirmans strain PsJN. Suitably wherein the first Paraburkholderia cell acts as a biopesticide. Suitably wherein the second Paraburkholderia cell acts as a biopesticide,and also provides improved plant growth, suitably improved root growth, suitably improved lateral root growth. In one embodiment, the composition may comprise a first Paraburkholderia cell according to the first aspect, and a second Paraburkholderia cell according to the first aspect, wherein the first and second cells are different Paraburkholderia species or strains, wherein the first Paraburkholderia cell is selected from: P. bannensis, for example strain BCC1915; P. bannensis, for example strain BCC1914; Paraburkholderia sp BCC1909; Paraburkholderia sp BCC1910; P. tropica for example strain BCC1950; P. tropica, for example strain BCC1924; P. tropica, for example strain BCC1925; P. tropica, for example strain BCC1927; and P. tropica, for example strain BCC1933 and wherein the second Paraburkholderia cell is selected from: Paraburkholderia strains BCC1909, BCC01910, BCC 1914 , BCC01915, and BCC 1950. Suitably wherein the first Paraburkholderia cell acts as a biopesticide. Suitably wherein the second Paraburkholderia cell acts as a biopesticide, and also provides improved plant growth, suitably improved root growth, suitably improved lateral root growth. Suitably any of the compositions listed above may be a biopesticide composition. Optionally the compositions listed above may also be plant growth compositions if suitable Paraburkholderia strains or species are contained in the composition. Optionally the compositions listed above may also be endophytic compositions, if suitable Paraburkholderia strains or species are contained in the composition. Suitably it will be appreciated that any combination of each of the Paraburkholderia strains or species listed above may be used in a composition of the invention. A third aspect of the invention provides a method of producing a biopesticide composition comprising admixing a Paraburkholderia cell according to the first aspect and a horticulturally acceptable excipient. In one embodiment, the method is a method of producing a biopesticide composition according to the second aspects. An alternative third aspect of the invention provides a method of producing a plant growth composition comprising admixing a Paraburkholderia cell according to the first aspect and a horticulturally acceptable excipient. In one embodiment, the method is a method of producing a plant growth composition according to the second aspects. An alternative third aspect of the invention provides a method of producing a biopesticide and/or a plant growth composition comprising admixing a first Paraburkholderia cell according to the first aspect, and optionally a second or further Paraburkholderia cell according to the first aspect, and a horticulturally acceptable excipient, wherein the first, second or further Paraburkholderia cells (if present) are different species/strains. In one embodiment, the method is a method of producing such a composition according to the second aspects. A fourth aspect of the invention provides a method of preventing, reducing or ameliorating plant pathogen infection comprising treating a plant with a Paraburkholderia cell of the first aspect or a biopesticide composition of the second aspect. An alternative fourth aspect of the invention provides a method of improving plant growth comprising treating a plant with a Paraburkholderia cell of the first aspect or a plant growth composition of the second aspect. In one embodiment, the method is a method of improving root growth, suitably a method of improving lateral root growth of a plant. An alternative fourth aspect of the invention provides a method of preventing, reducing or ameliorating plant pathogen infection and improving plant growth, comprising treating a plant with a Paraburkholderia cell of the first aspect, and optionally a second or further Paraburkholderia cell according to the first aspect, wherein at least one of the cells is capable of improving plant growth, or treating a plant with a biopesticide and plant growth composition of the second aspect, wherein the first, second or further Paraburkholderia cells (if present) are different species/strains. In one embodiment, the method is a method of improving root growth, suitably a method of improving lateral root growth of a plant. Optionally, the Paraburkholderia cell or cells may be an endophyte, suitably which is capable of colonising plants endophytically, preferably capable of colonising roots endophytically. In such embodiments, the method may be a method of endophytically preventing, reducing or ameliorating plant pathogen infection, or a method of endophytically improving plant growth, or both. In some embodiments of the fourth aspect, the plant may be treated by coating seeds of the plant with the cell or composition. Methods of the fourth aspect may be useful in treating, preventing or ameliorating a horticultural disease caused by a plant pathogen in a plant. Therefore the invention may further provide use of a Paraburkholderia cell of the first aspect, and optionally or second or further Paraburkholderia cell of the first aspect, or a biopesticide composition of the second aspect for treating, preventing or ameliorating a horticultural disease caused by a plant pathogen in a plant. A method of treating, preventing or ameliorating a horticultural disease caused by a plant pathogen in a plant may comprise treating the plant with a Paraburkholderia cell of the first aspect, and optionally or second or further Paraburkholderia cell of the first aspect, or a biopesticide composition of the second aspect. Methods of the fourth aspect may be useful in improving plant growth. Therefore the invention may further provide use of a Paraburkholderia cell of the first aspect, and optionally or second or further Paraburkholderia cell of the first aspect, or a plant growth composition of the second aspect for improving plant growth. Suitably which may be useful in improving root growth, suitably which may be useful in improving lateral root growth. A method of improving plant growth may comprise treating the plant with a Paraburkholderia cell of the first aspect, and optionally or second or further Paraburkholderia cell of the first aspect, or a plant growth composition of the second aspect. Suitably the methods may comprise exposing the plant to a Paraburkholderia cell of the first aspect, and optionally or second or further Paraburkholderia cell of the first aspect, or a composition of the second aspect. Suitable comprising exposing the plant to an effective amount of the cells or compositions thereof. Horticultural diseases caused by a plant pathogen include damping off. Other suitable diseases which may be treated or prevented by the compositions described herein are listed hereinbelow. A fifth aspect of the invention provides a method of converting a Paraburkholderia cell from a phenotype whereby the cell is unable to carry out biosynthesis of an antimicrobial compound to a phenotype whereby the cell is able to carry out biosynthesis of the antimicrobial compound, which method comprises the step of expressing a heterologous nucleic acid within the Paraburkholderia cell, following an earlier step of introducing the nucleic acid into the cell or an ancestor thereof, wherein the heterologous nucleic acid comprises a plurality of nucleotide sequences each of which encodes a polypeptide which in combination have the activity of, or are capable of, biosynthesis of the antimicrobial compound. A sixth aspect of the invention provides a method of producing a Paraburkholderia cell that produces or biosynthesises a heterologous antimicrobial compound, for example a Paraburkholderia cell of the first aspect. The method may comprise; introducing a vector that comprises one or more heterologous genes into a Paraburkholderia cell, wherein the one or more genes each encode a polypeptide which in combination have the activity of, or are capable of, biosynthesis of the antimicrobial compound. The one or more genes may be a heterologous biosynthetic gene cluster (BGC) for the antimicrobial compound. For example, the Paraburkholderia cell may comprise a Burkholderia biosynthetic gene cluster (BGC) for the antimicrobial compound. In one embodiment, introducing the nucleic acid or the vector into the cell comprises transforming the cell with the nucleic acid or the vector. Suitable vectors include integrative and extra-chromosomal vectors. Suitable means of transformation are described herein and known in the art. A Paraburkholderia cell of any one of the first to the sixth aspects may produce or biosynthesise multiple heterologous antimicrobial compounds. For example, the Paraburkholderia cell may contain multiple heterologous BGCs. For example the Paraburkholderia cell may contain a caryoynencin and a cepacin BGC. For example the Paraburkholderia cell may contain a caryoynencin and pyrrolnitrin BGC. For example the Paraburkholderia cell may contain a cepacin and pyrrolnitrin BGC. Heterologous antimicrobial compounds of any one of the first to the sixth aspects may include polyynes, such as caryoynencin or cepacin, or pyrroles, such as pyrrolnitrin (3-(2-nitro-3- chlorophenyl)-4-chloropyrrole). Preferably the heterologous antimicrobial compound is caryoynencin and/or cepacin. Other aspects and embodiments of the invention are described in more detail below. Any feature described herein in relation to any particular aspect or embodiment, or under any heading herein, is combinable in any workable combination, and is not limited to any particular aspect or embodiment. Suitably any references herein to ‘a’ or ‘the’ Paraburkholderia cell, may equally refer a first, a second and/or a further Paraburkholderia cell as described above. Features stated in relation to a first or individual Paraburkholderia cell may be understood to refer to any or all of the first, second or further Paraburkholderia cells. Features described in relation to the cells or compositions may equally apply to the methods recited herein. Brief Description of the Figures Figure 1 shows the cloning and expression of luxCDABE operon in yeast-adapted pMLBAD. (A) Plasmid maps pMLBAD_yeast, pMLBAD_yeast_luxCDABE_rev, pMLBAD_yeast_luxCDABE (pBBR1_oriV = replication origin of the broad host range plasmid pBBR1 from Bordetella bronchiseptica; pBBR1_rep = replication protein for broad host range plasmid pBBR1 from Bordetella bronchiseptica; TpR = trimethoprim resistance conferred by dihydrofolate reductase; araC = L- arabinose regulatory protein; pBAD = promoter of the L-arabinose operon in E. coli; rrnB T1 and T2 = transcription terminators of the E. coli rrnB gene; mob = mobilisation protein). (B) The bar chart shows the luminescence in relative light units (RLU) emitted by the bacteria harbouring the pMLBAD_yeast_luxCDABE plasmid divided by the RLU emitted by control (the bacteria containing pMLBAD_yeast_luxCDABE_rev). The luminescence was measured after 24-hour growth in minimal media, supplemented with different concentrations of L-arabinose or D-glucose, and was normalised by the optical density at 600nm (OD ₆₀₀ ). The height of each bar represents the mean +/- SD. Figure 2 shows cloning of polyyne gene clusters cepacin and caryoynencin in yeast adapted pMLBAD. (A) The gene arrangement of cepacin BGC (biosynthetic gene cluster) from B. ambifaria BCC0191 and the caryoynencin BGC from B. gladioli BCC1697. (B) The polyyne BGC were cloned downstream of pBAD promoter of pMLBAD_yeast in 3 overlapping fragments by homologous recombination in S. cerevisiae. (C) The cloning strategy employed was such that the first gene of the polyyne BGC, preceded by a native spacer of 9 bp (cepacin) or 6 bp (caryoynencin), was placed immediately downstream, of the Shine-Dalgarno (SD) sequence of the pMLBAD vector. Figure 3 shows heterologous expression of cepacin and caryoynencin under pBAD in B. ambifaria BCC1105 and P. phytofirmans PsJN. (A) The antagonistic activity of the B. ambifaria BCC1105 and P. phytofirmans PsJN heterologous hosts, containing either a polyyne BGC under the control of pBAD or empty plasmid vector, against S. aureus determined using a classic overlay assay. The observed zones of clearance indicate activity against S. aureus. High resolution LC-MS of the P. phytofirmans PsJN confirm the production of cepacin (B) and caryoynencin (C) by the heterologous hosts; no compound detected in the empty vector control. Figure 4 shows heterologous expression of cepacin by B. ambifaria BCC1105 and P. phytofirmans PsJN. Structure of cepacin and calculated masses (A). The extracted ion chromatograms (EICs) and high-resolution mass spectra are displayed for each of the following strains: B. ambifaria BCC0191 wild type (B) and the cepacin heterologous hosts B. ambifaria BCC1105 (C) and P. phytofirmans PsJN (D). Figure 5 shows heterologous expression of caryoynencin by B. ambifaria BCC1105, B. ambifaria BCC0191 and P. phytofirmans PsJN. Structure of caryoynencin and calculated masses (A). The extracted ion chromatograms (EICs) and high-resolution mass spectra are displayed for each of the following strains: B. gladioli BCC1697 wild type (B) and the caryoynencin heterologous hosts B. ambifaria BCC1105 (C), B. ambifaria BCC0191 (D), P. phytofirmans PsJN (E), P. bannensis BCC1915 (F), P. tropica BCC1950 (G), P. sp BCC1909 (H). Figure 6 shows a heterologous expression comparison when swapping pBAD for a native polyyne promoter. (A) Cloning strategy for swapping the BAD promoter of the pMLBAD_yeast_polyyne constructs for the native promoter of each BGC. Yeast homologous recombination was used to replace the araC-pBAD portion of the constructs with the native promoter (NP) fused to a kanamycin resistant cassette (KmR). The production of caryoynencin (B) and cepacin (C) by the native and heterologous hosts on basal media with glycerol (BSM-G) and pea exudate media determined by integration of HPLC peak areas. All peak areas are displayed as percentage of the metabolite peak area of the native host on BSM-G pH7. Figure 7 shows pMLBAD constructs copy number of pMLBAD::luxCDABE. Bacterial hosts containing the pMLBAD::luxCDABE constructs were passaged in BSM-G broth and the relative luminescence units normalized per optical density (A) and the % resistant colonies (B) were recorded at each passage. The points on the graph represent the mean of three independent experiments and the error bars the standard deviation. (C) The copy number, determined by qPCR, for each plasmid construct in each of the heterologous hosts is displayed as the mean value of four independent experiments and the standard deviation is shown in brackets. Figure 8 is a heatmap of the bioactivity of native polyyne hosts, polyyne mutants and heterologous hosts. The heatmap shows the native polyyne producers B. ambifaria BCC0191 (cepacin) and B. gladioli BCC1697 (caryoynencin) with an empty vector (EV) pMLBAD_yeast; the polyyne inactivation mutants B. ambifaria BCC0191::ccnJ (cepacin inactivation) and B. gladioli BCC1697::cayA (caryoynencin inactivation); the heterologous polyyne host P. phytofirmans PsJN NPcep (cepacin) and P. phytofirmans PsJN NPcay (caryoynencin) in addition to empty vector control P. phytofirmans PsJN EV. The bioactivity of all strains was assessed on four different media types – basal minimal media (BSMG) at pH5 and pH7, potato dextrose agar (PDA) and pea exudate media (PEM). (A) The bioactivity of the bacterial strains against two Gram-positive bacteria (S. aureus and C. michiganensis) and two yeasts (C. albicans and Z.tritici) determined by a classic overlay assay; the legend represents the zone of inhibition diameter in mm. (B) The bioactivity of the bacterial strains against 4 filamentous fungi (F. solani, A. alternata, C. cassiicola and G. tritici) and 3 oomycetes (Gl. ultimum, P. infestans, P. parasitica) determined by contact antagonism assay; the legend shows the % inhibition of mycelial growth compared to a control without bacteria. Figure 9 shows bioactivity and cepacin production of P. phytofirmans_pBADcep. (A) Heatmap summarising the bioactivity of the native cepacin producer B. ambifaria BCC0191 EV, the two heterologous hosts and the heterologous host P. phytofirmans, containing the cepacin gene cluster under the native promoter (NPcep) or the arabinose promoter (pBADcep) and the control P. phytofirmans containing an empty vector (EV). The bioactivity against two Gram-positive bacteria (S. aureus and C. michiganensis) and two yeasts (C. albicans and Z.tritici) determined by a classic overlay assay; the legend represents the zone of inhibition diameter in mm. The bioactivity of the bacterial strains against 4 filamentous fungi (F. solani, A.alternata, C.cassiicola and G. tritici) and the oomycete P. ultium was determined by contact antagonism assay; the legend shows the % inhibition of mycelial growth compared to a control without bacteria. (B) The production of cepacin by the native host B. ambifaria BCC0191 EV and the heterologous P. phytofirmans hosts, determined by integration of HPLC peak areas. All peak areas are displayed as percentage of the metabolite peak area of the native host on BSM-G pH7. Figure 10 shows a heatmap summary of the growth parameters of 43 screened Paraburkholderia strains at 30°C vs 37°C. Growthcurver R package (Sprouffske, K. and Wagner, A., 2016) was used to calculate the carrying capacity, area under the curve and intrinsic growth rate. The mean value of 3 independent biological replicates for calculated for each growth parameter. The tiles in the heatmap represents the Z-normalised values of the particular growth parameter for each of the investigated temperatures (Colour Key). Figure 11 shows temperature differential growth of selected Paraburkholderia strains. Growth curves of Paraburkholderia strains with area under the curve and carrying capacity significantly (p < 0.01, unpaired t-test) larger at 30°C than at 37°C. The optical density measurements were taken every 15 minutes for 48 hours at 420-550nm wavelength using a Bioscreen C automatic growth analyser. Figure 12 shows the temperature differential growth of Paraburkholderia strains and bioactivity. (A) The growth curves of four Paraburkholderia strains identified by screening to grow preferentially at 30°C relative to 37°C. The bioactivity of the four Paraburkholderia strains containing the caryoynencin construct against S. aureus (B) and Gl. ultimum (C). Figure 13 shows a schematic of integrative vector construction by homologous recombination in Saccharomyces cerevisiae. The integrase vector was assembled by transforming six PCR amplified fragments, containing 40 base pairs overlap between one another. Figure 14 shows the final assembly of the integrase vector with the feature-containing fragments annotated. Figure 15 shows biocontrol efficacy of P. phytofirmans PsJN expressing caryoynencin against Gl. ultimum damping-off disease in pea plants. (A) The % surviving pea plants at 14-days, followed a seed coated with P. phytofirmans strains containing either the caryoynencin (pCTX1_yeast_NPcay) or the empty vector construct (pCTX1_yeast_EV), and growth in Gl. ultimum-infested soil. The statistical difference between the two constructs was assessed by a two-tailed unpaired t-test (p-value = 0.005, represented by ** on graph). (B) Images representative of the observations in the assay are displayed for the P. phytofirmans PsJN biocontrol assays. Figure 16 shows Paraburkholderia do not have the ability to rot mushrooms. The ability of the Paraburkholderia heterologous hosts to rot commercial mushroom tissue slices was tested as described (Jones et al.2021). The state of the mushroom slices after incubation 48 hours at 30°C is shown. Panel a) Mushroom controls, from left to right: no treatment control, TSB only, non-rot control E. coli::GFP and B. gladioli strain BCC0238 (caryoynencin control). Pitting and tissue degradation was apparent in the known rot control B. gladioli (Jones et al., 2021). Panel b) Selected Paraburkholderia were tested, from left to right: Paraburkholderia species strain BCC1909, P. tropica strain BCC1910, P. bannensis strains BCC1914 and BCC1915 and P. tropica strain BCC1950. Panel c) GFP labelled cepacin-expressing biocontrol strains B. ambifaria BCC0191::GFP and BCC0191Δc3::GFP (both show evidence of rot) and P. phytofirmans PsJN::GFP (no evidence of rot). Figure 17 shows Paraburkholderia are not capable of onion rot. The ability of Paraburkholderia, B. ambifaria and B. gladioli to rot damaged commercial onion tissue was tested as described by Jones et al.2021. The tissue after incubation for 48 hours at 30°C is shown. Top section: Control onion sections, from left to right: no treatment control, TSB only, non-rot control E. coli::GFP and the rot control B. gladioli strain BCC238 (pitting and tissue maceration is present). Middle section: selected Paraburkholderia, from left to right: Paraburkholderia species strain BCC1909, P. tropica strain BCC1910, P. bannensis strains BCC1914 and BCC1915, and P. tropica strain BCC1950. Bottom section: GFP labelled biocontrol strains from left to right: B. ambifaria BCC0191::GFP, BCC0191Δc3::GFP and P. phytofirmans PsJN::GFP. The BCC0191 wild type strain produced a mild rot phenotype whereas its corresponding third replicon mutant did not degrade the onion tissue. No evidence of rot was seen with P. phytofirmans PsJN::GFP. Figure 18 shows Paraburkholderia are not pathogenic to Alfalfa. Alfalfa seeds were germinated, wounded and inoculated in groups of ten with standardised bacterial cultures (0.1 OD ₆₀₀ nm). After incubation for a further 7 days (2 in the dark), the pathogenicity was read out across the seedlings. Examples are shown (left to right) for Panel a) No treatment control, TSB only- control, non-pathogenic E. coli::GFP control and B. gladioli strain BCC0238 as the pathogenic control which attacked and began destroying the wounded seedlings. Panel b) Paraburkholderia strains: Paraburkholderia species strain BCC1909, P. tropica strain BCC1910, P. bannensis strains BCC1914 and BCC1915 and P. tropica strain BCC1950. Panel c) B. ambifaria BCC0191::GFP, B. ambifaria BCC0191Δc3::GFP and P. phytofirmans PsJN::GFP (BCC1604, bottom right). None of the Paraburkholderia strains tested showed any pathogenicity towards the injured Alfalfa. Figure 19 shows Paraburkholderia promote plant root development and increased lateral root number. The number of lateral roots was counted for the 10 injured Alfalfa seedlings exposed to Paraburkholderia or Burkholderia. B. gladioli stunted lateral root growth significantly in conjunction with the pathogenicity it showed towards the injured seedlings. In comparison the seedlings exposed to P. tropica strain BCC1910, and P. bannensis strains BCC1914 and BCC1915, all had significantly more lateral roots than the TSB control. Statistical analyses were completed using the Student’s t-test for 2 sample unequal variance (* p < 0.05 and ** p < 0.01). Note BCC1604 is the lab strain number for P. phytofirmans strain PsJN. Figure 20 shows macroscopic interaction of Burkholderia and Paraburkholderia with the Arabidopsis thaliana root system. A. thaliana seedlings were grown vertically for 2 weeks until root tips were 2 cm above lower edge of the plate. A bacterial suspension of 5 × OD ₆₀₀ of fluorescently labelled (pCTX1_yeast_eGFP; Table S1) Burkholderia and Paraburkholderia was mixed with soft agar, and applied to the lower edge of the plate (reaching up approximately 1 cm). After 7 days post this inoculation, the plates were imaged using a Biospace Lab PhotonIMAGER Optima at excitation wavelength 488 nm and emission wavelength 522 nm. The images are representative of eight different plates examined in four independent experiments. The root interaction of Arabidopsis seedlings with the Paraburkholderia strains was extensive over this timeframe (see lower panel). B. gladioli BCC1697 and B. ambifaria BCC0191 also colonised Arabidopsis, but the interaction of the plant’s roots with the bacterial seeded agar was far less extensive (see top right panels). Figure 21 shows confocal microscopy assessment of Burkholderia and Paraburkholderia interactions with Arabidopsis thaliana roots. A. thaliana seedlings were grown vertically for 2 weeks until root tips were 2 cm above lower edge of the plate. Bacterial suspension of 5 x OD ₆₀₀ of fluorescently labelled Burkholderia and Paraburkholderia was mixed with soft agar and applied to the lower edge of the plate (to a depth of approximately 1 cm).7 days post-inoculation, individual seedlings were removed from the plates, washed with PBS, stained with 0.01 mg/mL propodium iodide, immediately placed on a microscope slide with a cover slip and imaged using Zeiss LSM 710 inverted confocal microscope with the following settings: excitation with 488 nm laser (4.5%), emission channel 1 (499-529 nm), emission channel 2 (595-719 nm), 44 µL confocal pinhole and Plan-Apochromat 20x/0.8 M27 objective. The images are representative of ten different fields examined for each bacteria-plant interaction. Vasculature associated colonisation is indicated by white arrows. Detailed Description This invention relates to the expression of a biosynthetic gene cluster (BGC) from Burkholderia spp. in a Paraburkholderia cell. The biosynthetic gene cluster is for an antimicrobial compound, such that expression of the BGC leads to the production of the antimicrobial compound in the Paraburkholderia cell. This may be useful for example in the production of a safe biopesticide. A Paraburkholderia cell is a cell from a bacterium from the Paraburkholderia genus (Sawana et al 2014). Paraburkholderia are gram-negative bacteria that colonise plants and are associated with nitrogen fixation and plant growth promotion. A suitable Paraburkholderia cell may be non-pathogenic i.e. the cell may be from a non-pathogenic Paraburkholderia species. A non-pathogenic species does not infect or cause illness in mammals, such as humans. Preferred Paraburkholderia cells do not grow at 37°C or show reduced growth at 37°C. In some embodiments, the Paraburkholderia cell may grow more slowly at 37°C than at 30°C; for example, the Paraburkholderia cell may grow at least 25% slower, at least 50% slower, at least 75% slower, at least 80% slower or at least 90% slower at 37°C than at 30°C. In some embodiments, a Paraburkholderia cell may show at least 50%, at least 60%, at least 75%, at least 80% or at least 90% more growth after 50 hours culture at 30°C than at 37°C. The growth of Paraburkholderia cells at 30°C and 37°C may be readily determined, using standard techniques, for example by determining growth curves at the relevant temperatures and comparing the area under the curve, carrying capacity and intrinsic growth rate. Accordingly, the Paraburkholderia cell may show improved growth at 30°C relative to 37°C as determined by area under the curve, carrying capacity and/or intrinsic growth rate. Suitable Paraburkholderia cells and species may be identified using standard bacteriology techniques and optimally genome sequenced based methods. Suitable methods are well known in the art (see for example Mullins and Mahenthiralingam 2021). Any Paraburkholderia cells may be used in the invention, preferably those with the properties above. In some embodiments, a Paraburkholderia cell may be from a species selected from P. aspalathi, for example strain LMG 27731; P. caffeinilytica, for example strain LMG 28690; P. gisengisoli, for example strain LMG 24044; P. phytofirmans for example strain PsJN (LMG 22146); P. bannensis, for example strain BCC1915; P. bannensis, for example strain BCC1914; Paraburkholderia sp BCC1909; Paraburkholderia sp BCC01910; P. tropica for example strain BCC1950; P. tropica, for example strain BCC1924; P. tropica, for example strain BCC1925; P. tropica, for example strain BCC1927; or P. tropica, for example strain BCC1933. In some embodiments, the species may be selected from P. phytofirmans, P. bannensis, P. tropica, or Paraburkholderia sp. BCC1909. Suitable Paraburkholderia species are available in the art, for example from American Type Culture Collection (ATCC; USA);European Collection of Cell Cultures (ECACC; UK), Belgian Coordinated Collections of Microorganisms (BCCM; see all LMG designated species above) and DSMZ-German Collection of Microorganisms and Cell Cultures GmbH. Suitable Paraburkholderia species or strains are listed herein in table 3. Preferred strains are described in Alswat A (2020) ‘The biotechnological potential of natural populations of Burkholderiales bacteria for antibiotic production’. PhD Thesis, Cardiff University, which is incorporated herein by reference. Suitably said strains may be obtained from Organisms and the Environment Division, Cardiff School of Biosciences, Cardiff University, UK. In some embodiments, a Paraburkholderia cell may be selected from Paraburkholderia sp BCC1909, Paraburkholderia sp BCC01910, P. bannensis BCC 1914 , P. bannensis BCC01915, P. tropica BCC 1950 and P. phytofirmans strain PsJN. Suitably such strains are shown herein to improve plant growth, suitably root growth, suitably lateral root growth. In some embodiments, a Paraburkholderia cell may be from a species selected from P. phytofirmans PsJN, P. bannensis BCC1915, P. tropica BCC1950 and Paraburkholderia sp. BCC1909. Suitably such strains are shown herein to be endophytes, suitably which colonise roots of plants. A Paraburkholderia cell described herein that produces a heterologous antimicrobial compound may be non-naturally occurring i.e. it may be a recombinant cell that has been genetically engineered to produce the heterologous antimicrobial compound, for example by the incorporation of heterologous nucleic acid, such as a heterologous BGC. Such a cell may equally be referred to herein as a modified Paraburkholderia cell. An antimicrobial compound is an organic metabolite produced by a different bacterial species, preferably a species of the Burkholderia genus, that kills microorganisms or inhibits or prevent their growth or spread. An antimicrobial compound may have activity against a plant pathogen. For example, the antimicrobial compound may display antibacterial, antiviral, antifungal and/or antiprotozoal activity. An antimicrobial compound may be synthesised by a biosynthetic pathway in a microbial cell or may be an intermediate produced by a biosynthetic pathway. Suitable antimicrobial compounds may be generated with the Paraburkholderia cell by the proteins encoded by a heterologous BGC. Antimicrobial compounds may include pyrroles, alkaloids, polyenes, polyketides, polyynes, macrolides, terpenes, peptides, lipopeptides and quinolones. In some preferred embodiments, the antimicrobial compound is a polyyne. A polyyne is an organic compound characterised by alternating single and triple carbon-carbon bonds. A polyyne as described herein may be produced by a microorganism and display anti-biotic, anti-microbial and/or anti-fungal properties. A polyyne may be heterologous i.e. it may not be naturally present in the Paraburkholderia cell. Preferred polyynes include polyynes produced by Burkholderia spp, (i.e. Burkholderia polyynes), most preferably caryoynencin (6-hydroxy-7E,9E-Octadecadiene-11,13,15,17-tetraynoic acid; Pubchem ID 6474912;Compound 1) or cepacin (4,5-Dihydro-5-(2,3:4,5-diepoxy-1-hydroxydodeca-6,7-dien-9,1 1- diynyl)-2(3H)-furanone 2(5H)-furanone; Pubchem ID 56280; CAS 91682-94-9; Compound 2). Compound 1 Compound 2 In other preferred embodiments, the antimicrobial compound is a pyrrole. A pyrrole is an organic compound characterised by the presence of a pyrrole group. A pyrrole as described herein may be produced by a microorganism and display anti-biotic, anti-microbial and/or anti-fungal properties. A pyrrole may be heterologous i.e. it may not be naturally present in the Paraburkholderia cell. Preferred pyrroles include pyrroles produced by Burkholderia spp, (i.e. Burkholderia pyrroles), most preferably pyrrolnitrin (3-Chloro-4-(3-chloro-2-nitrophenyl)-1H-pyrrole; Pubchem ID 13916; Compound 3 ) Compound 3 An antimicrobial compound may be synthesised by a biosynthetic pathway in a microbial cell. A biosynthetic pathway is a series of enzymes and other factors that act in concert to synthesise the antimicrobial compound in the microbial cell. The genes that encode the members of the biosynthetic pathway (i.e. biosynthetic pathway genes) may be located in a biosynthetic gene cluster. A biosynthetic gene cluster (BGC) is a nucleic acid sequence that comprises the genes encoding the members of a biosynthetic pathway. The genes in the BGC may be within a single operon operably linked to single promoter. A biosynthetic gene cluster may for example be from 1 to 200kb, 1 to 100kb, or 1 to 50kb in length, preferably 2 to 25 kb, for example 10 to 15 kb. A Paraburkholderia cell may comprise one or more biosynthetic pathway genes, such that the Paraburkholderia cell is capable of producing, and preferably produces the heterologous antimicrobial compound. Preferably, the Paraburkholderia cell comprises the complete BGC for the antimicrobial compound. Expression of the biosynthetic pathway genes in the Paraburkholderia cell generates the proteins of the biosynthetic pathway that produce the antimicrobial compound in the Paraburkholderia cell. In other embodiments, the Paraburkholderia cell may comprise a partial BGC, expression of the genes of the partial biosynthetic pathway in the Paraburkholderia cell generates the proteins of the partial pathway that produce an antimicrobial compound that is an intermediate in the biosynthetic pathway encoded by the complete BGC. The biosynthetic pathway genes and/or the BGC may be heterologous to the Paraburkholderia cell. For example, the genes and/or BGC may be a Burkholderia BGC and/or Burkholderia genes respectively. A Paraburkholderia cell may comprise one or more biosynthetic pathway genes, such that the Paraburkholderia cell is capable of producing, and preferably produces the heterologous antimicrobial compound. Preferably, the Paraburkholderia cell comprises the complete BGC. The antimicrobial compound produced by the Paraburkholderia cell may be caryoynencin. The Paraburkholderia cell may comprise one or more caryoynencin biosynthetic pathway genes, preferably the complete BGC for caryoynencin. The caryoynencin biosynthetic pathway genes and/or BGC may be genes from a bacterium of the Burkholderia genus, for example B. gladioli. B. gladioli has 12 caryoynencin biosynthetic pathway genes; cayA, cayB, cayC, cayD, cayE, cayF, cayG, cayH, cayI, cayJ, cayK and cayL. These members are located in a BGC of approximately 11 kb. A Paraburkholderia cell may comprise one or more of these genes, and may be capable of expressing one or more of these genes, such that it is capable of producing, and preferably produces caryoynencin or an intermediate thereof. Preferably, the Paraburkholderia cell comprises all 12 caryoynencin biosynthetic pathway genes; cayA, cayB, cayC, cayD, cayE, cayF, cayG, cayH, cayI, cayJ, cayK and cayL. The genes may be in a single operon. For example, the Paraburkholderia cell may comprise Burkholderia BGC for caryoynencin. The Burkholderia BGC may comprise the sequence of SEQ ID NO: 2 or may be a variant or fragment thereof. Suitably such genes and the entire BCG is heterologous to the Paraburkholderia cell. In one embodiment, the Paraburkholderia cell may comprise the Burkholderia BGC of SEQ ID NO: 2 or a variant or fragment thereof. The cayA gene may comprise the nucleotide sequence or complement of residues 1015 to 2847 of SEQ ID NO: 2, or a variant thereof (see table 5). The cayB gene may comprise the nucleotide sequence or complement of residues 2864 to 3793 of SEQ ID NO: 2, or a variant thereof. The cayC gene may comprise the nucleotide sequence or complement of residues 3819 to 4793 of SEQ ID NO: 2, or a variant thereof. The cayD gene may comprise the nucleotide sequence or complement of residues 4056 to 5179 of SEQ ID NO: 2, or a variant thereof. The cayE gene may comprise the nucleotide sequence or complement of residues 5201 to 6301 of SEQ ID NO: 2, or a variant thereof. The cayF gene may comprise the nucleotide sequence or complement of residues 6360 to 7334 of SEQ ID NO: 2, or a variant thereof. The cayG gene may comprise the nucleotide sequence or complement of residues 7350 to 8222 of SEQ ID NO: 2, or a variant thereof. The cayH gene may comprise the nucleotide sequence or complement of residues 8246 to 8431 of SEQ ID NO: 2, or a variant thereof. The cayI gene may comprise the nucleotide sequence or complement of residues 8481 to 9677 of SEQ ID NO: 2, or a variant thereof. The cayJ gene may comprise the nucleotide sequence or complement of residues 9916 to 11004 of SEQ ID NO: 2, or a variant thereof. The cayK gene may comprise the nucleotide sequence or complement of residues 11004 to 12644 of SEQ ID NO: 2, or a variant thereof. The cayL gene may comprise the nucleotide sequence or complement of residues 12653 to 14206 of SEQ ID NO: 2, or a variant thereof. In one embodiment, the Paraburkholderia cell may comprise any one or more of the Burkholderia genes comprised within SEQ ID NO: 2 or variants or fragments thereof. The antimicrobial compound produced by the Paraburkholderia cell may be cepacin. A Paraburkholderia cell may comprise one or more cepacin biosynthetic pathway genes, preferably the complete BGC for cepacin. The cepacin biosynthetic pathway genes and/or BGC may be genes from a bacterium of the Burkholderia genus, B. ambifaria. B. ambifaria has 16 biosynthetic genes; ccnA, ccnB, ccnC, ccnD, ccnE, ccnF, ccnG, ccnH, ccnI, ccnJ, ccnK, ccnL, ccnM, ccnN, ccnO, and ccnP. These members are located in a BGC of approximately 13kb. A Paraburkholderia cell may comprise one or more of these genes, and may be capable of expressing one or more of these genes, such that it is capable of producing, and preferably produces cepacin or an intermediate thereof. Preferably, the Paraburkholderia cell comprises all 16 cepacin biosynthetic pathway genes; ccnA, ccnB, ccnC, ccnD, ccnE, ccnF, ccnG, ccnH, ccnI, ccnJ, ccnK, ccnL, ccnM, ccnN, ccnO, and ccnP. The genes may be in a single operon. For example, the Paraburkholderia cell may comprise Burkholderia BGC for cepacin. The Burkholderia BGC may comprise the sequence of SEQ ID NO: 1 or may be a fragment or variant thereof. Suitably such genes and the entire BCG is heterologous to the Paraburkholderia cell. In one embodiment, the Paraburkholderia cell may comprise the Burkholderia BGC of SEQ ID NO: 1 or a variant or fragment thereof. The ccnA gene may comprise the nucleotide sequence or complement of residues 714 to 1 of SEQ ID NO: 1, or a variant thereof (see table 4). The ccnB gene may comprise the nucleotide sequence or complement of residues 1143 to 1526 of SEQ ID NO: 1, or a variant thereof. The ccnC gene may comprise the nucleotide sequence or complement of residues 1885 to 2538 of SEQ ID NO: 1, or a variant thereof. The ccnD gene may comprise the nucleotide sequence or complement of residues 2680 to 3972 of SEQ ID NO: 1, or a variant thereof. The ccnE gene may comprise the nucleotide sequence or complement of residues 4136 to 5521 of SEQ ID NO: 1, or a variant thereof. The ccnF gene may comprise the nucleotide sequence or complement of residues 5628 to 6710 of SEQ ID NO: 1, or a variant thereof. The ccnG gene may comprise the nucleotide sequence or complement of residues 6791 to 7795 of SEQ ID NO: 1, or a variant thereof. The ccnH gene may comprise the nucleotide sequence or complement of residues 7792 to 8667 of SEQ ID NO: 1, or a variant thereof. The ccnI gene may comprise the nucleotide sequence or complement of residues 8672 to 10090 of SEQ ID NO: 1, or a variant thereof. The ccnJ gene may comprise the nucleotide sequence or complement of residues 10172 to 11968 of SEQ ID NO: 1, or a variant thereof. The ccnK gene may comprise the nucleotide sequence or complement of residues 12029 to 12988 of SEQ ID NO: 1, or a variant thereof. The ccnL gene may comprise the nucleotide sequence or complement of residues 13015 to 13998 of SEQ ID NO: 1, or a variant thereof. The ccnM gene may comprise the nucleotide sequence or complement of residues 14054 to 14374 of SEQ ID NO: 1, or a variant thereof. The ccnN gene may comprise the nucleotide sequence or complement of residues 14388 to 15485 of SEQ ID NO: 1, or a variant thereof. The ccnO gene may comprise the nucleotide sequence or complement of residues 15485 to 16408 of SEQ ID NO: 1, or a variant thereof. The ccnP gene may comprise the nucleotide sequence or complement of residues 16405 to 16590 of SEQ ID NO: 1, or a variant thereof. In one embodiment, the Paraburkholderia cell may comprise any one or more of the Burkholderia genes comprised within SEQ ID NO: 1 or variants or fragments thereof. The antimicrobial compound produced by the Paraburkholderia cell may be pyrrolnitrin. A Paraburkholderia cell may comprise one or more pyrrolnitrin biosynthetic pathway genes, preferably the complete BGC for pyrrolnitrin. The pyrrolnitrin biosynthetic pathway genes and/or BGC may be genes from a bacterium of the Burkholderia genus, B. ambifaria. B. ambifaria has 4 biosynthetic genes; prnA, prnB, prnC and prnD . These members are located in a BGC of approximately 9 kb. A Paraburkholderia cell may comprise one or more of these genes, and may be capable of expressing one or more of these genes, such that it is capable of producing, and preferably such that it produces pyrrolnitrin or an intermediate thereof. Preferably, the Paraburkholderia cell comprises all 4 pyrrolnitrin biosynthetic pathway genes; prnA, prnB, prnC and prnD. The genes may be in a single operon. For example, the Paraburkholderia cell may comprise Burkholderia BGC for pyrrolnitrin. The Burkholderia BGC may comprise the sequence of SEQ ID NO: 3 or may be a fragment or variant thereof. Suitably such genes and the entire BCG is heterologous to the Paraburkholderia cell. In one embodiment, the Paraburkholderia cell may comprise the Burkholderia BGC of SEQ ID NO: 3 or a variant or fragment thereof. The prnA gene may comprise the nucleotide sequence or complement of residues 6690 to 5074 of SEQ ID NO: 3, or a variant thereof (see table 6). The prnB gene may comprise the nucleotide sequence or complement of residues 5074 to 3989 of SEQ ID NO: 3 or a variant thereof. The prnC gene may comprise the nucleotide sequence or complement of residues 3944 to 2244 of SEQ ID NO: 3 or a variant thereof. The prnD gene may comprise the nucleotide sequence or complement of residues 2218 to 1106 of SEQ ID NO: 3 or a variant thereof. In one embodiment, the Paraburkholderia cell may comprise any one or more of the Burkholderia genes comprised within SEQ ID NO: 3 or variants or fragments thereof. A variant of a reference amino acid sequence or reference nucleotide sequence set out herein may comprise an amino acid sequence or a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% sequence identity to the reference sequence. Particular amino acid sequence variants may differ from the reference sequence by insertion, addition, substitution or deletion of 1 amino acid, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more than 10 amino acids. Particular nucleotide sequence variants may differ from the reference sequence by insertion, addition, substitution or deletion of 1 nucleotide, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more than 10 nucleotides. Sequence similarity and identity are commonly defined with reference to the algorithm GAP (Wisconsin Package, Accelerys, San Diego USA). GAP uses the Needleman and Wunsch algorithm to align two complete sequences that maximizes the number of matches and minimizes the number of gaps. Generally, default parameters are used, with a gap creation penalty = 12 and gap extension penalty = 4. Use of GAP may be preferred but other algorithms may be used, e.g. BLAST (which uses the method of Altschul et al. (1990) J. Mol. Biol.215: 405-410), FASTA (which uses the method of Pearson and Lipman (1988) PNAS USA 85: 2444-2448), or the Smith-Waterman algorithm (Smith and Waterman (1981) J. Mol Biol.147: 195-197), or the TBLASTN program, of Altschul et al. (1990) supra, generally employing default parameters. In particular, the psi-Blast algorithm (Nucl. Acids Res. (1997) 253389-3402) may be used. Computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and FASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI) are available and publicly available computer software may be used such as ClustalOmega (Söding, J.2005, Bioinformatics 21, 951-960), T-coffee (Notredame et al. 2000, J. Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer 2005, BMC Bioinformatics, 6(298)), Genomequest ^TM software (Gene-IT, Worcester MA USA) and MAFFT (Katoh and Standley 2013, Molecular Biology and Evolution, 30(4) 772–780 software. When using such software, the default parameters, e.g. for gap penalty and extension penalty, are preferably used. A preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res.25:3389-3402 (1977) and Altschul et al., J. Mol. Biol.215:403-410 (1990), respectively. Sequence comparison may be made over the full-length of the relevant sequence described herein. An amino acid residue in a reference amino acid sequence may be altered or mutated by insertion, deletion or substitution, preferably substitution for a different amino acid residue, to produce a variant of the reference amino acid sequence. A nucleotide in a reference nucleotide sequence may be altered or mutated by insertion, deletion or substitution, preferably substitution for a different nucleotide, to produce a variant of the reference nucleotide sequence. In some embodiments, the Paraburkholderia cell may be capable of producing, and preferably produce multiple heterologous antimicrobial compounds, such as polyynes and/or pyrroles. For example, a Paraburkholderia cell may comprise two or more different BGCs, for example, two or more different Burkholderia BGCs. In some embodiments, a Paraburkholderia cell may be capable of producing, and preferably produce two or all three of pyrrolnitrin, caryoynencin and cepacin. A Paraburkholderia cell as described here may be produced by introducing one or more biosynthetic pathway genes, preferably a BGC, into a Paraburkholderia cell, such that the antimicrobial compound is capable of being produced, and preferably is produced in the Paraburkholderia cell. Biosynthetic pathway genes or BGC for an antimicrobial compound may be operably linked to a heterologous regulatory sequence, such as a promoter, for example a constitutive or inducible promoter. A promoter is a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA). Suitable promoters include the pBAD promoter (Guzman et al., 1995, Lefebre & Valvano, 2002), which is activated by arabinose and suppressed by glucose in E coli, Paraburkholderia and Burkholderia. In other embodiments, the genes or BGC may be operably linked to its endogenous (i.e. native) promoter. "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. The term "inducible" as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is "switched on" or increased in response to an applied stimulus. The nature of the stimulus varies between promoters. Some inducible promoters cause little or undetectable levels of expression (or no expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus. The one or more biosynthetic pathway genes or BGC may be contained on a nucleic acid construct or vector. The construct or vector is preferably suitable for transformation into and/or expression within a bacterial cell, in particular a Paraburkholderia cell. A vector may be inter alia any plasmid, cosmid, phage or other expression vector in double or single stranded linear or circular form, which may or may not be self-transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host, either by integration into the cellular genome or exist extrachromasomally (e.g. autonomous replicating plasmid with an origin of replication). Constructs and vectors may further comprise selectable genetic markers consisting of genes that confer selectable phenotypes such as resistance to antibiotics such as kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones, glyphosate and d-amino acids. Constructs and vectors may further comprise recombination sites to enable the removal of antibiotic selection and other vector sequences, leaving the heterologous nucleic acid encoding the BGC inserted in the Paraburkholderia cell genome . In some embodiments, the one or more biosynthetic pathway genes or BGC may be contained on a extrachromosomal vector. Suitable vectors may include plasmid vectors, such as pMLBAD (Lefebre & Valvano, 2002) and modified forms thereof. Preferably, the plasmid vector is adapted to replicate in yeast and Paraburkholderia. This allows the insertion of genes or nucleic acid into the vector in a yeast host before introduction into the Paraburkholderia cell. For example, a suitable plasmid vector may comprise a yeast origin of replication, such as 2µ; a yeast selectable marker, such as URA3, a bacterial origin of replication, such as pBBR1 oriV, and a bacterial selectable marker, preferably a Paraburkholderia selectable marker, such as TpR (trimethoprim resistance; dihydrofolate reductase). Examples of suitable plasmid vectors are described below and shown in Figure 1A. In other embodiments, the one or more biosynthetic pathway genes or BGC may be contained on an integrative vector. An integrative vector integrates into the Paraburkholderia chromosome, following introduction into the Paraburkholderia cell. Preferably, the integrative vector is adapted to replicate in yeast. This allows the assembly of the vector and the insertion of genes or nucleic acid in a yeast host. For example, a vector may be assembled in a yeast cell from overlapping nucleic acid fragments by homologous recombination. Suitable techniques are known in the art (see for example, Pahirulzaman et al., 2012). The integrative vector may for example comprise a yeast origin of replication, such as 2µ or CEN/ARS regions; and a yeast selectable marker, such as URA3. The integrative vector may further comprise an integrase coding sequence, for example a φCTX integrase coding sequence, and an integrase recognition site, such as attP. This allows integration of the vector into the Paraburkholderia chromosome. The integrative vector may further comprise a bacterial origin of replication, such as ColE1, and a bacterial selectable marker, preferably a Paraburkholderia selectable marker, such as TpR (trimethoprim resistance; dihydrofolate reductase). The integrative vector may further comprise a marker, for example a fluorescent marker, such as eGFP to help with genetic manipulation. We would seek to remove this additional DNA from a final construct The integrative vector may further comprise the one or more biosynthetic pathway genes or BGC for an antimicrobial compound. In some preferred embodiments, the integrative vector may comprise a Burkholderia BGC, for example a Burkholderia BGC for a polyyne or pyrrole. Following integration and BGC expression, an integrative vector may allow removal of the non-BGC vector sequences, such as the selectable markers, from the Paraburkholderia genome, Suitable approaches for the removal of vector sequence are well established in the art. In some preferred embodiments, the integrative vector may include elements that allow excision from the Paraburkholderia genome of vector sequences other than the antimicrobial compound biosynthetic pathway genes or nucleic acids to be expressed. For example, the integrative vector may comprise site specific recombination sites, such as FRT sites. Those skilled in the art can construct vectors and design protocols for recombinant gene expression, for example in a microbial cell. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 3rd edition, Sambrook et al, 2001, Cold Spring Harbor Laboratory Press and Protocols in Molecular Biology, Second Edition, Ausubel et al. eds. John Wiley & Sons, 1992. When introducing a chosen gene construct into a cell, certain considerations must be taken into account, well known to those skilled in the art. The nucleic acid to be inserted should be assembled within a construct that contains effective regulatory elements that will drive transcription. There must be available a method of transporting the construct into the cell. Once the construct is within the cell membrane, integration into the endogenous chromosomal material either will or will not occur. It is desirable to use a vector and transformation method which enhances expression of the nucleic acid to generate the biosynthetic pathway and allow biosynthesis of the antimicrobial compound. Integration of a single copy of the gene into the genome of the Paraburkholderia cell may be beneficial to minimize gene silencing effects. Likewise, control of the complexity of integration may be beneficial in this regard. Techniques well known to those skilled in the art may be used to introduce nucleic acid constructs and vectors into Paraburkholderia cells to produce Paraburkholderia cells with the properties described herein, including electroporation and conjugative plasmid transformation . For example, constructs and vectors may be transformed into Paraburkholderia cells using triparental conjugation mating with E. coli DH5α containing the construct or vector and E. coli HB101 containing a helper plasmid, preferably the helper plasmid pRK2013, as described herein. The transformed Paraburkholderia cells may then be cultured in a culture medium to produce a population of Paraburkholderia cells. Suitable culture techniques are well-known in the art. Further provided herein is a culture comprising a Paraburkholderia cell according to the first aspect of the invention, or a composition of the second aspect of the invention. In some embodiments, the population of Paraburkholderia cells may be further treated for example by lyophilisation, and stored for use as described herein. Paraburkholderia cells as described herein may display antimicrobial properties and may be useful as biopesticides. Paraburkholderia cells as described herein may display plant growth promoting properties and may be useful as plant growth compositions. While it is possible for a Paraburkholderia cell described herein to be used (e.g., applied to a plant) alone, it is often preferable to present it in the form of a compositions, suitably a biopesticide and/or plant growth composition, which may comprise at least one component in addition to the Paraburkholderia cell. The biopesticide composition may comprise, in addition to the Paraburkholderia cell, a horticulturally acceptable excipient, carrier, binder buffer, stabilizer or other materials well known to those skilled in the art. For example, a composition, suitably a biopesticide and/or plant growth composition may comprise Paraburkholderia cells as described herein and a horticulturally acceptable carrier or excipient. Suitable horticulturally acceptable carriers may include water, saline, buffered saline or phosphate buffer, for example a suitable buffer may be TBS or PBS. The term “horticulturally acceptable” pertains to compounds, ingredients, materials, compositions, dosage forms, etc., which are, within the scope of sound horticultural judgment, suitable for use in contact with the tissues of the plant in question without excessive toxicity. Each carrier, diluent, excipient, etc. must also be “acceptable” in the sense of being compatible with the other ingredients of the formulation. In some embodiments, the biopesticide and/or plant growth composition may be formulated as a seed-coating. Suitable horticulturally acceptable excipients for use in a seed coating may include binders, for example natural or synthetic polymers, such as methyl cellulose, carboxymethyl cellulose, gum arabic, polysaccharides and xanthan; and fillers, such as peat, talc, alginate, biochar, chitosan and lime. A seed coating may be applied to seeds using standard techniques, such as seed dressing, film coating, encrusting and pelleting. In some embodiments, the biopesticide and/or plant growth composition may be formulated for drip irrigation. For example, the biopesticide and/or plant growth composition may be suspended in water and directly applied to plants or seed beds. A biopesticide and/or plant growth composition may be produced by a method comprising admixing Paraburkholderia cells according to the first aspect and a horticulturally acceptable carrier. Paraburkholderia cells and biopesticide compositions may be useful in treating plants or plant parts, for example to prevent infection with a plant pathogen or to reduce or ameliorate the effect of infection with a plant pathogen. The cells or composition may for example kill the plant pathogen or reduce or inhibit its growth or transmission. A method of treating, inhibiting or preventing infection with a plant pathogen may comprise treating the plant or part thereof with a Paraburkholderia cell or a biopesticide composition as described herein. Plant pathogens may include oomycetes, fungi, viruses, bacteria or nematodes. For example a Paraburkholderia cell or a biopesticide composition as described herein may be useful in the treatment or prevention of infection with Staphylococcus aureus, Candida albicans, Clavibacter michiganensis, Zymoseptoria tritici (Septoria tritici, Mycosphaerella graminicola), Pythium species, such as Globisporangium ultimum (Pythium ultimum), Phytophthora nicotianae (Phytophthora parasitica) Phytophthora infestans, Fusarium species, such as Fusarium redolens Wollenweber (Fusarium solani), Alternaria alternata (Alternaria tenuis Nees), Corynespora cassiicola and/or Gaeumannomyces tritici (Gaeumannomyces graminis var. tritici). In some embodiments, methods described herein may be useful in treating, preventing or reducing the effect of a horticultural disease caused by a plant pathogen, such as a bacterial, fungal or viral infection, for example blight, fungal infection or damping off, bacterial wilt, canker, crown gall, rot, basal rot, gray mold rot, hear rot, scab, fire blight, late blight, rice blight, anthracnose, black knot, clubroot, Dutch elm disease, ergot, fusarium wilt, leaf blisters, mildew, downy mildew, powdery mildew, rust, blister rust, cedar-apple rust, coffee rust, smut, bunt, corn smut, snowy mold, sooty mold, verticillium wilt, curly top, mosaic, psorosis, spotted wilt etc. In some embodiments the horticultural disease is damping-off. In some embodiments the horticultural disease is caused by a fungal pathogen. A method of treating, reducing or preventing a pathogenic horticultural disease, such as damping off, in a plant may comprise treating the plant or a part thereof with a Paraburkholderia cell or a biopesticide composition as described herein. Paraburkholderia cells and biopesticide compositions may be useful in treating plants, for example to improve plant growth, preferably to improve plant root growth, more preferably to improve lateral plant root growth. The cells or composition may for example provide the plant with nutrients, or may kill or inhibit pathogens which reduce plant growth. A method of improving plant growth may comprise treating the plant or a part thereof with a Paraburkholderia cell or a plant growth composition as described herein. In some embodiments, methods described herein may be useful in promoting plant growth, such as root growth, such as lateral root growth. The Paraburkholderia cell or a biopesticide and/or plant growth composition as described herein may be applied to a plant, or any plant part, by any suitable method known to the skilled person. For example, the plant or part thereof may be sprayed, dipped, or infiltrated with the cell or composition or the cell or composition may be watered or irrigated onto the plant or plant part. The Paraburkholderia cells may be applied to a single plant at a concentration of 10 ³ or more, 10 ⁴ or more, 10 ⁵ or more, 10 ⁶ or more, 10 ⁷ or more, 10 ⁸ or more, 10 ⁹ or more or 10 ¹⁰ or more cfu/ml, preferentially applied at a concentration of between 10 ⁴ and 10 ⁹ cfu/ml, more preferentially applied at a concentration of between 10 ⁵ and 10 ⁷ cfu/ml. Suitably such concentrations may be referred to as an effective amount. Suitably a plant part may be any part or organ of a plant including a leaf, stem, flower, bud, root, nodule, tuber, pollen, fruit, seed etc. or cell, or collection of cells. In some preferred embodiments, a plant may be treated by coating seeds with the cell or composition (i.e. applying the cell or composition as a seed coat). For example, the seeds of a plant may be coated with the cell or composition by seed dressing. This may comprise dusting the cell or composition dusted onto the surface of seeds in a fine particulate solid form. Alternatively, the seeds of a plant may be coated with the cell or composition by slurry or film coating. This may comprise applying the cell or composition to the surface of seeds in a solution or suspension form to form a fine outer coating. Alternatively, the seeds of a plant may be coated with the cell or composition by pelleting. This may comprise admixing the cell or composition with the seeds to form pellets comprising seeds and cells. Suitable methods of seed coating are well-known in the art. "Heterologous" indicates that the compound, nucleic acid or protein in question has been produced in or introduced into a Paraburkholderia cell or an ancestor thereof artificially, for example using genetic engineering or recombinant means, i.e. by human intervention. Compounds, nucleotides and proteins which are heterologous to a Paraburkholderia cell do not occur naturally in the Paraburkholderia cell (i.e. they are exogenous, non-native or foreign). Other aspects and embodiments of the invention provide the aspects and embodiments described above with the term “comprising” replaced by the term “consisting of” and the aspects and embodiments described above with the term “comprising” replaced by the term ”consisting essentially of”. It is to be understood that the application discloses all combinations of any of the above aspects and embodiments described above with each other, unless the context demands otherwise. Similarly, the application discloses all combinations of the preferred and/or optional features either singly or together with any of the other aspects, unless the context demands otherwise. Modifications of the above embodiments, further embodiments and modifications thereof will be apparent to the skilled person on reading this disclosure, and as such, these are within the scope of the present invention. All documents and sequence database entries mentioned in this specification are incorporated herein by reference in their entirety for all purposes. “and/or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, “A and/or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein. Experimental Strains and growth conditions For routine growth, the E. coli and Burkholderia strains were incubated at 37 °C, whilst S. cerevisiae and the Paraburkholderia strains were revived at 30 °C. Following chemical transformation of E. coli with the plasmid constructs, LB (Luria-Bertani) media supplemented with 50 µg/mL trimethoprim or kanamycin was used for selection. Where minimal media were required, M9 (Atlas, 2010) was used for the E. coli and basal salt media with glycerol (BSM-G) (Hareland et al., 1975, Mahenthiralingam et al., 2011) for Burkholderia and Paraburkholderia. Pea exudate media (PEM) was prepared as described (Mullins et al., 2021). A collection of 19 environmental Paraburkholderia was assembled after sampling the rhizosphere and soil of forest floor plants in Bornean Jungle as described in Alswat, 2020. The sampling and initial culture of this collection was carried out with permission from the Sabah Wildlife Departmental, Sabah, Malaysia, and took place in August 2008, prior to the Nagoya protocol. The collection of 43 Paraburkholderia reference strains and novel isolates from the natural environment that were screened as potential heterologous expression hosts is described in Table 3. Such strains may be obtained from Organisms and the Environment Division, Cardiff School of Biosciences, Cardiff University, UK. The bacterial and yeast strains used in the study are given in Table 1. Microbial strains used for polyyne susceptibility testing and the antagonism assay conditions are provided in Table 1. Plasmids used in this study are provided in Table 2. All experiments were performed in at least three independent biological replicates unless stated otherwise. Yeast adaptation of pMLBAD vector in Saccharomyces cerevisiae The yeast fragment containing the replication origin 2µ and the orotidine‐5′‐phosphate decarboxylase gene URA3 (2867 bp) was amplified from pE-YA plasmid (Pahirulzaman et al., 2012) (Table 2) using Q5 ^® High-Fidelity DNA Polymerase (NEB). The PCR primers were designed to incorporate 30 bp overlap with the pMLBAD vector backbone. The E. coli-Burkholderia cloning plasmid pMLBAD was linearised with AseI (NEB) and transformed into S. cerevisiae YPH500 alongside the yeast fragment PCR product, using the LiOAc yeast transformation method previously described (Pahirulzaman et al., 2012). The transformation mixture was plated on synthetic media (SM) containing 0.68% yeast nitrogen base without amino acids, 2.0% D-glucose, 0.077% complete supplement mixture drop-out URA (Formedium), 1.5% bacteriological agar 1 (Oxoid), and incubated at 30 °C for 3-4 d until yeast colonies appeared. Plasmids were extracted from the yeast using Yeast Plasmid Miniprep (Zymo Research) and transformed into E. coli DH5α. The transformed E. coli were screened for the presence of the yeast fragment by colony PCR. luxCDABE and polyyne pathway cloning using yeast-adapted pMLBAD in S. cerevisiae Prior to each transformation, pMLBAD_yeast plasmid was digested with HindIII and EcoRI (NEB). The polyyne pathways were PCR amplified in three overlapping fragments, whilst the luxCDABE operon in two overlapping fragments, and overlap was 30 bp between the fragments and the vector backbone as appropriate. The cepacin fragments were amplified from genomic DNA of Burkholderia ambifaria BCC0191, the caryoynencin fragments from Burkholderia gladioli BCC1697 and luxCDABE fragments from mini-Tn5 luxCDABE plasmid (Winson et al 1998). Q5 ^® High-Fidelity DNA polymerase was used to amplify the PCR fragments for each construct. The yeast transformation for each construct was performed as described above, with the yeast plasmids extracted and used to transform E. coli DH5α. Colony PCR with DreamTaq Polymerase (ThermoFisher Scientific) was used to confirm the presence of the correct constructs. The construction of the plasmids was further confirmed by restriction digest and Sanger sequencing (Eurofins, UK) of a portion of the operon immediately downstream of pBAD promoter. Yeast homologous recombination was also used to replace the araC-pBAD portion of the plasmid polyyne constructs with the native promoter of each polyyne cluster. Briefly, a kanamycin resistance cassette and the polyyne native promoter were PCR amplified with 30 bp homologous regions between them and with the plasmid backbone either side of the araC-pBAD region. The homologous recombination in yeast yielded a polyyne construct with the native promoter directly upstream of the corresponding polyyne gene cluster and a kanamycin resistance cassette to allow for the selection of the correct constructs in E. coli. Triparental conjugation of plasmid constructs in Burkholderiales All the constructs were transformed or mobilised in Burkholderia and Paraburkholderia using the triparental conjugation mating with E. coli DH5α containing the construct of interest and E. coli HB101 containing the helper plasmid pRK2013 (Craig et al., 1989). The selection conditions were 150 µg/mL trimethoprim and 600 units/mL polymyxin for the Burkholderia species, P. phytofirmans and P. bannensis BCC1915. The transconjugants selection for Paraburkholderia BCC1909 and P. tropica BCC1950 was performed using modified basal salt media with 0.2% (w/v) sodium citrate as the sole carbon source. In all cases successful conjugation was confirmed by colony PCR with the same primers used to confirm the presence of the constructs in E. coli. The identity of the transconjugants was confirmed by Sanger sequencing (Eurofins, UK) of the 16S rRNA gene, amplified with the 27F and 1492R universal primers. Luminescence assay for pBAD regulation characterisation Luminescence assays were performed using a Tecan Infinite 200 PRO microplate plate reader for the bacteria harboring the luxCDABE operon downstream of pBAD. Overnight cultures of strains containing pMLBAD_yeast_luxCDABE or pMLBAD_yeast_luxCDABE_rev were grown for 20-hours at 30°C on a rocking platform (50 rpm) in minimal media containing 25 μg/mL trimethoprim; modified BSM-G media without yeast extract or casamino acids was used for the Burkholderia and Paraburkholderia species. The cultures were then diluted to ~ 1 x 10 ⁶ cfu/mL in test media. Test media employed was minimal media with 25 μg/mL trimethoprim supplemented with either 0.2%(w/v) D-glucose or L-arabinose at a concentration range 0.05% to 1.0% (w/v). The cultures were grown for 24 h at 30 °C in clear flat-bottom 96-microwell plates (200 µL per well; 4 technical replicates) on a rocking platform and the optical density OD ₆₀₀ of the bacterial suspension was measured. The bacteria were then transferred to a white LUMITRAC flat-bottom 96-microplate, incubated in the dark for 10 minutes, followed by a 5 sec orbital shake and measurement of the relative light units (RLU). Each RLU measurement was divided by the corresponding OD ₆₀₀ to normalize for differences in cell densities. Response ratio for each strain under each test condition was calculated by dividing the normalised RLU value of the strain harbouring the pMLBAD_yeast_luxCDABE by the normalised RLU of the same strain containing pMLBAD_yeast_luxCDABE_rev. Plasmid copy number determination by qPCR Plasmid copy number of the polyyne and empty vector constructs in the heterologous hosts was estimated by quantitative PCR performed using Agilent Mx3000P qPCR System. Total DNA of each strain was extracted from an overnight culture in TSB supplemented with 50 µg/mL trimethoprim using the Maxwell® 16 Tissue DNA Purification Kit; 2 ng DNA was used as template in the qPCR reaction. Two sets of qPCR primers were used: one set targeting a 143 bp portion of the chromosomally encoded single copy rpoD gene (Ogier et al., 2019) and set targeting 173 bp from the 2µ region of the pMLBAD_yeast plasmid. The copy number of the rpoD gene and 2µ was determined from a standard curve and plasmid copy number calculated by dividing the 2µ by the rpoD copy number. The standard curve was generated using 1011 bp rpoD standard, amplified from the genomic DNA of Burkholderia cenocepacia J2315, and 1115 bp 2µ standard, amplified from purified pMLBAD_yeast vector; amplification efficiencies for both were 91-96%. Plasmid stability in the absence of antibiotic selection Overnight cultures of strains labelled with the pMLBAD_yeast_luxCDABE construct were grown for 20 hours in 30°C on a rocking platform (50 rpm) in minimal media containing 25 μg/mL trimethoprim; modified BSM-G media without yeast extract was used for the Burkholderia and Paraburkholderia species. The cultures were diluted to ~ 1 x 10 ⁶ cfu/mL in minimal media supplemented with 0.2% (w/v) L-arabinose and 25 μg/mL trimethoprim, grown for 24 h at 30°C in clear flat-bottom 96-microwell plates (200µL per well; 4 technical replicates) followed by OD ₆₀₀ and luminescence measures as described above to obtain initial measurements (day 0). The 4 technical replicates were then pooled, washed twice with sterile PBS to remove traces of antibiotic, diluted to ~ 1 x 10 ⁶ cfu/mL in antibiotic- free minimal media containing 0.2% (w/v) arabinose and grown 24 h at 30°C in clear flat-bottom 96- microwell plates prior to obtaining the OD ₆₀₀ and luminescence measurements for day 1. The process was repeated for 3 days/passages in total. After each passage, the cultures were serially diluted and enumerated via drop counts on TSA plates with and without antibiotic (50 μg/mL trimethoprim) in order to calculate percentage of resistant colonies. Confirmation of metabolite production by heterologous host using high-resolution mass spectrometry High-resolution mass spectrometry was performed as described in Mullins AJ, et al (2019) and Mullins AJ et al (2021) to confirm the identity of the metabolites, Quantification of polyyne production using HPLC Overnight cultures of strains were grown at 30°C on a rocking platform in tryptone soya broth (TSB), supplemented with 50 µg/mL trimethoprim. The cultures were adjusted to ~ 5 x 10 ⁸ cfu/mL and 7 x 20 µL streaks of the bacterial culture applied to solid test media containing 25 µg/mL trimethoprim. Following a three day incubation at 22 °C, the bacterial growth was removed with a sterile cell lifter, placed on pre-weighed nitrocellulose filter, dried at 80°C for 24 h and the dry biomass weight recorded.20 mm discs were excised from each agar plate and metabolites were extracted from the agar piece by incubation in 0.5 mL extraction solvent for 2 h with gentle shaking. Ethyl acetate (EtOAc) was used for the extraction of cepacin, whilst dichloromethane (DCM) was used for caryoynencin (Webster et al., 2020). HPLC analysis was conducted as previously described (Webster et al., 2020). Temperature differential growth dynamics of Paraburkholderia panel Master plates of the Paraburkholderia strains panel (Table 3) was prepared by growing the strains in a 96-microwell plate format in TSB for 20 hours at 30°C on a rocking platform (50 rpm); 8% DMSO was added as a cryoprotectant, and the plates frozen at -80°C until required for experiments. Prior to each growth experiment, a master plate was thawed, strains diluted 1:100 in BSM-G media and incubated at 30°C for 20 hours in a 96-microwell flat bottom plate; each master plate was subjected to maximum of 3 freeze-thaw cycles. Fresh BSM-G media was inoculated with ~ 1 x 10 ⁶ cfu/mL from the overnight cultures and 48-hour growth dynamics for the strain panel determined at both 30°C and 37°C using Bioscreen C instrument. Optical density readings at 420-530 nm were taken every 15 minutes, with 10 second orbital shaking prior to each reading. Bioactivity overlay and contact antagonism assays with native and heterologous hosts Test strains of native and heterologous polyyne hosts were tested for bioactivity against a range of susceptibility organisms using either an overlay (Mahenthiralingam et al., 2011, Mullins et al., 2019) or contact antagonism assay (Table 1). Overnight cultures of test strains grown at 30°C on a rocking platform in tryptone soya broth (TSB), supplemented with 50 µg/mL trimethoprim were adjusted to ~ 5 x 10 ⁸ cfu/mL. The adapted overlay assay (Mahenthiralingam et al., 2011) involved inoculating 2 µL (~1x10 ⁶ cfu) of each test organism at the centre of a 90 mm Petri dish and incubating at 22°C for 48 h. The bacteria were killed by exposing them to chloroform vapour for 3 minutes and overlaid with 15 mL half-strength iso-sensitest agar (Oxoid) seeded with ~ 1 x 10 ⁶ cfu/mL of susceptibility organism. The plates were incubated at the optimum incubation temperature and duration for each susceptibility organism (Table 1) and the diameter of the zones of inhibition measured in mm. The contact antagonism assay was performed as described with slight modifications (Tenorio- Salgado et al., 2013). Briefly, 6 mm diameter mycelial disc was excised from a 7-day old potato dextrose agar (PDA) culture of oomycetes and filamentous fungi tested, placed in the centre of a 90 mm Petri dish and incubated for 24 h at 22°C. The Petri dishes were the inoculated with 10 µL bacterial culture, adjusted to 5 x 10 ⁸ cfu/mL, in the form of four 15 mm long streaks placed 30 mm away from the centre of the mycelial disc; a control plate without bacteria was used for each susceptibility organism used. Following a 6-day incubation at 22°C, the bacterial antagonism was calculated percentage inhibition on mycelial growth as described (Tenorio-Salgado et al., 2013). The assay for P. ultium was slightly modified to account for faster growth of the organism – the bacterial streaks were inoculated to the Petri dish and incubated for 24 h at 22°C, following the addition of a mycelial disc from a 3-day old PDA Gl. ultium culture. The radial inhibition percentage was calculated following a further 48-hour incubation. Results Yeast-adapting the E. coli-Burkholderia pMLBAD vector The vector pMLBAD was selected as the basis for the transgene expression study due to its successful historical use in Burkholderia and E. coli, and its arabinose-inducible expression (Lefebre & Valvano, 2002). The first step in design was to adapt the vector to allow yeast-based recombination cloning (Pahirulzaman et al., 2012). The yeast 2µ origin of replication was derived from an endogenous 2µ plasmid, which is a high-copy, stable and non-selectable yeast plasmid (Ludwig & Bruschi, 1991). The URA3 gene encodes orotidine‐5′‐phosphate decarboxylase, allowing the survival of a URA3-deficient strain of S. cerevisiae in the absence of uracil (Boeke et al., 1987). These yeast markers were amplified from the yeast plasmid pE-YA and cloned into pMLBAD to give the yeast- adapted vector, pMLBAD_yeast (Fig.1A). Expression of luxCDABE pathway from yeast-adapted pMLBAD vector Having yeast-adapted the pMLBAD vector, our next step was to show that this can express transgenes under arabinose-based induction. The reporter system selected for this was the Photorhabdus luminescens luciferase operon luxCDABE (Winson et al., 1998), which consists of five genes, with luxA and luxB encoding a heterodimeric luciferase, whilst luxC, luxD and luxE encode the enzymes responsible for the biosynthesis of the luciferase substrate (Close et al., 2012). Using yeast recombination, the promoterless luxCDABE gene cluster was cloned in pMLBAD_yeast downstream of the pBAD promoter, in two fragments (luxCD and luxABE), with 30 bp overlap between them, to make pMLBAD_yeast_luxCDABE (Fig.1A). A construct containing the luxCDABE operon in reverse orientation to the pBAD promoter, pMLBAD_yeast_luxCDABE_rev (Fig.1A), was also assembled to act as a control for the background luminescence due to read through transcription. The pBAD promoter of pMLBAD has been shown to be activated by addition of 0.2% (w/v) arabinose and supressed by addition of 0.2% (w/v) glucose in both E. coli and Burkholderia (Guzman et al., 1995, Lefebre & Valvano, 2002). This regulation was assessed in heterologous hosts, B. ambifaria, B. vietnamiensis, and P. phytofirmans, using the pMLBAD_yeast_luxCDABE construct as a positive expression control, prior to the more complex polyyne BGC cloning. The expression of the luciferase operon under the pBAD promoter was assayed by comparing the response ratios (see Methods) at different concentrations of L-arabinose and in the presence of D-glucose (Fig.1B). In E. coli, the basal level response ratio in the absence of L-arabinose or D-glucose, increases 100-fold when arabinose is added at a concentration 0.05% (w/v) (Fig.1B). Further increasing the arabinose concentration to 1.0% did not yield significant increase in the response ratio in this host species (Fig.1B). Adding 0.2% (w/v) glucose significantly (p < 0.001; one-way ANOVA; F4,10=9.692) suppresses the pBAD promoter in E. coli from the basal uninduced level, consistent with previous reports on pBAD promoter regulation in E. coli (Winson et al., 1998). To our knowledge, there are no previous studies exploring the regulation of pBAD in Burkholderia ambifaria or Paraburkholderia phytofirmans. pBAD regulation performed in the species B. cepacia and B. vietnamiensis strains showed that addition of 0.2% (w/v) L-arabinose leads to activation from baseline and addition of 0.2% (w/v) glucose to repression, measured by GFP fluorescence (Lefebre & Valvano, 2002). Our results demonstrate that addition of 0.05% (w/v) arabinose leads to an increased response ratio from basal level in all the Burkholderia strains studied (Fig.1B). Increasing the arabinose concentration above this did not lead to significant increases in lux response ratio; in P. phytofirmans PsJN 0.05% L-arabinose yielded greater response ratios than 1.0% arabinose (p < 0.001; one-way ANOVA; F4,10=198.2). Interestingly, our results also suggest that the addition of 0.2% D-glucose does not suppress the pBAD promoter below the basal level in the 3 Burkholderia species examined; in the case of B. ambifaria BCC1105 and B. vietnamiensis G4, the presence of glucose led to significant increases in response ratio (Fig.1B). Since the addition of concentrations of L-arabinose above 0.05% did not lead to any significant increase in the response ratio, we explored the possibility that the increased arabinose concentrations may have led to promoter induction, but the higher expression levels of the luxCDABE caused toxicity and cell death. However, comparison of viable cell numbers for all the pMLBAD_yeast_luxCDABE constructs did not show this was occurring. Cepacin and caryoynencin BGC cloning and heterologous expression For the construction of pMLBAD_yeast_pBADcep and pMLBAD_yeast_pBADcay, the 13 kb cepacin gene cluster (Fig.2A) from B. ambifaria BCC0191 (Mullins et al., 2019) and the 11 kb caryoynencin gene cluster (Fig.2A) from B. gladioli BCC1697 (Jones et al., 2021) were PCR-amplified and cloned into pMLBAD_yeast (Fig.2B). Cloning of the biosynthetic pathways was carried out using a design which incorporated 6-9 bases upstream of the first ATG codon of the operon and placed the promoterless gene cluster downstream of the pBAD promoter. The already optimised Shine Dalgarno of pMLBAD (Lefebre & Valvano, 2002) was used for both constructs. Multiple constructs containing the cepacin and caryoynencin BGC were obtained, and one from each experiment was evaluated for heterologous expression in Burkholderia and Paraburkholderia hosts as described above. The B. ambifaria BCC1105 and P. phytofirmans PsJN hosts containing the cloned cepacin and caryoynecin BGCs gained new antagonistic activity against S. aureus (Fig.3A), a bacterium specifically susceptible to polyynes (Mullins et al., 2019). Comparative LC-MS analyses confirmed that cepacin and caryoynencin are produced by the recombinant P. phytofirmans PsJN (Fig.3B and 3C) and B. ambifaria BCC1105 (Fig.4C and 5C) strains. Following successful expression of the cepacin and caryoynencin BGCs under the pBAD promoter in Burkholderia and Paraburkholderia host backgrounds, replacement of the arabinose promoter for the native promoter for each polyyne cluster was carried out as shown (Fig.6A). Heterologous expression driven by the native promoter enabled further comparison of polyyne production on different growth media, including a biomimetic pea exudate medium (PEM) (Mullins et al., 2021), without the need of supplementation with L-arabinose (Fig.6B, C). Since the polyynes are challenging to quantify due to their inherent instability (Ross et al., 2014; Mullins et al., 2021), a semi-quantitative method of comparing HPLC peak areas was employed (see Methods). The HPLC peak area of the native polyyne producer on a well characterised specialized metabolite induction growth medium, BSM-G pH 7 (Mullins et al., 2019; Mahenthiralingam et al., 2011), was taken as a benchmark from which the induction level of all the other metabolite peak areas was evaluated (Fig.6B, C). Greater quantities of caryoynencin and cepacin were produced by the native producers, B. gladioli BCC1697 (Fig.3B) and B. ambifaria BCC0191 (Fig.6C), respectively, when grown on BSM-G compared to PEM; the difference was particularly striking in B. gladioli BCC1697 with 28-fold more caryoynencin produced on BSM-G medium (Fig.6B). Polyyne production by the heterologous hosts was also dependent on the medium type. The heterologous production of caryoynencin by the three heterologous hosts grown on BSM-G was between 18-fold (P. phytofirmans PsJN) and 3-fold (B. ambifaria strains) lower than the native producer B. gladioli BCC1697 (Fig.6B). However, the normalised peak areas obtained on the biomimetic PEM were comparable between the native and heterologous hosts (Fig.6B). It was also interesting to observe that the caryoynencin BGC is expressed in B. ambifaria BCC0191, the native cepacin producer, and results in the recombinant strain producing both of the polyyne compounds. The production level of cepacin in P. phytofirmans PsJN and B. ambifaria BCC1105 when grown on BSM-G was also lower than the native host B. ambifaria BCC0191 (Fig.6C). pMLBAD_yeast stability and copy number in heterologous hosts Overall, the pMLBAD_yeast vector proved to be suitable for the heterologous of expression of polyyne BGCs under the control of both the arabinose-inducible and native promoters. Next, we investigated the stability of the shuttle vector in the absence of antibiotic selection, using the luxCDABE construct which provided a direct readout of functional pathway expression efficacy as a reporter construct. Both light emission (Fig.7A) and the number of viable bacterial cells carrying the plasmid resistance marker (Fig.7B) diminished within 3 days for both the Burkholderia and Paraburkholderia hosts; in constrast the luciferase carrying plasmid remained stable in E. coli (Fig.7). Using quantitative PCRs targeting the plasmid versus chromosome of each host, the copy number of the pMLBAD_yeast vector and recombinant polyyne pathway clones was found to vary between 2 and 19 copies per cell, dependent on the strain, host species and the specific construct. The copy number of all constructs in P. phytofirmans never exceeded 3, but in B. ambifaria the empty vector was at 18 copies per cell in strain BCC1105, with the cepacin construct reaching a copy number of 11 in the same host (Fig.7C). Bioactivity of native and heterologous polyyne-producing hosts The bioactivity of the P. phytofirmans PsJN containing the cepacin and caryoynencin BGCs was compared to that of the native producers B. ambifaria BCC0191 and B. gladioli BCC1697, respectively, under a range of growth conditions (Fig.8). Native producers with insertional mutations in the fatty acyl-AMP ligase gene of both the cepacin (B. ambifaria BCC0191::ccnJ) (Mullins et al., 2019) and caryoynencin BGCs (B. gladioli BCC1697::cayA) (Jones et al., 2021), were also included in the assays as negative production controls. Trimethoprim selection was maintained in all experiments and an empty vector control used to enable comparison of polyyne expression in wild type strains under this selection. As the expected baseline, P. phytofirmans PsJN containing only the empty vector had no bioactivity against susceptible bacteria and fungi (Fig.8). The cepacin BGC-containing P. phytofirmans PsJN_NPcep exhibited bioactivity that was comparable to the native producer B. ambifaria BCC0191, against Staphylococcus aureus, Zymoseptoria tritici and Corynespora cassiicola when grown at BSM- G pH5 media (Fig.8). This was in line with the observation that low heterologous production levels of cepacin for the BGC under the control of the native promoter occurred in the heterologous hosts (Fig. 6C). However, P. phytofirmans PsJN containing the cepacin BGC under control of the pBAD promoter exhibited comparable cepacin production levels (Fig.9B) and bioactivity (Fig.9A) to the native cepacin producer B. ambifaria BCC0191, demonstrating that greater heterologous expression in Paraburkholderia can be achieved if the BGC is placed under the control of a suitable promoter. The native cepacin producer B. ambifaria BCC0191, possessed broad anti-bacterial and anti-fungal activity under all conditions, reflecting antagonism as a result of the production of the polyyne and other antimicrobials (Fig.8). This was demonstrated by the insertional mutant, BCC0191::ccnJ still possessing residual bioactivity (Fig.8), corroborating previous results that the strain possesses multiple BGCs encoding potential antimicrobial metabolites (Mullins et al., 2019,). The bioactivity gained by P. phytofirmans PsJN containing the caryoynencin BGC was much broader than that seen with the strain containing the cepacin BGC, matching the overall bioactivity spectrum of the native producer B. gladioli BCC1697_EV, but not showing the same outright antagonism levels against the bacterial and fungal susceptibility test organisms (Fig.8). Disruption of the caryoynencin BGC in the native B. gladioli host (B. gladioli BCC1697::cayA) did not eliminate bioactivity, correlating to previous analysis demonstrating the strain produces multiple antimicrobials (Jones et al, 2021). Overall, the successful introduction of potent antagonism towards a range of bacterial and fungal plant pathogens by heterologous expression of polyyne BGCs in P. phytofirmans PsJN validated that our strategy to create novel Paraburkholderia biocontrol strains is feasible. Temperature-dependent differential growth of Paraburkholderia strains Following the successful heterologous expression of polyyne BGCs in P. phytofirmans PsJN as model plant beneficial Paraburkholderia strain (Sessitsch et al., 2005), we screened a panel of 42 additional Paraburkholderia (representing 27 further species; Table 3) for preferential growth at 30°C over 37°C (Fig.10). This was carried out to characterise additional Paraburkholderia for use as heterologous expression hosts, and specifically identify those with reduced potential for opportunistic pathogenicity. Out of the total of 43 Paraburkholderia (including P. phytofirmans) strains screened, 12 had significantly (p < 0.01, unpaired t-test) lower growth (carrying capacity and area under the growth curve) at 37°C compared to 30°C. Reduced capacity for growth at 37°C was observed in 7 of the 27 Paraburkholderia species examined and was a common phenotype for P. tropica (5 of the 12 strains of this species showed defective growth; Fig.10 and Fig.11). Four of the strains with defective growth at 37°C were characterised reference strains (P. aspalathi LMG 27731, P. caffeinilytica LMG 28690, P. gisengisoli LMG 24044, see Fig.11; and P. phytofirmans PsJN LMG 22146, see Fig.12A), whilst the remaining eight were isolated from the Bornean jungle (P. bannensis BCC1915, P. bannensis BCC1914, Paraburkholderia species BCC1909, P. tropica BCC1950, P. tropica BCC1924, P. tropica BCC1925, P. tropica BCC1927, P. tropica BCC1933). The growth curves for 11 of the 12 strains showed considerable growth impairment at 37°C (Fig.12A; Fig.11), while a complete inhibition of growth was seen with P. bannensis strain BCC1915 (Fig.12A). Three of the Paraburkholderia strains with temperature preferential growth at 30°C over 37°C were selected as potential heterologous hosts for polyyne BGC expression: P. bannensis BCC1915, P. tropica BCC1950 and Paraburkholderia sp. BCC1909 (Fig.12A). All three were genetically amenable to mobilization of the empty vector and the construct containing the caryoynencin BGC, including P. bannensis BCC1915, the strain with no observable growth at 37°C, but possessed a normal sigmoidal growth at 30°C (Fig.12A). Examination of cellular viability measured at the 48-hour end-point of the growth curve, demonstrated that it was significantly higher for all 3 heterologous hosts strains at 30°C than at 37°C, with a 3-log difference seen for P. bannensis BCC1915. Caryoynencin was produced by all three novel Paraburkholderia heterologous hosts and they were bioactive against S. aureus (Fig. 12B). and the oomycete Globisporangium ultium (Fig.12C). A novel integrative vector approach to creating metabolite expressing Paraburkholderia This approach to genetic modification of Paraburkholderia has the added benefit of creating a stable integrated version of the pathway of interest within the host strain. Genetic constructs of the polyyne pathway (or another metabolite pathway of interest) were made using yeast recombination in Saccharomyces and assembled into a novel integrative vector construct. The integrase vector was assembled by transforming six PCR amplified fragments, containing 40 base pairs overlap between one another (Fig.13), in S. cerevisiae yeast strain YPH500 using a previously described method (Pahirulzaman et al., 2012). The assembled integrase vector (Fig.14) was verified by short-read Illumina sequencing. The details of the origin of the fragments making the integrase vector can be found in Table 2. The resulting integrative vector is based on a published genetic construct but has been modified to enable genetic modification and recombination within yeast, selection in Burkholderia and Paraburkholderia using a trimethoprim resistance cassette, and ultimately a means to excise the resistance gene cassette and other genetic material outside of the biosynthetic cluster of interest. This enables the construction of a new Paraburkholderia strain carrying only the biosynthetic cluster of interest such as a polyyne from Burkholderia and no other genetically modified DNA. The integrase vector (figure 14) was used to clone the and express the caryoynencin BGC within Paraburkholderia phytofirmans PsJN. The recombinant P. phytofirmans showed stable expression of caryoynencin. It was also found to protect peas against damping off at comparable rates to the originally characterised cepacin producing Burkholderia ambifaria BCC0191 biocontrol strain (see Mullins et al.2019) as shown in Figure 15. Building on the finding that P. phytofirmans protects against damping off when expressing caryoynencin, a further recombinant construct was made to express the pyrolnitrin gene cluster. The integrase vector was initially modified to encode a tetracycline resistance gene cassette to give versatility in selection of recumbent clones (the initial integrase vector constructed has trimethoprim selection and this was swapped out for the pyrolnitrin construct). The pyrolnitrin BGC was cloned using yeast recombination as shown (Figure 13), and recombinant P. phytofirmans PsJN identified to produce the metabolite. The P. phytofirmans carrying the pyrolnitrin gene cluster was tested using the pea damping off biological control model and found to produce control of the disease and enable the plants to germinate at levels comparable to P. phytofirmans expressing caryoynencin. Ability to stably modify other Paraburkholderia strains with the pCTX yeast vector system Successful biological control after stably expressing the caryoynencin pathway in P. phytofirmans PsJN by use of the pCTX-based integrative vector was achieved as above (Figure 15). Heterologous expression of caryoynencin was also achieved in P. bannensis BCC 1915, P. tropica BCC1950 and Paraburkholderia sp. BCC1909 using the plasmid-based pMLBAD_yeast_polyyne construct (see Figure 5). We have now shown that all the Paraburkholderia strain candidates can be successfully engineered with the integrative pCTX vector and stably express a green fluorescent protein (GFP) as a test expression system (Table 7). We expect that these strain candidates should all also accept the caryoynencin encoding pCTX1_yeast_NPcay integrative construct and stably express the polyyne as had been seen with the plasmid-based pMLBAD_yeast_pBADcay (Figure 5; panel F BCC1915; panel G, P. tropica BCC1950; and panel H, Paraburkholderia species BCC1909). Paraburkholderia biopesticides show no pathogenicity towards damaged plants The restricted ability of the Paraburkholderia strains grow at 37°C demonstrates they are unlikely to cause human or mammalian infections (Figures 10, 11, and 12). In addition, we now have evidence that they do not show pathogenicity towards damaged plants (mushroom rot, onion rot and virulence towards Alfalfa) and this is summarised in Table 8. Each Paraburkholderia was compared against the original Burkholderia strains that produce each respective polyyne (Burkholderia ambifaria BCC191 – cepacin and Burkholderia gladioli BCC0238 – caryoynencin). The mushroom rot assays were carried out as described in Jones et al. 2021. None of the Paraburkholderia strains demonstrated the ability to rot this commercially important crop (Figure 16; Table 8). The onion rot assays were also carried out using the same protocols as described in Jones et al.2021. The Paraburkholderia did not have the ability to rot this important vegetable crop (Figure 17). Overall, both rotting phenotypes are seen widely with Burkholderia species and the lack of plant rotting traits in Paraburkholderia is advantageous for their future development as biopesticides which are safe in relation to plant damage. The ability to infect injured Alfalfa has been used widely as a model to identify plant pathogenicity traits in Burkholderia (Bernier et al.2003). In this model, Alfalfa plants are injured by wounding with a sterile 20-gauge needle 7 days after germination and then infected with a standardised dose of bacteria (10 seedlings per group). The wounded seedlings were incubated at 30°C for 48 hours (in the dark) before being transferred to a windowsill where they were left at room temperature for 5 days. Clear evidence of infection and seedling death was observed with the B. gladioli pathogenicity control (strain BCC0238; Figure 18). No evidence of pathogenicity was observed in any of the Paraburkholderia heterologous hosts. Paraburkholderia show the ability to promote seedling root growth A biopesticide which has both plant-protective and plant-growth promotion properties is commercially more desirable. Observation of the injured Alfalfa seedlings that had been exposed to bacteria as shown (Figure 18), demonstrated that not only were Paraburkholderia nonpathogenic, but in fact they significantly stimulated the growth of additional lateral roots (Figure 19). Surprisingly this demonstrates an additional effect; that the Paraburkholderia strains which can be engineered for protection against damping-off, will also act in a biostimulatory manner for germinating plants. Paraburkholderia strains interact extensively with plant roots The ability of biopesticide strains to colonise the crop rhizosphere is vital for targeted protection and plant biostimulation. All the Paraburkholderia strains described herein were originally isolated from the rhizosphere of jungle-floor plants in Sabah, West Malaysia, (see Petrova et al., 2022, and Alswat A 2020). Their ability to specifically interact with the plant rhizosphere was evaluated using an in vitro root colonisation assay with the model plant species Arabidopsis thaliana. The Arabidopsis model was originally developed and described and used to demonstrate that rhizosphere colonisation is an inherent trait of Burkholderia bacteria by Vidal-Quist et al.2014. In parallel with previous observations (Vidal-Quist et al. 2014) Paraburkholderia phytofirmans strain PsJN was observed to interact extensively with the Arabidopsis root system (Figure 20). In addition all the Paraburkholderia biopesticide candidate strains also colonised the Arabidopsis roots rapidly, with the plant’s roots penetrating the bacterial seeded agar extensively (Figure 20). Over the same timeframe, root interaction and colonisation by a caryoynencin-producing B. gladioli strain and a cepacin producing B. ambifaria strain was much less extensive (Figure 20). Paraburkholderia strains interact endophytically with plants Multiple Paraburkholderia species have been characterised as endophytes that grow within the root systems of different plant species. The ability of a bacterial biopesticide to interact as an endophyte with its host crop species is considered commercially beneficial because it enables targeted delivery of the protective or biostimulatory properties it possesses. An endophytic biopesticide mode of action may also allow less of the biopesticide to be used and reduce its potential for dispersal beyond the target crop. The ability to interact as plant endophytes was not known for Paraburkholderia strains BCC1909, BCC1910, BCC1914, and BCC1950. Using the model plant species Arabidopsis thaliana, the interaction of GFP-labelled Burkholderia and Paraburkholderia bacteria was assessed by confocal microscopy. The Paraburkholderia heterologous hosts all demonstrated extensive endophytic interaction with Arabidopsis roots (Figure 21). The GFP labelled bacteria not only localised around the lateral root junctions, but will also seen throughout internal structures of the plant root system (Figure 21). In contrast, B. gladioli BCC1967 and B. ambifaria BCC0191 were only observed to interact around the lateral root junctions of Arabidopsis, indicating that they possessed far less potential for endophytic interaction. Collectively these data demonstrate that Paraburkholderia can be engineered to express bioactive antimicrobial BGCs, and these bioactive microbials can be stably produced such that protection in biological control is achieved.

Table 1. Fungal and bacterial susceptibility organisms: assay type, incubation temperature and duration.

Table 2. Fragments for the integrase vector.

Table 3. Reference and novel Paraburkholderia strains.

Table 4 Location of genes within the cepacin BGC and SEQ ID NO:1 Table 5. Location of genes within the caryoynencin gene BGC and SEQ ID NO:2 Table 6 Location of genes within the pyrrolnitrin BGC and SEQ ID NO:3 Table 7 Ability to integrate the pCTX-vector and stably express green fluorescent protein in other Paraburkholderia prototype biopesticide strains

Table 8 Summary of the crop-rot and plant pathogenicity of Paraburkholderia heterologous hosts References Alswat A (2020) The biotechnological potential of natural populations of Burkholderiales bacteria for antibiotic production. PhD Thesis, Cardiff University. Antoine R & Locht C (1992). Molecular Microbiology 6: 1785-1799. Atlas RM (2010) Handbook of microbiological media. CRC Press, Boca Raton, FL. Barka EA, Belarbi A, Hachet C, Nowak J & Audran JC (2000) FEMS Microbiology Letters 186: 91-95. Bauman KD, Li J, Murata K, Mantovani SM, Dahesh S, Nizet V, Luhavaya H & Moore BS (2019) Cell Chemical Biology 26: 724. Bernier, SP, Silo-Suh, L, Woods, DE, Ohman, DE & Sokol, PA (2003). Infection and Immunity, 71(9): 5306-5313 Bilyk O, Sekurova ON, Zotchev SB & Luzhetskyy A (2016) Plos One 11. Boeke JD, Trueheart J, Natsoulis G & Fink GR (1987) Methods in Enzymology 154: 164-175. Bowers JH & Parke JL (1993) Phytopathology 83: 1466-1473. Close D, Xu TT, Smartt A, Rogers A, Crossley R, Price S, Ripp S & Sayler G (2012) Sensors 12: 732- 752. Craig FF, Coote JG, Parton R, Freer JH & Gilmour NJL (1989). Journal of General Microbiology 135: 2885-2890. Dalmastri C, Chiarini L, Cantale C, Bevivino A & Tabacchioni S (1999) Microbial Ecology 38: 273-284 Datsenko KA & Wanner BL (2000) Proceedings of the National Academy of Sciences of the United States of America 97: 6640-6645 Eberl L and Vandamme P. (2016) F1000Research 5. DOI: 10.12688/f1000research.8221.1 Figurski DH & Helinski DR (1979). Proceedings of the National Academy of Sciences of the United States of America 76: 1648-1652 Florez LV, Scherlach K, Gaube P, Ross C, Sitte E, Hermes C, Rodrigues A, Hertweck C & Kaltenpoth M (2017) Nature Communications 8.15172 (2017). https://doi.org/10.1038/ncomms15172 Frommel MI, Nowak J & Lazarovits G (1991) Plant physiology 96: 928-936. Guzman LM, Belin D, Carson MJ & Beckwith J (1995). Journal of Bacteriology 177: 4121-4130. Hareland WA, Crawford RL, Chapman PJ & Dagley S (1975) Journal of Bacteriology 121: 272-285. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST (2019). ACS Synth Biol 18;8(10):2372-2384. Holden MT, Seth-Smith Hm Fau - Crossman LC, Crossman Lc Fau - Sebaihia M, et al. (2009) Hwang ET, Ahn JM, Kim BC & Gu MB (2008) Sensors 8: 1297-1307. Jahn M, Vorpahl C, Hubschmann T, Harms H & Muller S (2016) Microbial Cell Factories 15. DOI: 10.1186/s12934-016-0610-8 Jeong Y, Kim J, Kim S, Kang Y, Nagamatsu T & Hwang I (2003) Plant Disease 87: 890-895. Jones C, Webster G, Mullins AJ, et al. (2021). Microbial Genomics 7. DOI: 10.1094/pdis.2003.87.8.890 Jones DA & Kerr A (1989) Plant Disease 73: 15-18. DOI: 10.1094/pd-73-0015 Joska TM, Mashruwala A, Boyd JM & Belden WJ (2014) Journal of Microbiological Methods 100: 46- 51. Khlebnikov A, Risa Ø, Skaug T, Carrier Trent A & Keasling JD (2000) Journal of Bacteriology 182: 7029-7034. Kunakom S & Eustaquio AS (2019). Journal of Natural Products 82: 2018-2037. Kunakom S & Eustaquio AS (2020) Acs Synthetic Biology 9: 241-248. Kurepin LV, Park JM, Lazarovits G & Bernards MA (2015) Plant Growth Regulation 75: 199-207. Kusumi T, Ohtani I, Nishiyama K & Kakisawa H (1987 Tetrahedron Letters 28: 3981-3984. Lefebre MD & Valvano MA (2002) Applied and Environmental Microbiology 68: 5956-5964. Lewenza S, Falsafi RK, Winsor G, Gooderham WJ, McPhee JB, Brinkman FSL & Hancock REW (2005) Genome Research 15: 583-589. Ludwig DL & Bruschi CV (1991) Plasmid 25: 81-95. Mahenthiralingam E, Song LJ, Sass A, White J, Wilmot C, Marchbank A, Boaisha O, Paine J, Knight D & Challis GL (2011) Chemistry & Biology 18: 665-677. Mao W, Lumsden RD, Lewis JA & Hebbar PK (1998) Plant Disease 82: 294-299. Masschelein J, Jenner M & Challis GL (2017) Natural Product Reports 34: 712-783. Masschelein J, Sydor PK, Hobson C, Howe R, Jones C, Roberts DM, Yap ZL, Parkhill J, Mahenthiralingam E & Challis GL (2019). Nature Chemistry 11: 906-912. Melamed S, Lalush C, Elad T, Yagur-Kroll S, Belkin S & Pedahzur R (2012). Microbial Biotechnology 5: 536-548. Mesureur, J., Feliciano, J. R., Wagner, N., Gomes, M. C., Zhang, L., Blanco-Gonzalez, M., van der Vaart, M., O'Callaghan, D., Meijer, A. H., & Vergunst, A. C. (2017). PLoS pathogens, 13(6), e1006437. Miotto-Vilanova L, Courteaux B, Padilla R, et al. (2019) International Journal of Molecular Sciences 20. DOI: 10.3390/ijms20225775 Mullins AJ, Murray JAH, Bull MJ, Jenner M, Connor TR, Webster G, Green A, Challis GL, Mahenthiralingam E (2019) Nature Microbiology 4: 996-1005. Mullins AJ, Webster G, Kim HJ, Zhao J, Petrova YD, Ramming CE, Jenner M, Murray JAH, Connor TR, Hertweck C, Challis GL, Mahenthiralingam E (2021). MBio 12(4). DOI: 10.1128/mBio.00715-21 Mullins, A. J. and Mahenthiralingam, E. (2021). Frontiers in Microbiology 12, Art No: 726847. (10.3389/fmicb.2021.726847) Nandi M, Macdonald J, Liu P, Weselowski B & Yuan Z-C (2018) Molecular Plant Pathology 19: 2036- 2050. Ogier J-C, Pagès S, Galan M, Barret M & Gaudriault S (2019) BMC Microbiology 19: 171. Oldenburg KR, Vo KT, Michaelis S & Paddon C (1997). Nucleic Acids Research 25: 451-452. Pahirulzaman KAK, Williams K & Lazarus CM (2012) Natural Product Biosynthesis by Microorganisms and Plants, Pt C 517: 241-260. Parke JL & Gurian-Sherman D (2001). Annual Review of Phytopathology 39: 225-258. Parker WL, Rathnum ML, Seiner V, Trejo WH, Principe PA & Sykes RB (1984) Journal of Antibiotics 37: 431-440. Parveen A, Smith G, Salisbury V & Nelson SM (2001) Fems Microbiology Letters 199: 115-118. Petrova, Y. D., J. Zhao, G. Webster, A. J. Mullins, K. Williams, A. S. Alswat, G. L. Challis, A. M. Bailey and E. Mahenthiralingam (2022) Microbial Biotechnology; https://doi.org/10.1111/1751-7915.14106. Pillay VK & Nowak J (1997) Canadian Journal of Microbiology 43: 354-361. Poupin MJ, Timmermann T, Vega A, Zuniga A & Gonzalez B (2013). Plos One 8. Rushton L, Sass A, Baldwin A, Dowson CG, Donoghue D & Mahenthiralingam E (2013) Antimicrobial agents and chemotherapy 57: 2972-2980. Ross C, Scherlach K, Kloss F & Hertweck C (2014) Angewandte Chemie-International Edition 53: 7794-7798. Sass AM, Schmerk C, Agnoli K, Norville PJ, Eberl L, Valvano MA & Mahenthiralingam E (2013). The ISME Journal 7: 1568-1581. Savary S, Ficke A, Aubertot JN & Hollier C (2012). Food Security 4: 519-537. Sawana A, Adeolu M & Gupta RS (2014) Frontiers in Genetics 5. Schimming O, Fleischhacker F, Nollmann FI & Bode HB (2014). Chembiochem 15: 1290-1294. Sessitsch A, Coenye T, Sturz AV, et al. (2005). International Journal of Systematic and Evolutionary Microbiology 55: 1187-1192. Sprouffske K & Wagner A (2016) BMC Bioinformatics 17: 172. Steinberg G (2015) Fungal genetics and biology : FG & B 79: 17-23. Stevens DC, Hari TPA & Boddy CN (2013) Natural Product Reports 30: 1391-1411. Szpirer CY, Faelen M & Couturier M (2001). Journal of Bacteriology 183: 2101-2110. Tenorio-Salgado S, Tinoco R, Vazquez-Duhalt R, Caballero-Mellado J & Perez-Rueda E (2013) Bioengineered 4: 236-243. Thongkongkaew T, Ding W, Bratovanov E, et al. (2018) Acs Chemical Biology 13: 1370-1379. Timmermann T, Armijo G, Donoso R, Seguel A, Holuigue L & Gonzalez B (2017). Molecular Plant- Microbe Interactions 30: 215-230. Vidal-Quist JC, O'Sullivan LA, Desert A, Fivian-Hughes AS, Millet C, Jones TH, Weightman AJ, Rogers HJ, Berry C & Mahenthiralingam E (2014) Microbiology-Sgm 160: 373-384. Webster G, Jones C, Mullins AJ & Mahenthiralingam E (2020) Journal of Microbiological Methods 178: 106057. Webster G, Parkes RJ, Fry John C & Weightman Andrew J (2004) Applied and Environmental Microbiology 70: 5708-5713 Winson MK, Swift S, Hill PJ, Sims CM, Griesmayr G, Bycroft BW, Williams P & Stewart G (1998). Fems Microbiology Letters 163: 193-202. Yamanaka K, Reynolds KA, Kersten RD, Ryan KS, Gonzalez DJ, Nizet V, Dorrestein PC & Moore BS (2014) Proceedings of the National Academy of Sciences of the United States of America 111: 1957- 1962. Zhang JJ, Tang XY & Moore BS (2019) Natural Product Reports 36: 1313-1332. Zhang JJ, Tang XY, Zhang M, Nguyen D & Moore BS (2017). Mbio 8. DOI: 10.1128/mBio.01291-17

SEQUENCES tcagaataaaagccccagcatcgccgccttgaccgcggcttcggtcttgttggtcgcgtt caacttgcgcattgcattga cgaggtgaaatttgacggtgcggtcgtcgacatgcatgattttgccgatctcggcgtagg ttttccccgcggcagaccat tgcagcgtctcgcgctcgcgagcagtcaactcgacggcatattcaggcacgaaccgcgcg agcagatgcatgctcatcgc atagttggccatgttcgcgagccatgacatctggtatcccttttccgcgagctcgcgctc gtcgatcggctcgcccgatc gcaccatggtcacgagtccgatcgccccggtgcggctgatggacggcatgcaccagccgt ggcgcaagccatggtgttcc gcctcgtcccagaactcgacactctgtgtctggctatcggcgcgccagatcaacgggctc atctgactgagaccatgccg caccgtcgggtcgacggcaaaatagttctggctcacatagcggtcgacccacgtctgcgg atagttggactgcagcatga actgcggcttgctgaccggcaacggaatgcgcagaccgaacgaacagtactcgaatccca gtgctcgcacgtcagccgtg aactccagaaacacgtcggcctcggattttgccgtcgcgtatccattcagatacttctct ctccaggcatgcatatcatt cccttgcggtcaatcttgcccacgaaggcgggctatatcgtgtggatggtgcgttgaccg gctttttcaacaaattattc aagagggaggctcattgtttcaagtatcgagtggcaagcatggtgtcgttcgtgaatttt ccgcgtgatggcggattcag gggaatccgcgctcgatattgatcgctcgaattgtgcggtttgcatgtgggcatggctac ttgtacatcctgataatgcg acggcattgttgggatgatctgtaataatcgcaaataatgtgcacacgattgcgccggct atcacgaatcacaacgcggg cgcgctacaagcgttgcaatggccttcgcctagccgatagccgcgaatcttgccaaacta tgcgacagcgattttaacag gtgccacgtcgagagaacggacatgccagaaaaactgaacgatggatacgtacgattgac cttgccggcgttttacgcgc tgcgcttccgtcagcatatgtgtgagcaagccccgaacgtgttgcatgacttgtggggcg agggcattagcgccgtcaat gccggctactacgaactggtctgcaccgaaacgcggccgaccgccagcgtcggctgcgta tggcatgtggcggtgggcca gtccgacgtgagggtcgggaagaacgacgtcagcagcaacgtgatgctcctcaacatgaa cggtgacgattacggagcgc gatacagccaggaattgatccagggctggctgtgctccggagttcgtcagcgcgaacttg aatcggccatcttcgcaggt tactgattttgtttttcaatgcatagggttatcttgcatgaaaccctatgcttcgcggca caccatatgtgccgctccgc cccctatttccgtcggtccccctgatcggtgtggcaatgtcgcgatgccggctacggccc tccgataatccagtgcgcgc cggcctgtccttccgcccgactcgcgtagcgttctcccgttgaattccgccccccgtttg cccggagtaatgtcccagcg cgctcgccgcgaagaatctcgcccgaacgcccgaccctgcccattcgggcagcttttttg acatggcaatttcgggtcca attcgcgctaacaattctgagatgagagagcgagggcatttacgatgctgactttattgt cgggaagaagcgctgatttg agtcgcgagacgatgaatcgacttgcggagtttcggcataaggtcttcatacaggaactc ggttggtcattacccaccgg cgacggcatcgaatttgacgacttcgatcacgcggacaccctctatgtggtcgctcgcga ccgcaacggcgaaatcgtcg gatgcggtcggctgctgccgaccgatgagccttatctgctcggtgaggtgttcccggatt tgatgggtggcgcatctctt ccccgtgcgcgcaacgtgtgggaactgtcccgcttcgcgatgagcatgccgcgcggcgag tcgttgaccgcggaagagtc gtggcaaaacacgcgcgccctgatgtccgaaatcgtccgtgtcgcgcatgcacatggcgc caaccgtctcattgccttct ccgtgctcggcaacgaacggctgctgaagcggatgggcgtcaacgtgcatcgcgctgctc cgccgcaaatgatcgacggc aagccgaccttgccgttctggatcgagatcgacgagcaaacgcgcgcggcgctgaatatc gacgcgctggaacacggcgt gccgttcaacctgtcgcgcgccctgcctatgtcgcacgcgttcggacaagcggtgtgaac gctcgatgcgcaccgggaag gacgacggtccgccgcagccgtgccccggtgcaatgaattaactcaaagggtgtgccctg aagatgaacagttttaacga cgtggctcggctgatcccggcccgaagggggaaggtgaaatgacgcttcgagtggtagta accggtatcggcattgtgtc cccattgggttgcggtaaggaattggtgtggcagcgcttgatcggaggaggctccgggct gcgccggctcggcgacgaca tcgtcgccgacctgcccgccaaggtcggcgggaccgtgcaggacaagaccgacgatcccg acggcgggttcgatcccgag ctttcggtgccgaacaaggaactgaggaagatggatcgcttcatccagatggcgatggtc gccgcggacgaggcgctcgc cgaagccggatgggcaccgcaaagcgagcatcagcgcgagcgcacggctacggtcgtcgc atcgggcatcggtggctttc ccggtctggcggaggcggtccggattggcgagacgcgtggtgtgcggcggttgtcgccgt tcaccattccgttctttctg tcgaatctggcggctggccagatttcgatcaagcatcggtttcgcgggcctctcggctgt cccgtgaccgcctgtgcggc gagtgtgcaggcaatcggcgatgcgatgcgtctgatccagaacggcgaggccgatgtcgt gctggccggcggcgccgaag cggccttcgacaaggtcagcctgggcggattcgcggcggcgcgcgcgctgtcgaccggtt tcggcgatcagccggttcgg gcgtcgcgcccgttcgaccgcgaccgtgacggcttcgtcatgggcgagggggccgcgatg ctggtggtcgagtcgctgga ccatgccgtcgcacgcggcgccagcccgatcgcggaaatcatcgggtacggaaccacggc ggacgcgtatcacatgaccg ccggacccgacgacggatccggcgccatgcgggcgatgaagctggcgctggcaatgggcg aggtcgccccggaacaggtg ggctacgtcaacgcccatgcgacttcgacgccagtcggcgactccggagaaatcgaggcg ctgaaaaccgtgttcggcgt gggtgccggcccggcgatttcatcgaccaagtcggcaaccgggcatttgcttggggcggc gggcgccattgaagcggcgt tttccattctcgcgctgcgcgatggcgtgatgcccggcacgctgaatctcgagcaccccg acgaagcggccgccggcctg gatctgatcgggccttccgcccggcacgttcccatcgagatcgcactgtcgaacgggttc gggtttggcggcgtcaatgc gtcggtgctgttcaaacggtacccgccggataggtcagcctcggcgcactgaacgcagac gttcacagttcgcgtgccat tcgccatttagaaaggattgcgaggcgtcggtaatcggcgctacgtcgcggtccgcaacc gcccccgccattcgatggcg agggcgcgtcacgtgcaatccgggttccagtcgtcatccaaggggaaaactttccgtgtt agacaccctcatcgtcggtg cccgctgcgcgggcgccacactcgcgattcatctggcgcgcgccggcaagcgcgttctgg cgatcgacgctggcaatctc ccgagcgaccagccactgtccacccactggatttcgccatacggcatggcgctgctggac gaactgtctctgggtgacaa ggtgcgcagcttcgcgccaccggtgcccagcatgatgtatggcgtcgacgaggtgaccgg ccgcatcgagtatccggtcg gcggacgttgctcgtgcccgcgacgcatggatctcgatgcgcttctgctggaggaggcgc gcacctcgggtgccgaggtc cgtacgcggaccaagctggtcggcctgctgcgcgacggcgggcgggtgacgggcgcggtg gtcgaacagggcggagcccg tgaagaaattcgggcgcgggtcgtggtgggcgcggacggtccgcactcgaccacggcgga actcgtcggcgccgacgagt atcacgactacgactgcccccgtgcgatttactgggcctactggccgcggccggactggt tcgacgacgatccacgctat cagggtggcgcgatgaactgcctcttcggcgacgatatcgtcttcgtctttccgaccaac cgcgacctgttgctgatcgg ggtggctttcgcgaaaacgcagttgccggagtggaaagggcgcgtgctcgaaaagctcat ggagacgctgagcgccaacc gtcacacggcgccgctgattaccggggcgcctgcgagcaaggtgctcggcgcgttgaagc tgcgctttttcttccgtcag gcggcagggccgggctgggccctggtcggcgatgcgggcctcttcatggacccgtccccc gggttcgggattaccgatgc gctgcgcgatgcacgcgcgctcggccgagcgattgtcgagggcggcgacgacgcgctggt gcgctactggcgtcagcgcg acgcgacctcgatcgacctgttcgaatactcgcgcggtcgcggcgccctcgaccacaaca acccgctcagccggatcctg tacggcaagctggcggccgatccggtgctgcaggcacgcttgctcgcttcgcagaatcgc gagtgctcgccgcttgcggt gttcgatcggagcgatatcaagcaatgggcagacgaggccgttgcgcgcggcgagatggg cgtaatccagccgttgatcg acatgtcccggcgaggcgaggcgatccgcgccgagatggcgttgcgccagcgtctgtccg aggaagcccgttccagccgg ccgcaagcgtccgagcctgacgagatcgaatcgttcgccgtcggcagcgatcacgacgtt cacgtgaaggagtccatatg agcgcgcaataccggtgcgtggtcgttgcggccacgcgatttcaagccacggcggggcac gttcgccactcgccggccct gcgtcgcgtaactcgaggagagacgctttgaccatcgaagccacgctggacagtgatctc gcactctcgcggctcaagct gccacgacacttccaccgaatcagttccgtcgccacgatcctctatctggcgcacgcgct cgcattcttcctgatcccgg ccgcggtggcgttcgccgtcgtcgatatcccggcgtcgacgccgacacgtattgccatgg cgatcgtcctgggcgtgatc ggcgggcacggcatgcacttgctgaccttcgtcgggcacgaggggatgcacacgaacctg catcgcaacaagtacgtgag cgccgcgcttgcgctcatctgctcgtcgctggtgcccggcttcctgatcgtcggcttcag catgacgcactggaagcacc atcgcttcaccggtcaggacatcgacccggatgtccagatctattcgcagtaccgcacat tctggtcgcgcttctttctc gcgcgctccacgggcgtgcggatctacctgaagaacgccatgcgcatggcggcggggctg ccctggccggagaacacccg gttgccgttcagccagcgcgaaatgcgctggatctcccggctcaatgttgcgttgaacct gtgcgcggtgacgacctacg ggttcatctggcatcgctcggtgtggttgggtttcacggtcatgctgattccgtatatcg gggtgtacgtgttcagcacg atccgcgcctacatcgagcatacggataccgtgccggggcgatatcgcgatagccgcagc tacacgtcgccgatctatac cgcgctgttcttcggcagcaattaccacctcgaacaccaccagtatccggccgtcccgtg ttatcggctgcccgcgctcc acgcgtatctggcgtcgcacgggctgttcgaggggacaggcgcgcaggtcgagccgtcct tccttggggcgttgcgttat acgacgggtcgcttccagtacccgtgcgtcaacctgcagtccgcgacggatgaattcctc gagcggatggcggacggtcg tctcgatcgcgaagcggccacggccgacgttcgggacggcgacgcgctggtcgccgtcgc gcgcaagtagaaacgatccg gtaggcacatgccagcctgaactcgggtccggtgtgccacaacgccactcctgtagcaaa gagaggaatcatgtttatcc agaatgcgtggtacgcagcagcactttccgacgaagtccagcgggagccctttgcgcgga cgatcctgaatcagaagatc gtcatgtaccgtacgttggcgaaccaggtcgtcgccctcgaggaccgatgcccgcaccgg caggttccgttgtcccgcgg gcgcgttgtcggtgacgatctccagtgctggtaccacgggctccggtacgactgctccgg cgcgtgcgtcagtattccga gccagagcacgatcccgaagggcgcgcgcgcgcgggcgttccccgccgtcgagaaatacg gcttcatctggctgtggacc ggcgagcctgaccaggccgacgaagcgacgatcccgaaccattgggtctgttcggcgccc gaactcgccgggaagatgag ctattgcaccatcgcgtgcagctacttgttcggcatcgacaacatcctcgacatctcgca cgccgcgttcgtgcatgcga agacgctgggttcgctcgacatcgtcgagacgccgcccgaaatcgtgatcaacgacgatg aagtccgcgtgcgccggtac ctgcgccgcgagaagacgccgccgctctacacccatatcctgaagctcgactacatcgac cgattccaggaggtcgtgta ctggcccatcggcaacacgcgggtcgaaacgcgggcgcacgcctgcgacgatgccagcgg ccaggtctaccacgtctaca cgacgacgatcttcacgcccgcgacggacacgacgacgcatgtcttcgtgggcatgcacc gcgatttcgacatcgacaac gaacggtttaccgagttcaccgcgaaggaagtgttcgccaccgtcatggaggacaaggac gtcgcggagagcctgcaggc gaactggagccccacggcgccgatgatcgacatccagctcgatcgaccggcgtttgccgc gcggcggatattggagcgaa tgggcgcgaacgcgtcgattcgagcagccgtatgacgcacgcagcggacgtatcgacgat caccgggaaggaaacgacga tgaatcaccaaggacgagccggtctctatgtcggcgagttgctgcgcgagctcgacacgt cggcgcaggacgaggtcagt ttgcggcatccgatgacgttcggagaaatcgtcggtcgcggccaggtcgagcgcctcgcg gctgccgccgaaggcatctt ctccgaggtcgagccgacacacgcgtggagcggcgccgatatcggcgggcgcgaatggca cggccgcttccaggaccgcc ggattcgcggcgtgacggtggcgcgccggttcggcacgcgcatccaggtcgacatcttcc tcggctcgtttcccgcgccg gtgcgccgggcgctgtatgacgcgagccgggatctcgtcgacgccaacgtgtggacgctg ccgccggggatcgataccgc gttgccgccggtacccgacgatgaagtgctggacgccaaattgccgttcggcatcaccga cgagatgtttctgaccagtc cggtggcgtgcaagccgattcgcggcagcgccgatgtcgagcgcgtttgcggccactcga tcgcggtctacggcgggcgt gcgagcggcccgcgtctgtcggccggcgcgacgacgctgagcctctggacaggcgaggtc ggcgggctgccgctggaagt ggcgaacgtcattcactgggaagatgcccagaacgtgaagggcatggcaatggcgatgcg cccgtggccggtcgtggcgc tctttcaagcgcggatgcgggcgcgaacgctgtcgtttctcgacacgtcgtatttcgaat ccgaatcgggcgacggcatg acgccgcttcagccgcgcgaggtataaggacatgaacggacccagcgtgctcactccgca ggcgcagtcgaacgccgttt caccgtggccggttttctggatcgcaagtgtggcggtgttcctcgtttcgatcgacgtca ccgtcctctacgcggcgttt cccgcgttgcgactggcgtttcccgatgcgcacccggccagcctgtcgtgggtgctgaac gcgtacacgctggtgttcgc cgcgttgctcgtaccggccggccgcctcgccgacctgcgcgggcgcaagcgcacattcct gcttggtctcgcgatgttcc tggcaggatcgttgggctgtggcatcgccacgcgtgtcgagatgctctgggcgatgcgcg ccgtgcagggagcaggcgcg gcgctgttgttgcctgcctcgctgtcgatcctgctggcggcattccccgtcaacaaacgg gcgatcgccgtgagcttgtg gggcgcggtcagcggggtggctggtgcgttggggccgagcctcggctcgttcctggtcga tcgcttcggctggccgtcag ccttctttctcaacctgccgctcggggcgatcgcgctatggcgcgggtggcgcattctcg acgagtcgcgtgatcccgag cggggcgcgccgctcgatctcgttggcgtcgtcttgctgatcctcggcgttggcgcgatt gctttcggtttggtgcagtc ggaggcggtcggctggacttcccctgcggtggcgctggcgatcgccggtgggctggtcat gctggcagcgttcgttgcat gggcgcgcacggcgcgcgccccggccatcgatctgtcgctgttccaggatcggacttact gctacatcaatctggcttcg ctgtgcttcgcgatcggcttcgcgatgatgtttttccagacgttcctgtttaccaccggt gtctggtcgtattcgctgac gcgtgcgggattggccggcagccccgggccgctgctcgtcgtccccacggcgatcgtgtg cggacggttcgcggcgcgcg cggggcaccggcttctgctggtgaccgggagcctgatctccacggcggcaagcgtatggt tcgcgttggtgcccggcgtc actcccgactatgtgcacgcgtggcttccgggggcgctgttgaccggactcggggtgggc atggtcatgcctgcgctgtc ggccgccgccgtcgcacatctgccgcctgcccgattcggcgtgggctcggccgtgaacca ggcgatacgccagatgggat cggtgttcggcgtggcgctgacggtcgcgataaccggcaacgcgatcgggcacctcacgg aattccgcaccctgtgttac ctgcagatcgcgctcggtctggccacggcaatcctgtgcgcgccggtggatacgcgaccg cgaacgctggcgcccgcgac ggcgcattgatggccgcgtgccggccagcgccggttggcgcatgacgctttcaccaaaac aaaacaacactaattatccg agggtctcacgatggccggtagcattcccccctccaccctgacggcggagcgcatgacct cgtctctgctcgacattctt cgagagcgggccgagcaaacgcctgagcggatcgcattccattttcttcgcgacggcgag gatgatgtcgtgagctggtc gtacggccagttcgccgccgctgctatccacgtgcgcgacagggtgctgcagcacgcgct gcacgaacggcgcgtattgc tgctgctcgaacccggcctgagctacgtcgcggcgttgttcggcatcctgctcgcgggcg ccaccgcggtgccttcgttt ccgcctgccggttctcgcgcggtggcacgcttcacgtcgatctgtcgcgacgcccatcct gacgtgatcattgccggcaa gcttcaccgctcgctgcaaccgcagctcgacgagctctacggcgaccagcgcgcggcgcc cgccttgctgacgatcgacg aagattccttcgacgatggcgaagtatcggtacatgacgttcggaacctgctggagcagc acgtcgacctggatcggccg gcgctgctccagtacacgtcgggatcgacgggcgagcccaagggcgtgatcgtcacgcac gagaatctcgtcagcaactg cgcggtgatcgccgagcggctcggccccgatccggatcgcgtcggctgcacgtggttgcc gccgtatcacgacatggggc tgatgggcgcgctgctgctcgcggtgtacagcggctttccgctcgtgattctgtcgccgc agcatttcgtccagcgtcct tatcgctggctcaaggcgatctccgactaccgcgtgacgacgagcgtcgctccgaatttc gcgttcgacctgtgcgtcga caacgtcagtgaagaagaagcagccacgctcgatctcagctcgttgcagcacgtattctg cggcgcggagccggtgagcc acacgacgctcgaacgtttcttcgcgcgcttcggccggcacggcttcgagcgccgcgccg tggtgccctgctacggcatg gcggaggcgacgctctatgtatcgggcaaggtcggccgttcgccggtctcgctgatcgag gtcgacaaagaggcgctcgt tcgcggcctgtgcaagccgcgcgacccggagctcgacgagcacggacgcaccacgctggt tgggtgcggacccgcggcag tcggccatcggctgctgattgtcgatccggcgacgaagcgcgtgctgccggagcgcactg tcggcgagatctggtttagt ggtccgaacgttgcagccggctatctgaatcgtgcggacagcgacgacatcttcgccgcg acgattgccgacgcggacga cggcgatgatccgacgcgctacctgcgcacgggcgacctcggctttctgaacggcggcga gctgttcgtgacgggccgca tcaaggacgtcgtgattgtcgccgggcgcaatctctatccgaccgacatcgagggatcgg tgcaatcggcgcacgacgcg attcgcaccaacggcgtggtggcgttttcgatcgatggcgcgcacggcgagtcgctcgtc atcgttgcggaactcaaacg ctcgcgccgtccaagtgccgagcaaatgagcgaggtgcgagccgcgatcacgttggcggt cacgcgcgaccacggcgtct cgccggcagtggtgcacctgggcccgactggtgcgattccgctcacgacgagcggcaagg tgcggcggcaagcgtgcaag caggcgttccagcagggcagtttgagcgcactcgagacgcgcgcataagcggttcgcacg aaccgcatccccgattttca tcgacgctgtctttcttcggagccagtcatggctgaagcggattccttgtcttcgcgaac accggcggccgcccgtgagg cgcaagccgataccgacgtgcgcgcacgccggctcgcttatctgaccgtgggtattcccg cgctcggtttcgtactggcg attgcctacacgtggatatatgggttgcgcgcaaccgacttcgtgctgttggcggtgatg tatttctcgaccgcgatcgg cgtcgaaaccggcatgcaccggtatttctcgcatcggtcgttcaaggggcggccggtcgt taccgtgatgctgggtgtgc tcggcagcatggccgcccaggggccgatcctgttctgggccgccacgcaccggatgcatc atgcgttcaccgatcaggac ggcgatccgcattcgccgcgcccgcgcgcgaaccggcacggcaagctcagccgattcgcg ggcctttggcacggccacgt gggctggctattcaccgtgcgccgcgagaactggagcacgtatgccgcagacctgctgcg cgaccgtctgatcgtcaatc tcaatttgcgctacgggtggtgggtgctgctcggcctggcgattcccgcgctcgcgggcg cgttgctcgcgcccgccggg cagagcttgctcggggccgtcggcggcttcctgtggggcggactcgcgcggatattcctg ctcgatcagtcgacctgggc cgtcaattcgctgtgccacacgatcggcacccgtccgcacgcgacgcgcgaccatagccg caatctgggcgtgctcgcga tcgtttcggtgggcggcgcatggcacaacaaccatcacgcgcagccggcgttcgccaaca acgatcacgcgttctggcag atcgatccgtccgcctggctcatccgtctgctcgacgcggtgggactcgtcacggaggtg cgctatgcgccgaagcgccg cgcggcgttctcctcaacttcgccgtaatcctctattagcgtttggagaatcctatgaat tcgtcgattcaggttgcccc cggcgtgactgccgccggcgggctgtcggcccccgatggccagatccccggcgtttcgcc gctaaaaggcagtggtgcgc gcgtcaaacgctacacggccctggccgtcatgctggtgccgcttgccgggttcgcgctgg cggtgcgtcaactcgtgctg ggcgacttcgccgtcactgacctggtgctgttcgcggtgttctattttctgcacatgggc gggatcacgatgggcttcca tcggtatctggcgcacaagacgttccggacctcgaagtggttcgaagggctgctgctgat ctgtggctcgatggccgcgc aagggccggtcatgttctgggtgacgacgcatcgccgtcatcacctgtacagcgaccaga agggcgatccgcattcgccg aacctgggcggcgcgggcctgctcgcgaagctgcgcggcctctggtatgcgcacatgccg tggatgctggccccggacgt gtcggggtggacgttcttcgcgcccgatgtattgcgcgatcgccgcctgtttttctatca ccgcacctatgtctggtgga tcgtgctcggccttgtgctgcccgcggcgatcgggggcgcgatcggcggttcctggcacg gcgcttggaacggcctgctg ttcggtggcttcgcacggattttcctggccaatcaggccgcctggtgcgtcggttcggtt tgccacatgttcggcggacg gcccttcaagaccgacgacaacagcgcgaacaactggaccgtcgccatcctcacgttcgg cgaaggtctgcagaacaacc atcacgcgttccccgcgtcgtatcgccattcggtgaagtggtacgagccggatctcagtg cgtgggtgctctggacgctc ggcaaggcgggtgtcgtctgggacctgcgcttgccggggccggccgcgatccgcaagttg gccaagcaaccgtattgaag aaagttgccttcatgaagctgttcatctccctcgtatagaaggattattcatcatgtctc aagctggaatcctgggtggc ctgttcggccgcaagaaagcggtcgccgccgacgtcggccccctgacggaagcgtcgatc cgcagttggctggtcgaccg gctcgcgaagcagctgaagatggaccgggctgccatcgatcccgccaaacgctttgacga gtatggactcgattcgatcg ttgccgtgcaggtgtcgggcgatctcgagaaagtcgtcgagcagcggctgtccccggcgc tgctgttcgaacacaacagc atcgacgagctggcgcgccacctgtcgaccgagctcggtctgcaggctgcgtaagcggga gatcgacatggcgaacacct acactgttccgagcgcgccgccggcgcgtttcgacgaattcctgcaaaaatcgaaggcgc tcgagggcgtgcggctgacc gatgcgattccaaagtcgctgtacgaaccgcgtgcgtggcgtggcgttctcggcttcgtg gtgagctatgcggcgtacat cggcgcgctcgtcggcatcgcgtatgcgccgcactggctgttctacgttccgctgtggct gctcgcgggcctgggcggct gggggctgcattgcatcgcgcacgattgcgggcacaactcgttctcccgctcccggtggt tcaacctgacgatcgggcat ctatcgctgctgccgctgctgtatccgttccatgcgtggcgccacacgcataacctgcac cacgcgaacaccaacaacct cgagctcgacaccgactggcggccgattcccgcgccgctttacgatcgcatgccgctcct caagcgcctcgagtacgccg gtacccgcaagtggctgttctgggcaggtacgttgagctactggaaggaatcgggcttcc gtcccggcttctatccgaag cgcgagatgcggcgcgacgtgaagcgctcgatcggcttcgtgctgatcgtcgcgatgctc tatttccctgcgctgatcta ctttaccggcgtcacgggcctgttcctgtacttcgtcgtgccgtggctcatgatccatgc gtggttcagcgccacgacgc tgatgcaccacacgtcggacgacatcccgtttctgccgtcgcagcactggacgccgaacg cgagtcgcctgctcgtgacg acggactaccggtatccgaagtggctgcacttcatgacccataacatttcggtgcatacg gcgcaccacgtcgcgccgat cgtgccgttctacaaccttccgaaggcgcaggcggcgctcaaggccgcgtttccgggaat gattcgcgaaaaggatttca cgttcggcgatctgtggcacgtgatccgccactgccacttctacgacaccgagtcgggct attaccggaccctgtcccgg gaggcggtggccgtcggcgcgcgtgcggcgacggagggccggtgatggcggccgcgaatc atacggaagtctcgccgatc gtccggcagaccacgaaggcgccttcgttgcgcgtgcggctcggccgtcacgcgttccgg atgctgaacacgttcgcgcc gcgcattgccggacggcgcgcggccgatgcgttcggcttcacgcgtggctacgggctgcc cgtcagcgatcgcataccgc tcggcgcgacggtgacgtccatcgagggcaacgaggacatcgaccgggcgtattactggg agggcggtgcggcgcgggtg ttgctcgtgcacggctggggcaccgacagcagcagcatgctgagcttcgtcaagccgatg aagacgctgggcttttcggt ggcggcattcgacgcgcccgcgcatggtctgtcgccgggcaagcatacgacgatgacgca gttcacgcgggcgaccggcg cggcgctggatgcgatcgaaggcgcgcaagtggtgattgcacattcgcttggctcgatcg cgacgatctcggcgctggcg gagcgctcgcgccgcgcgtcgttgcgctgcatcgtgctgatcgcgccgacgagcgcgctg accgaggtgctggagcgctg ggcgaaccgcgacatggcgttgccgcgcccggtgatcgagcgcatctatgcggagctgca atgccgcaatggcgtgccgg tgagtcattgggacattctggcgcgcggcgcgtcgctcgatgtaccggtgctggtcgtgc acgacccggccgatcccgtg gtgccgtactgcgaggcgcagcgggtagtggcgggcctgccgcaggcgacattgtggccg gcgccgggcacgggtcacgg gcggatcctgtcggatgcgagggtacgcgagcaggtgcgcgaattcgtgaagcgacaaat gtcgaatcttggagagttgg cgggatgagcacgacagcggtggagatgcgcacattgatgtgtctggtgtgcggctggat ttactcggaagaaaaaggtg cgccggaagacggcattgcaccgggcacgcgctgggaagacattccggccaaatggaagt gtcccgagtgcggcgtcggc aaggaggatttcgaaatgatatcgatttga SEQ ID NO: 1 Cepacin BGC sequence [2305843009240116982] (16,590 bp) ccggccatcttccccatgcgggacctgccgcccggcgatgcctcgccgcgagcgcgcagg tcctgaatcaaacacgatcg cgcctgcccgccgccggggcgaacacggcgcgatacgtcgcctctctcccctgcctcgat atctttcctgttgcgatgtc gcgtgcgtgtttcgcgatcccgatcgattcgatcgcgccgcccatccaattttccatcgc aaactggcgccgtcaaaact gttccattaacaagccagttatcgagctggttcgcgaatgtaccgggctggacaattaat acgcggcaatgacaagccgc ttcttccttatttccaaatattttccggacaccggccgaccgctttctttttgatatcgg aaatattcatcggatcattg aaaggcgcttgacaatgtttttctcttgaataaacattcatgcatatacatgcaaacaaa gcagccgagggccgtaacga ttgagcggtacgttccactacccgttccgagcgggaagcggagcatgcgaggcgatggcg tcattccttcgcgcgtgccc cgtttccccgtccatgcgaggaatgcggcctgataccggttatagcgcccagcggcttga gcgcggcccgtagtacgtgt ctcatctgatgttgcagctcgaagtcaaacaacacgctgtgctccggacctggcgatccc ccgatcgccagcgtcccgta tcgccgcgccgtccccacacgtgtcggccggaacggatgagttttgcccgcggaatgaaa aaccgcgcttaaccggtttg tgaagccatttcaaaatccggataactttattaagcgcaagcgtagtttgtatttccgtc tacgtaatcctacgtaaatc ggaaaatgcctgcgtattttgttccggttggattcgagaattcgattttcagtggaacgg accgatacgcgcgatgccgt ggcatttggcgtggcgcatgtcgatgcaacgctttacgtggaaaggatgccgacatgaca catctcgaagtcgcaagccc ggcgctcgatgcgctcgacgcgagccattcgcgccatcgcgccgccgcgacgctggccga gcacgccctcgacacgctgg ccgacgtgctgcgcctgcgcgccgcgacgctgcccgggcagaccgccttcatccacctgg tggacggcgaaggcgagacg cgcaccgtgagctatgccgagctgcagctgcaggcaggcgcgatcgcgcgccacctcgcc gcgcgcggcgtggccggcaa gcgcgtgctgatgctgttcgaggccggcatcgactacatcgccgcgctattcggcgtctg gatggccggcgcggtggcgg tgccctcgttcccgccggtgggcacgcgggcgctggggcggctcggcgcgatcgcgcgcg actcgcagcccgagctgatc ctgaccgattcgcgcttcacccggctgcgcgagcgcgtgctggcgctactgccggacggc ttcccggaggaggcctggac cgaggccgatgcgctttttcgcgccgatacttatgcatatgcatacaatccggccgatgc cggcccggccttgccggtgc tcgatcgcgaggcgctcgccctgctccagtacacgtcgggctcgacctccgatccgaagg gcgtgatgctgacccacggc aacctgctcagcaactgccacggcgcgagccgctggatgggcgggccgcgcgagcgcgtc ggttgcacctggttgccgcc ttatcacgacatgggcctgatgggcggcatcctgcagccgatctacgagggtttcccgac cgtgatcctctcgcccggcc acttcgtccagcagccgctgcgctggctggcggcgctctcgcagtaccgcgtcaccacca ccatcgcgccgaacttcgcc ttcgacctctgttgcaacgcgattggcgacgacgtattgccgctgctcgacctgtccacg gtcgaggcgatctactgcgg cgccgagccggtccggcgccgcaccttcgagcgtttcgccgagcgcttcgcgcgctgcgg cttccgtgccgaggccttcg gcccctgctacgggctggccgaggccaccgtgttcgtgtcgggcaaggtggacggcgccg cgcccgccttcgtcgagctc gaccaggacggcctggcgcgcggcgaggtgcgcgagatcgcggccgatcatccgcgcgcc caggcgctggcctcctgcgg cgcgccggcgccgggccacgacgtgcggatcgtcggtccggatgggcgcgcactgcccga cggcgcgatcggcgaaatct gggtgggcggcccgaacatcggcatcggctactggaaccagcccgagcgcagcgaggaga ccttccacgcgcgcctggaa ggctcggcacaacgctacatgcgcaccggcgacctcggtttcctgcgcgcgggcgagctg tacgtcaccggccgcatcaa ggacctgatcatccacgcgggccgcaatctctatcctcaggatatcgaactgctggtgga ggagctcgacgcgcggatcc gcccgaacggcgtggccgccttctcgatcgacgacggccagggcgagcggatcgccgtgg tggccgaactccggcgcggc gagaaggtggccgagggcgagctgcagacgctgcgcgaggcgatcgtcgagcgcgtcacg cagcagctcggcgccgcgcc gcacctgatccatttcgcgccgatgggcgcgatccccctgaccacgagcggcaagatcca gcgctacgccacccgccacg cgctgctgacgcaatcgctggcgagctatccccacgcacgcgcctgagcccgcgaaggac atcatggacatccagaccca aacctccccctcgcggcccgcgccgctcgccgatcgcaccggcgccaccgaacggcgcct ggcctggctcacggtcggga tcccggccgtcggcgcgctcgcggccgcggcgctggcgatcgtgcacggcatcggctggc tcgagatcggcctgctcgcg gtgatgtacctggtcaccgcgctcggcgtcgaggcggggctgcatcgcttcttctcgcac caggccttcaaggccggccc ggtggtgacggcgctgttcgcgatctccggctcgatggccgcgcaggggccgatcctgtt ctgggccgccacgcatcgca tgcaccacgccttcaccgaccaggaaggcgacccgcattcgccgcgcctgcacggcgagc atctcggcgggcgcctgcgc ggcatctggcacgcgcacgtcggctggctgttcacgctgcgccggcagaactggagccag ttcacgcccgacctgctgcg cgaccgctgggtggtgcgcctgaaccgcctctacttcctgtggatcgcgctcggcctggc gctgccgacgctggccggct ggctgatcggcggcaccggctacgcggccctgacgggtttcctgtggggcggcctgctgc gcatcttcctggtcgaccag gccacctgggcgatcaactccttcgcgcacagcttcggcccgcgcccgaacagcacccgc gaccaaagccgcaacgtgtt ctggctggccctgccggcggtgggcggcggctggcacaacaaccatcacgccttcccggc tctcgcacgcaccagccagc gcttctggcagctcgacctgtcgggcggcctgatcgagctgctggcggtgttcggcctgg tgtgggacgtgcgccgccca gcccccgagcgcagccgcgccacccagtcctgagcgcccgccttccggagattccttcat gacccagctcgatctcaccc ccgcgccaaccctccccgacgaccagccggtgcgcggcgtcagcgtgctcgacgcgcgcg gcgcccgcatcaaggcgatg accgccttcggcgtgatgacgattccgttggccggcacgctggcggcggcctggctggcc tgggccggctacgccacgcg cgtcgacgcctggctgttcgccgcgatgtacgtgctgcacatggccggcgtctcgatcgg ctaccaccgcttcctggccc atcgcgccttcaggacctccccgctgttccgcgcgctgatcctgatctgcggctcgatgg ccgcgcagggcccgatcctg ttctgggtcaccacgcaccggcgccaccacgcctacagcgaccgcccgggcgacccgcat tcgcccaacctgctgggcga gagccgcgcggagcgcctgcgcgggctgtggcacgcccacatgccctggatgatgtcgcc cgagatgtcgagctggagct acttcgcgcaggacatcctgaaggaccgcagcctgctgttcttcaatcgcacctacttct actgggtgctgctcggcctc gcgatcccggccgtggccggcgggctgatcaccgcgagctggatgggcgcgctgtgcggc ctgatgttcggcggcttcgc gcgcatgttcatcgccaaccagttcgcctggtgcgtcggctcgatctgccatcgctacgg cagccgcccgttcgacacgc gcgaccacagcaccaacaactggatcgtggccttcctgaccttcggcgagggcctgcaga acaaccatcacgccttcccg gcctggtaccggcacggcgtgcactggtgggagccggacctgtcgggctggatgctggcg ctgttcggccggctcggcat cgtcgaggagctgcgctcgcccagccgcgacgtgatcgagcgcgtgcgcaagcgcgagcc cggcggcgcctgagcgcgcc gcatcccgatcgtttcgttttgccttgccttcttcaaccctgaggagtacgcatcatggc gttcatgtcgagcctgttca gcaagatcggcttcatcgaggaaaaacgttcctcgaccccgctcaccgaggcgggcatcc atcaatggctggtcgagcgg ctggccaggcaactcaacgtgccgatcgcgcagatcgatccggcccgcagcttcgagtcc tacgggctcgactcgctggt cgcgctgcaggtcgcgggcaatctcgagaagctgctcgagcagcgcctgtcgccggcgct gctgttcgaacaccagaaca tcgacgacctggcgagctatctcgccgccgaactcgccaccggcgagatcaaggcctgag gcccaccaaggagcgaaccg atggcaaccatccaactaccgcagcagcagaccccgggctttcgggacttcgtgcagtcg atcaagtcgctcgacggcga gcgcctggccgacgcgattccgcgcgaactctacgaaccgcgcctggcgcgtggcctgct gggcttcttcgccagcaccg cgctctacgtgggcgccgtgatcggcgtgcactacgcgccgcactggtcgctctggatcc cgctctggctgctggccggc ctgggcggctggggcctgttctgcatcgcccacgattgcgggcacaactccttctcgaag agccgccgcttcaacttcgc gctcggccagatcgcgctgttcccgctgctctacccgttccacggctggcgccacatgca caacctgcatcacgccaaca ccaacagcctggagatggataccgactggcgtccggtgctgccggagcaataccgccgca tgggcgcctgggagaagttc gtgtaccgcagcacgcgcagctggctgttctggctgggcacggtcaactaccagcgccac tcgggcttcaagcccagcat gttccccaagcgcgaggcccgcaacgacgtgcgccgctcggtggcggtcacggtgctgtt cgccgccgtctacctgccca ccctggtctggttcacgggctggcagggtttcctgctgtacttcctcggcccctggctcg gcatccacgcctggttcagc accaccacgatgatgcatcacatctcggacgaactgccgttcctcacgcgcgagcactgg agcctgaacggcagccggct gatgatgaccaccgactacgagtacccgaagtggctgcacttcttcacccacaacatctc ggtgcatgccgcccaccacg tggtgccggtgatccccttctacaacctgcccaaggcacgcgaggcactcaagcgcgcct atcccggctcgatccggcag aagccgttcacgctcggcgaggtctggaaggtgatccgcgcctgccatctctatgacccg gtgcacggctactaccgctc gttcgaggcggtcgccacgccgcccgcggccaccccgccgcgcgccgattcggcgatctg agcccactacctgagccaac tacccggcttcatcaggccacactggcaggagaaggacgatgtccaacacttccgagtca tccctcccgcacggcgcggc ggccgccgccgcgccggcgccttcgccggcacgcgcggcgagccccgcgatgtcgttcgg caagcgcgtgctcaagggct acgtcggcgcgctcggcgcggtctcgccggcggccgccgcgcggcgcgccaccgacctgt tcggctatacgcgcaccttc cgcaagacgccgcccaaggacatgtcgccgctcggcgcgcgccgcttcgagatccgcggc gtggacggcgtcacccacgg ccatctgtggggcaagggcgagcgcaccgtgctgctggtgcacggctggggcgccgacag cgccaccatgttctccttcg tgcccaagctgcagaaggcgggttttcgcgtggccgccttcgacgcgccggcgcacggcg tctcgcccggcacggtcacc accatgacggccttcaagaacgccgtgaagggcgcgatcgaatcgctcggcggcgtgcac ggcatcgtctcgcactcgct gggcagcatcgcctcgaccggcgcgatggccgagctcgggcccgacagcgtggacggcat cgtgatgctggcgccgccct gcacgctgccggcggtgatcgaccgctggtcgggcgacttcctgcgcctggcgcccagcg tgatggacgcgatgtatgcc gagctgcatcgccgcaacggcgtgccgccccagcactgggacatcggcgcgctgggccgg ggcctgcgcacgcggatctt cgtgatgcacggcccgaacgacaagatcgtgccgatctgcgaatcggagaacatcgccgc ggccttgccgcacgtgcgct tcgagcgcgtcgagaaggtcggccacgtgcggatcctgtcggacgcgcgcgtgatcgagc gcgccacccagttcctcgcg atcggcggcgagccggcggcgaacgcgccgtcgctggcgccggccgcgggctgagccgag gggaccaccatgctctatcc cgaactgtaccgaagcctggaacgcgcgcgctgggacatgcagcacgacgtcgactggga ccgcttcgacgcctcgctgc tgtccgacgagcaggcgctgtcgatcaagatgaacgcgatcacggaatgggcggcgctgc cggccaccgagatgttcctg cgcgacaacgtcgacgacagcgatttctcggccttcatgtcgatctggttctacgaggag cagaagcattcgctggtgct gatcgagtacctgcggcgcttccgtcccgagctcgcgcccaccgaggacgagctgcacgc ggtgcgcttcccgttcgacc cggccccggcgctggagacgctgaccctgcacttcggcggcgagatccgcctcaaccact ggtatcgctgtgccgcgcac tggcacaccgagccggtgatccggcagatctacgagctgatctcgcgcgacgaggcgcgc cacgcggccgcctacctgaa gtacatgcgccgcgcgctggaccggcacggcgacgaggcgcgcctggccttcgccaagat cggcacgctgatggccagcg ccaaccgcgcggccaaggcgatccatccgaccaacctgcacgtgaatcgcacgctgttcc ccaacgacacggtgcagagc cgcctgcccgatcccgaatggctgggccgctggctcgacacgcagatccgcttcgaccgc gactgggagaaccgcgtggc cgaccgcatcctgcacaacctgtcgatcctgctggagcgtccgctgctcaacgtcaagga cctccacaagctgcgcaagc agctgcaccagaacctggaaggcgcgagcgcgggcgcggccgccgccgagcctgccctgc agcactgatccggagaacgc ccacgatgtccgaactcaccgtcgaataccgcacctggatgtgcctgatctgcggttacc tctatgacgaacgaagcggc gacccgaacgccgggatcgccgccggcacgcgctgggaggacattcccgacgactggcgc tgccccgaatgcgacgtgcc caagctcgacttcgagatggtctcgatctgaggcgcggctgcccgagcgccatttcccaa gacaccaaggactccccacc atgcaatacagcgacctggcgacacccgatttcctgaagaacccctaccccgtgttcgac gcgatgcgcgccgagggcca actggtcaagctcgcgcccaagctctacgcgacctcgcactacggcttcggcgagaagct gctgctcgaccgccgcttcg gcaagggcatcgtcgaggcggtcaaggcgcgctacggcgagggcgtgatcgaccagccgc cgttccgcaccttccgctcg atgctgccgggcctgaacccgcccaagcacaccaacctgcgcgcgctgctgatgaagtcc ttcaacgcgcgccaggtcga gaagttccgcgaggcctcctacaccatctcgaaccagttgatcgaccggctggtgaagga gccgcagggcgacctggtga ccggcttcgccttcctgctgccgatgcagaccatgtgcaccatcctcggcgtgccgctgt cggacggcgcgatgttcaag cgcgccgccgatcgcgcggccggcgcgctcaacgtcacgccgctcaacgccgagcagctc gaggaatcgcgcaagtcggc gatcgaactcgaaacctacttcgccaaggtgctggccgagcgccgcaaggagccgggcga cgacctgatctcgcagatga tcctggccgaggaagacggccagcgcctgaccgacgacgagatcgtcgccaacctctgct tcctgttcgtggccggccac gagaccaccgagaacatgatcggcaacacgctgatcgcgctgcagcgccatccggagcag cgcgagcgcgtcaaggccga cctctcgatcatgccccgggtggtgaccgaggcgctgcgctacgacagctcggtgcagat cgcccagcgcgtggcgctcg aggaggtcgagctggaaggccagacgatccagcgcggcgacctgatctgcgtgttcctcg gcggcggcaatcgcgatccg gagaagttcgagaacccggaccggctcgacatcgaccgcgagaacgtgcgcccgctctcc ttcggcggcggcctgcacta ctgcctgggcgcgcgactcgcgctgctggagatcgcggccgcgctggaggtggtctacac gcgcctgccgaacctgcacc tgaccaatctcgacgtgctgccctatcgccgcaacaacgcgctgcgcggcgtcgattcgc tgctcggcacctggtaggac acgcggcgcgcgccgcatgagcgaggcgccgtgattgctgcacgcaaggcagggccgcgc gggccatcgcgccgcgccag gctccggcatgcccggcgttcgggcatgccggaattcggcctcttcatatgacgatgacc atctgaaaccggcatgaatc gccgcgatcgttgcgcatgcaacgcatgatcccggcgaggacggccaagcaagccacgcg aaggagaacctcaacttgag cgagaaccaaacgggcgcgacggcactgccgggcgccgccgacggaaaaccgaaacgcaa gcgcaagctggtgctgccgg tgctgatcgtgctgctggtgctgctcgccggctacgcgatctactggtggctgcacgggc gcttctacgagaccaccgac gacgcctacgtgggcggcaacatcacggtgatctcgccgcacgtggcgggctacgtgtcg gagctgctggtggaggacaa ccagcgcgtgcgcgccggccagccgctgctgcgcctgcagcccggcgatttcgccgccgc gctggatgccgccaaggcca acgaggcggccatgcgcgcctcgcgtgcgcaactgctggcgcgccgcacgctgcagcaga ccctgatcgaccaggccggc gccgaagtcgcggagaaatcggccgcgctgtccttcgcccggaccgacgcggcgcgctac cgcaacctgctcagcaccgc ggcgggcacgcgccagagcgaggaacgcgccagcgccgcgctcaagcaggcccaggcgca gctcgattcggcctcggcca agctgcgcgaggcgcgccagcaggtgggcgtgctcgacagccagatcgccggcgccgatg ccgcgatcctgcaggccggc gcggcccagcgcaccgccgagctgaacgtcggctacaccgagctgcgcgcgccgatcgac ggctacgtgggcaatcgcgc gatccacgtgggcagctacgtgacgcccggcacccagctgatgtcggtggtggccgccag gggcctgtgggtcgacgcga actacaaggaggaccagctgcgccacatgcatgccggccagcgcgccaggatctgcgccg acgtgcagtcctcgcgctgc ttcgagggtcgcgtgcacctgctggcgccggccaccggcgcggtgttcagcgtgatcccg ccgcagaacgccaccggcaa cttcacgcgcatcgtgcagcgcgtgccggtgcggatcagcttcgagggggccgacggcgt gctgggcgtgctgcgcccgg gcctgtccaccaccgtgacggtcgacacccacggagcctcctgatgagcgagctcgccaa gcgccccgccggcgcgccgg ccgagggcacgcccggcgcagccggggccggggctgcttccggctcgccgccggccgccg cgcatccgcccgcctggccg ttcgcggtgatgtgcgtgggcatgttcatcgcgctgctcgacatccagatcgtggcctcc tcgctgcaggagatcggcgg cggcctgagcgcggcgcaggaccagatcggctgggtgcagaccgcctacctgatcgccga gatcaccgtgatcccgatgt cgggctggctcacgcgcgtgttctccacgcgccgcctgttcgccggctcggcgctcggct tcacggccgccagcctgctg tgcggcttcgcctggaacatcgagagcatgatcgtgttccgcgcgatccagggcgtgctg ggcgcctcgatgatccccac cgtgttcacctcctcgttccactacttcgacggcaagcggcgcgtgatcgcggccgccgt gatcggcaccatcgcgtcgc tggcgccggcgctcgggccgatcgtcggcggcttcatcaccgataccgccaactggcgct ggctgttctacgtgaacctg gtgccggggctgctggtggcgctgggcgtctcgctggcggccgacatcgaccggcccgat cacgggttgctcaagggcgc cgactacgtgggcatcgcgttgatggcggtattcctcggcacgctcgaatacgtgctgga ggaaggcgcgcgctggaact ggctcgacgaccccatcatccgccgctgcgcggtgatctcggcctgcgcgggcagcgtgt tcgtggcgcgctgcctgagc atcgacaacccgatcgtcgatctgcgcgccttcggcaaccgcaacttcacgatcggctgc atcctgtccttcctgaccgg cgtgggcgccttctcgtcgatctacctgacgccgctgttcctcggctacgtgcgcggcta cgacgcctggcagaccggcg tggcgatgatgccgaccggcatcgccgcgctggtgggcgtgccggtctacgtgatgttcg cgcgcaagaccgacctgcgc tggctgatgatgttcggcatggcgatgttcggcctgtcgatgtgggacttccgcttcatc acccacgactggggcaacca gcagttgctctggccgcagctgatccgcggcttcccgcaggtgttcgcgatcgcgccggc ggtcacgctcggcctgggca gcctgccgcccgaacggctcaagtacgccagcggcctgttcaacatgatgcgcaacctgg gcggcgcggtgggcatcgcg atcgtcggcgcgatcctcaacaatcgcaccaacctgcatttcaccgatatcgcctcgcgc ctgacggccgccaaccagcc gatgaacaagatgctcggcacgctggaggcccagctcggcccggcgctcggctccgccca ggccggcgcggccgcctcgc tgcgcgagctgcacgacatcgcgttgcgcgaggcgcagaccatggcctatggcgacgcgc tcaccaccatcatgatcggc ttcatgttcgccaccctgatcgtgccgctgatgcgcaaggtggtgccgccgccccccgat tcgtcgaagaacgctcactg aggcgcctcccaatgtcacgaactcctgatcattcgtttgcgcggccgcgccgcccggcc ctcgcgcggccggcggcaat ggccgccgccgcgctggccgcgtctctcctgggcggctgcacggtcggccccgactatcg gccggccgactcgccgctcg cgccgaactatgccagccaggatgcgctgcgcacgctgcaggcgcggcccgcggccgaac cggttgcgctcgatgcctgg tggctcggcttccacgatccggtgctcacacaactgatcgagcgagcgctggcgcagaac ctcgacctggccgccgccga ggcgcgcgtggcgcaagcgcgcgcggcggccgccgatgccggcgcgcagcggctgcccag gctcgatgtcgagggcacgg cggcgcgccagcggcagtcgctggaatcgccgctgggccggatcggctcggccctgcccg gctacgatcgcaaccagagc tatacccagctcggcctgggcgcgagctgggagctcgacctggccggcggcctgcgccgc caggcccaggccgccagcgc cgaggccgaggcagccgaggccctgcatgccggttcgcgcgtctcggtggcggccgacgc ggccgatgcctatttccggc tgcgcggcctgcaggcgcgcatcgccatcgtcgagcagcagatcgaggccgatcgccacc tggtctcgctggtccgcgat cgcgtcggcaacggcgtggcgacacggcgcgaacaggccgaggccgaggcgcggctcgcg cagacgcgctcgcagcgtcc gcccttgctggccgaacgcgcgcgccaggccaaccggctggacatcctgatgggcgccgc gcccggcacctacacggcgc agctgggcacgccggccgcggatccggcggtgccgggcctgccggccgcaatcggcccgg acacgctgctgcgccgccgc cccgacgtggtggcggccgagcggcggctggcggcgagcaacgcgggcatcggcgcggcg ctggccgagtactacccgaa gctgtcgctgtcggggatcctcggcttcgaggcgctcgacgggccgctgttcaagtcggc cgcgttccagcccggcgcgc tggccgggctgcgctggcgcctgttcgacttcggccgcgtcgatgccgaggtggcgcagg ccagggggcgccatgccgag gcgctcgccgtctaccgccaggccgtgctgcgcgcggccgaggatgtggagaacgcggtg accgactgggcgcagatcgg tgcccagcgcgacgagctcgcgcgccaggtggaagccgaggcgctggcccagcgcgcggc gcgcgatgcctatgcgcaag gcgacgcgagcctggtcgaggtgctggtggaggaccagcaatggctctcggcgcgcggcg agcaggcgcgcctgaacgcc gactacgcgcgtgccgcggtggccaccttccgcgcgctgggcggcggctggacgctgccg gaaaccgccccggcggcact cgccgccagttcgcgccaggatcccccggccccatgaaaaagcacgcgcagcctgtcaaa accgcgatggtggcgatttt tccttgtcatagaatacgggcaacgtattccgcatttccccatccgacgaggagagcaag tc SEQ ID NO: 2 Caryoynencin BGC [2305843009240116981] (14,302 bp) atgaaagcactcacattcaaacgctatggcaaatcacccgagatcgggttcgccgaagtg ccgcgccccacgctcaagcc cgacgaactgctggttgaggtgcacgccgcgggggtgaacccgatcgacaacatgattcc aacgggaatgttcaaacccg tcttgaaggtccagctgcccgcgaccatgggtagcgatctggctggcatcgtgatcgatg ttggcagccgcgtcactcgc ttcaagaaaggcgacgccatctttgcaagtctgttcgaccttggaagaggatctatcgct gaatttgccgtggtaccaga gagcgctgcagccccgaaaccggttgatctggacttcgtgcaggccgcctcggttccaat ggtcgggctcacttcatggc aagcactgaaggagcgtgccaatcttcagccgggtcagaaggtgttcattcccgcggggt ccggcggtattggaacgttt gcgatccagttggccaaatatttcggcgccaaggtgggaaccaataccagcacgggtaat atcccgttggtgaaaagcct cggcgcggacgaagcaatcgactacaagaagcaagcgttcgagaaagtgctgcgcgacta cgatgtggtgctgggaacga tcaggggtgacgcggttgaaaaatcggtaggaatcctgaagcggggagggaagatcgtct ctcttatcgggccgctggac gcagcgtttgcccgtgctcgcgggctgaacttcgtcctgaggtttgtattcggcctgatg agccgaaagatcatgcgtct tgcgagaacgcgggacgttacctactcatttctcttcgtacgccccgacggtactcaact cgccgagatcggcaaactgc tcgaatccgaacgtatccatcctgtgatcgacaaggtatttccgtttgaacaagcaaagg atgcacttgaatacctggcc caaggacgcgccaagggcaaggtcgtcgtcaggatcaagtgaaggaacgcgacgaacgcc gcccaaggcctcgaacagcg catgtctcggcgttcatcggtggtgaagcgtgggcagcgtcaacgactgactcacgcatc gccgctcactcgcggcggcg cggtcgagcggctggctcggcgacgcggtcaacccagccccggtagaacgcgcggtactt gagcacgagcttgtcgtact tgctgtacgcgccaccgccgtccggcttcatcccgttccagatcttgacgtcgtatcccg cggcctgcttggtctgcaac ccgaatagcacgaagtcggtcgcgcggcgcaggatgccgcccaccttcttgatcgagatg agcatgtgcatgacgttctt gccgtcgctcaccggcgtcacgcactggagcagcttgtatttgacgtctccgtccagtgc gaccgtcatgacgcacccgc ccgggtagccatcgaagtgcaggttcatctgcgacatgtccatgccgagcgcgcgcgaca gcatgccgaggggcccgaag taccggttcacggtgaagtcgatcccggcaccgaaccacgcgcccgcccgggccagtgac tcgacctccggccacgggcg ccaatcgtcgaagagcttgagctcgaaggcggaaatcggaagcgcgtgcacgggagtcgc gtgctgcgcgtcgtagaagt tctcgacgatccgcaacaccgccgtcgtcgtctcgaacgcgaagtgcacgtgcatgaagt cgccgttgtcgacgtcggcc gcggcgatttcgggcagcgggtgcagcggctgcggcgagccgtaccagacccacacgtag ccgtatcgctcggcggtgac caacgtcggctggcgcgccccgcgcgggacgggctccagccggctcaccgcctcgctgtg gccggggatgtgaacgcact ggccctgctcgtcgtagcgccagtggtggaacgggcactggatgcacccgtccttgatct gcccgtcggccagattcgcg ccgaggtgcgcgcagtggcggtccatcaccacggcccgccccatcgtgccgcgccacgcc acgcacggacggccgaagag cgtcaactccgtcggcttgtccttgagggcgtccgagcgcatcgcgacgtaccagctcgc ggccacgcgcgtggtcgcgt cgtacgctgcgtggggaggctccttgacgctcggttgatcgaattgaatgtcgtccatcg ttttttgtgtggtcgtcggt cgattacttcagcgccaggccgatgcgggtcgtgatgtacgccttgagcagcgcgaacat cgggttgtagtcgaagtact ttttcacctctgccggcgcgctggtttgcgtccagtacatcagcttcatcgccggcagca ggctgtacttcgagttgttg agctgcggcttgtcccccgtgatgcagtacccgaagccgaacatcggcttggcgaactcc cgttcgtcgatgagggcgtg aatccgcgccgcggcctcgtcggccggcttgcgcccggcgctcacggcctcgacctcggc tttggcgtcgttgaacaact ggtagtactcctccatgtccgcacacaggtacccgaggtacggcgggtcgttgtcgaggt gatcgaggtcgccttcgtcg cgcgacgcgcggaacctcgcgtgggcttgcacgagccggaactgcccgaggatcgtgccg accgcccacagcctgtggaa cgcgtcccacagccggaagtccttgaacgccgtgtagcagcagctgacgaagtcgtcgtt gtggtccaacagcttctgct gcaggcgctcgatgtactcgaagcgctcgggggagaagtcgtcgtcgcgcaacgccttga tgaggcgcgccgcgagcgcg tggatcgtcaccgcggtgttctcgagcccccgggagaacagcgggtcgatgaacccgttc gcgtgcagcatcaggcagta gcggtcgccgacgcaggcgctcgacgagaattgcaggcggtcggtcttgacccagtcgcg taccggcacggcgtcgcgga actgcgcaccgatgctcgggaaccgcgcgaggaactcgtcgaattcctgctgcgcggaga tgtccgttttcgggtagaca cgcgggtcgagctgcaggccgacgctcaccaggttgttggtcgaccgcgggtggttgttg aacggaatcacccacagcca gccgccctcgaacatgtggtgcaaggtcccctcgtgccagcgccagcgctgccccttgac cttgaagatgtcgtcgaacg gcttgaccccgagcatgtgcgtatagaggctgcgcgagtgcgtcttgaagcgacacggct cttcgcggagcccgaacttg gtcgcgagcggcgcgcggggcccgccgcagtcgatcatgtaccgaccggtgaaccgatcg ccctgggcagtggtcaccgc gacgccgtccttgtccgcgtgatattcggtcacgctcgtcttctggcggaccgtgcagcc gtatttgatggcggcttgca acaggtaggcgtcgacgtcttgccggtaataatggctctccggaccccacggcagctcgg gaatcacgcactgcgtgaac tccttcgggtcgtgctcctggccgggcttgtggaacacgaagccgaagttgcgcttgatg cccgtgctcgacgcgacgta acgctgcgtcgagtagaacgacgtgatgtggtcgagctccggaatgccgtagcgatcggc gatgatccggttcatgagag acgtctcgggaatcgacgactcgccgatcgtgaaccgcgggtgcgacgactcctcgatga tcagcacccgaaactgttgt ttggccaggatggcgcccatctgggtgccggacatgcccgagccgaggatgatcacgtcg aagtggttgctatcgcgccc gttcgcggggctcatctgagtcatgggggcaaactctccttgtgagatggaacacatggc cgcgtgcgtcaggattggtc gagcgcggcgcggatgcgggaccgcgcggcgcgcgtgagcgtgagtagatcgccgagcat gctgggcgcgtaccccccgc tgccgatgcttgggccgcttcgaccgacttcgtacgcccgctcggccaatttgacgtgag gcgcccggaagcgcagcagg acctcgaagacccggtcgagggccgccagcccggcccggacgggctcgccccgcgtgccg accacttgcgcctcgccaag cgcgcggtcgacgagcgccggctccccggcgaaccgcgcgtagaccgccctgaatgcggg aagcacgtagggcaggtacg tctccttgaattctcgataggcctggtggtccgattgcgagccccacagcacgtgctcca gcacgaagaggggcatttcc acggcaccggggccgaggtagctctggcctccgattcgaatcggttcgtagaaggggcgc agctcgtcgtagaaaacctg cagcgagatgaagcggtaggcgtatacgatcgattcgaccattttctgcagataggctgc cagctcgtcgcagccttgcg cgaacgcgggcgagcgcagggacacgtcggacagctcgacggtcaccgcgatggccgcct cgagggccgccatcgagatg cgcacgctctcgagcaggtgcgcttcgtcggggaggccggtgtagctccgttgcgcgtcg gccgccgcggggttccagac cgtcacatgcaggagcgtctcgcgcggcggcaggtcggtcgcgcgcgccaggtcgagcag caccggctcgagccccggca ccgcgtccgcgggctcgtgtccgtgccgcttgagcgacccgaggaagaacccgatgtccc gcatcgcggcggcggcttcg acgaagccccagccggcgggcacgccgcgcgtcgggagaaactcgcgcagcaggccgacg atgccgggcacgtccttttt acagttcaggcccggcagctgcagaacgagcgcgcgcgcctgcagcggatcgcaggccgc caccgcagcgtgcgtggccg cgaatgcacctacccggtcaagggtgcgctccactacaggatttcctgcgccgcgagcgt ggacccgcgctggctgagag acagccccgcgtcgccgtcgcgcaacgagcgcaggtagtcgtagttcgtcggcaggctcg tgcgcagacgctcggcctcg cgccggatgctggcgaacatcgcctcggccttctcgatcgactccggtcggtgctgcaag agcggcagcgaccggtcggg cagcatgcccaagccggcaaagatgcagtagtagttgccgttcaaccagaagttcttgaa ctcgtagtcgaaggtttcgt agtatgtcgaatcgtcgaacgacgtggtggtcagcggcagccccgccttgtagcgctgaa ccttctccttgatggcgtcc gaaagccgcaggtcgtgccggttcgcgagccagaacggcgtgtcttcgcgcgacgtggtg aagtagtgcgcctggacgaa atcccggcagtcgtcgaacatgtagacgatctcggcgttgaatgcgtcgctcagccgcgg gtcgaacgaggtgtcgggga agtgcttcacgagctggtaaagcgccgcgtagataaagtagattcccgtcgattccagcg gctccaaaaagcacgacgac agcccgatcgacacgcagttgttgacccacgcccgcctgttgcgcccgacccggaacttg atctggttgagcggctgatt gtccgagaggccccagaggttgaggaagtcggcggtagcctggtcgcgcgacgtgaactt gctcgagaagacgtagccgc tgccgaaccggcccagcatcggaatcttccaggtccaccccgagttcatggcgatcgccg aggtgtacggctcgatcccg tcgcgcgcgtcgtcgttgggcacggcgctggcgaccgcgctgtcgcacagcaggtggtcg gacatgtcgatgaacggctc cttcagggcctggttgatcaggagcccccgcatgccggagcagtcgatgaacaggtccgc ctccagcgtgcgtccctcct tggtggagaggctggagatgtagccgcgctcgttcaggtgaacatccacgacttcgtcga ccacgcgcttgaccccgcgt tcgacggcccagcgcttcaggaagtcggcaacaagatgcgcgtcgaagtgccacgcgtgg gacatctggcgcgtgccgtc ggccaggcagggtgccagcttgccgtcgagcgcgccgggctgcggatagcacgcgtactc catcggctgctggaagccct gctcgcgcttgcgcagccagtagtgggtaagcggcacgccgtcgcagttcggcacgttgc cgaacagatggtagaagtga tcgtcgcgcgaggggtcgggagacttcctccagttcacgaacttgatggcggccttgaac gcaccgttcacctgcggcat ccactcccgctccggtatcccgaggaagtcgaagaacaccttctgcaaactcgggatggt tgcctcgcccacgccgatcc gggggatcgccgcggactcgatgagcgtaatgttcgcctgctgctggagcgcccggacga ggtacgaggcggccatccag cccgcggtgccgccgcccacgataacgatattcttgatcggattgctcatgccacctttc ccataggatttaaaacctca atggatagtgacgccttatcgagttgaacgcgcaactcgtccggtaacgcgtcataacgt gtctgattcatcgcgataaa tgacaccgggaaggcgtggtgaatcgcggcaagggacgtccctccgcgcaaaatccggac atcattgggtacagtcccag aatttgatctgaggctgttccgctctcaattcagatagagaagcacaatcgaataatgct aggcgcccattgcagcggcg gcacaccgcgcaagggcttatcgaggcttgtcaggccatacatgtaaccgcaccgacgca ccatagcagtgttcacgatg gcacgtctcgcaaaatttcatatcaatctcggttaatccagagaaatactcaatatcggc gaggcatccgataacaaacg atttaattttttaaaaatgagaaatttacttttccgttgcgggtgtgcgcgtcaaacaat ttattgtataaaaattcgaa atgaccgacttaattgacgggggaataacggtgtcgacatttccgaaacaaaggtgtcaa ttggccctggctcaagaaat agtccggtttaaaagtggagaaattcggaggaccggggccttctgagttgctccgattgg gctacctcgaagaggaaaac acgaagctgaaacgactcgtggcgaacccgagccgggacaggagaagcggcaggaagtag caccccaccccggtactaac cctgattaaaaaatcttatcgcggtgaaaaattccgcatcttattgagccgatatcggct cgctatagtggctcgctttc ccgcacgcaccctccgcgtgcggctgacacgctgacgatcagcaggagccgcttgatgac caccgacgtccgattcaccg aaatcgacgatctcatgcccgccgccggcgggctgcgcgagatccgccaccacattcacc accacccggaactcgcatac gaggagcacgagacggccgcgctcgtcgcggacaagctcgagcaatggggctggcaggtg acgcgcggggtcgggcagac gggtgtggtcggcacgctgcgggtcggcgacggcacgcgcagcatcggcatccgcgcgga catggatgcgctgccgatcc tcgaggcgacgggcctgccgtatgcgagcggcacgcacggcaagatgcacgcatgcggcc acgacggccacacgacgatg ctgctcggcgccgcgcagcacctcgcgaagacgcgcaacttctccggcaccgtgcacctg tatttccagccggccgaaga gcacggcgtcgacagcggcgcgaagaagatgatcgacgacggcctgttcgagcgctttcc gtgcgatgcggtgttcggca tgcacaaccatccgggcgcggcgcccggcgtgttcctcacacggcgcggcccgttcatgt cggccggcgacaaggcgatc atctcgatcgagggtgtcggcggccacgcggcgcggccgcacctgacggtcgacccggtg gtcgtcgcggcgagcatcgt gatggcgctgcagacgatcgtcgcgcgcaacgtcgacccgtctcagccggcggtcgtcac ggtcggctcgatgcacgcgg gcaccgcgaacaacgtgatcccgaacggcgcgcgcctcgaactcagcgtgcgttcgttca gccccgacgtgcgcgcgctc ctgaagcgccgcatcgtcgagctcgccgaatcgcaggccgcgagctacggcgcgatcgcg cacgtcgagtacatcgaagg ctatccggtcgtcgtcaatacggatgccgaaacggatttcgccgcgcaggtcgcgcgcga gctggtcggcgacgcgcacg tcgtcgagcaggccgacctgctgatgggcagcgaggatttcgcgttcatgctgcagcagc ggcccggctcgttcgtgcgg ctcggcaacggcgaaggggaagacggctgcatggtgcacaacccgaagtacgacttcaac gatcgcaatctgccgatcgg cgcggcgttctggacgcgcctcgtggagcgttacctcgggcagtaa SEQ ID NO: 3 Pyrrolnitrin BGC [2305843009240118600] (8766 bp)